CN106011134B - The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application - Google Patents
The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application Download PDFInfo
- Publication number
- CN106011134B CN106011134B CN201610459379.1A CN201610459379A CN106011134B CN 106011134 B CN106011134 B CN 106011134B CN 201610459379 A CN201610459379 A CN 201610459379A CN 106011134 B CN106011134 B CN 106011134B
- Authority
- CN
- China
- Prior art keywords
- tcr540
- chinese cabbage
- genes
- clubroot
- crb
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Molecular labeling TCR540 is isolated the invention discloses a kind of anti-clubroot CRb genes of Chinese cabbage, its nucleotide sequence is as shown in SEQ ID NO.1, TCR540 and CRb genes isolate, and can be used for the molecular marker assisted selection that Vegetable Crops of Brassica includes Chinese cabbage and the anti-knee ospc gene of green stem vegetable.Simultaneously using these labels during assisted Selection, Choice Theory accuracy can reach 100%, and the label is reproducible, and reliability is high, and testing cost is low, time saving and energy saving.
Description
Technical field
The invention belongs to biotechnologies, and in particular to a kind of anti-clubroot CRb genes of Chinese cabbage isolate molecule
Mark TCR540, primer and application.
Background technology
2002, this seminar obtained Chinese cabbage Doubled haploid line ' the CR Shinki DH ' of 1 part of anti-rape clubroot
System, research shows that disease-resistant anti-2,4 and 8 (Piao etc., Conversion of AFLP of rape plasmodiophora brassicae biological strain of material
Marker linked to clubroot resistance gene into SCAR marker.2002, J Kor Soc
Hort Sci 43:653–665).Further research has shown that anti-knee ospc gene is dominant single-gene, and is named as CRb (Piao
Deng SCAR and CAPS mapping of CRb, a gene conferring resistance to
Plasmodiophora brassicae in Chinese cabbage (Brassica rapa ssp.pekinensis),
Theor Appl Genet, 2004,108:1458-1465).
During Vegetable Crops of Brassica anti-clubroot kind transformation, the method that per generation is required for using Field inoculation pathogen plasmodiophora is reflected
Determine the genotype of intermediate materials, and environmental condition influences whether the selection of correct intermediate materials, certainly will influence in this way transformation into
Journey, therefore the problem of disease-resistant variety transformation hardly possible thoroughly solves not yet.Molecular Marker Assisted Selection Technology (MAS) may be final
Solve the problems, such as this effective way.
Currently, domestic Agricultural University Of Shenyang Piao Zhong clouds seminar obtain it is chain with the anti-clubroot gene C Rb of Vegetable Crops of Brassica
It marks (2004,2014), including TCR01, TCR05 and TCR09, sees (Piao etc., SCAR and CAPS mapping of
CRb,a gene conferring resistance to Plasmodiophora brassicae in Chinese
Cabbage (Brassica rapa ssp.pekinensis) and TCR108, TCR30, TCR74, TCR79, are shown in (Zhang
Deng Fine genetic and physical mapping of the CRb gene conferring resistance to
Clubroot disease inBrassica rapa., Mol Breeding, 34:1173-1183).But these labels are not
The label isolated with CRb be easy to cause Linkage drag when carrying out molecular marking supplementary breeding using these labels.
Invention content
Isolating molecular labeling TCR540, draw the object of the present invention is to provide a kind of anti-clubroot CRb genes of Chinese cabbage
Object and application can carry out seedling stage assay to plant to be measured using the molecular labeling, to reduce Linkage drag, it is anti-to simplify Chinese cabbage
The transformation program of clubroot kind.
Molecular labeling TCR540, the great Bai are isolated the present invention provides a kind of anti-clubroot CRb genes of Chinese cabbage
The nucleotide sequence for isolating molecular labeling TCR540 of the anti-clubroot CRb genes of dish is as shown in SEQ ID NO.1：
5’-TGACATTGTTGATGTGCTGATAAAAAAATCAGTAAGTCTAAGCAAATGTATATATTTTAGTTCTAT
TGGAACTTTGGATTACTGCTTTCTTCGCTTAGAAAAGTTTGCATTTTTACTTCAGGGAACCGAAGCAATTGAAGGCA
TATTT-3’。
Isolate molecular labeling TCR540's the present invention also provides a kind of above-mentioned anti-clubroot CRb genes of Chinese cabbage
PCR specificity amplification primers, including：
F TCR540:5’-TGACATTGTTGATGTGCTGA-3’
R TCR540:5’-AAATATGCCTTCAATTGCTTC-3’。
Molecular labeling TCR540 is isolated the present invention also provides a kind of anti-clubroot CRb genes of Chinese cabbage, in molecule
Application in marker assisted selection.
Molecular labeling TCR540 is isolated the present invention also provides a kind of anti-clubroot CRb genes of Chinese cabbage, in great Bai
Application in the anti-clubroot molecular marker assisted selection of dish.
Answering for molecular labeling TCR540 is isolated the present invention also provides a kind of above-mentioned anti-clubroot CRb genes of Chinese cabbage
With method, specifically include：
(1) genomic DNA of CTAB methods extraction detected materials is used
(2) PCR amplification
A. reaction system：The content of 10 μ L systems, each component substance is respectively 15ng template DNAs；5pmol·L-1Primer；
1.0mmol·L-1dNTP；1.0uL 10×PCR Buffer；0.5U Taq archaeal dna polymerases；ddH210 μ L of O polishings, mixing, from
The heart,
Wherein the sequence of primer is F TCR540:5 '-TGACATTGTTGATGTGCTGA-3 ',
R TCR540:5’-AAATATGCCTTCAATTGCTTC-3’；
B. amplification program：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；60 DEG C of annealing 45s；72 DEG C of extension 30s；35 are followed
After ring；72 DEG C of extension 10min；Last 4 DEG C of preservations；
C. electrophoresis：Amplified production is mixed with isometric sample-loading buffer, 94 DEG C of denaturation 6min, later in DNA sequencing
Carry out 6% denaturing polyacrylamide gel electrophoresis on electrophoresis apparatus, electrophoresis 1.5 hours under the conditions of 70W after electrophoresis, carries out silver
Dye, and observe amplification；
D. judge：If being able to detect that the band of 148bp in amplification, anti-of Chinese cabbage is contained in detected materials
The probability of swollen ospc gene CRb is 100%.
The anti-clubroot CRb genes of a kind of Chinese cabbage provided by the invention isolate molecular labeling TCR540, with Vegetable Crops of Brassica
Anti- clubroot gene C Rb is isolated, and the molecular marker assisted selection that can be widely applied to the anti-clubroot gene C Rb of Vegetable Crops of Brassica is educated
Kind.The present invention can carry out seedling stage assay by specific primer PCR amplification to plant to be measured, greatly improve breeding efficiency, shortening is educated
Kind process.
Description of the drawings
Fig. 1 is TCR540 and TCR541 in disease-resistant material ' CRBJN3-2 ', susceptible material ' BJN3-2 ' and recombinant
Amplification；
Fig. 2 amplifies the alignment come figure for the primer of TCR540 in the disease-resistant material of Chinese cabbage and susceptible material；
Fig. 3 is the genetic linkage maps of the anti-clubroot CRb genes of Chinese cabbage.
Specific implementation mode
The following describes the present invention in detail with reference to the accompanying drawings and specific embodiments, it is to be understood that the protection of the present invention
Range is not restricted by specific implementation.
One, the acquisition for isolating molecular labeling TCR540 and TCR541 of the anti-clubroot CRb genes of Chinese cabbage
1, the structure of segregating population
With the Chinese cabbage strain ' CRBJN3-2 ' containing anti-clubroot gene C Rb for male parent, the Chinese cabbage of easy infection clubroot
Strain ' BJN3-2 ' is that hybridization of female parent obtains F1, obtained F1It is all shown as plant disease-resistant.Two above parent ' CRBJN3-2 '
' BJN3-2 ' is stored in Agricultural University Of Shenyang.Select single plant F1Selfing structure F2For mapping population, group's number is 4783.
All 4783 F of sowing2Group, plantation are inoculated with plasmodiophora brassicae after 10 days.Disease Resistance Identification, 4783 F are carried out after 40 days2Group
In 3641 it is disease-resistant, 1142 are susceptible, meet 3 through Chi-square Test:1 segregation ratio
2, CTAB methods extract DNA
1) 1 × CTAB of 498uL extracting solutions and 2uL beta -mercaptoethanols, are added in 1.5ml centrifuge tubes, shakes up, wherein 1
× CTAB extracting solutions include 2% CTAB, the NaCl of the EDTA and 1.4mol/L of the Tris-HCl of 100mmol/L, 20mmol/L,
The mass concentration that wherein 2% CTAB refers to is 2% (w/v)；
2) 0.2g young leaflet tablets, are taken, powder is ground under the conditions of liquid nitrogen, are added to containing CTAB extracting solutions and β-sulfydryl
In the centrifuge tube of ethyl alcohol, shake up；
3), then centrifuge tube is put into 65 DEG C of water-baths, primary, water-bath 30min was shaken every 5 minutes；
4) centrifuge tube, is taken out, isometric chloroform is added:Iso pentane alcohol mixture (24:1, v/v) after, rocking 10min, often
The lower 12000r/min of temperature centrifuges 10min；
5), supernatant is transferred in another centrifuge tube, isometric chloroform is added:Isoamyl alcohol (24:1, v/v) it, rocks
After 10min, 12000r/min centrifuges 10min under room temperature；
6), supernatant is moved in another centrifuge tube, the absolute ethyl alcohol that 2 times of volumes of addition are pre-chilled in advance, it, will after mixing
The DNA to unite, which chooses in the centrifuge tube equipped with 400uL TE buffer solutions, to be dissolved；
7) 1.5uL RNaseA (10ug/uL), are added, 30min are preserved for 37 DEG C after mixing；
8) step 5), is repeated；
9), supernatant is transferred in another centrifuge tube, 50uL 3mol/L NaAC solution and pre- is added into centrifuge tube
Cold isometric isopropanol, -20 DEG C of precipitation 20min；
10), 12000r/m centrifuges 10min under the conditions of 4 DEG C, discards supernatant, and the ethyl alcohol for being added 75% cleans 2 times；
11) DNA, is air-dried on superclean bench, and 50 μ L TE (Tris-EDTA) dissolving DNAs are added, are protected in -20 DEG C of refrigerators
It deposits.
Two, the acquisition and identification for isolating molecular labeling TCR540 and TCR541 of the anti-clubroot CRb genes of Chinese cabbage
1, the screening of polymorphism primer
According to 2 flanking markers TCR79 and TCR108 of the anti-clubroot CRb genes that Piao Zhong clouds seminar delivers for 2014
Sequence (Zhang etc., Fine genetic and physical mapping of the CRb gene conferring
Resistance to clubroot disease in Brassica rapa., Mol Breeding, 34:1173-1183),
The gene is anchored in the sections Chinese cabbage A3 linkage group 83.5kb.Analyze Brassica Database databases (http://
Brassicadb.org) sequence information finds that there are 15 genes for target area.It is right according to the gene function of this 15 genes
Wherein 5 disease-resistant related genes ' are sequenced in disease-resistant material on CR BJN3-2 '.Sequencing result is compared, is found anti-
There are the sequence and Brassica Database databases (http of 3 genes in sick material://brassicadb.org) in reference
Genome sequence has differences.Therefore, according to the sequencing result of disease-resistant material, using Primer5.0 softwares, 3 pairs is designed altogether and is drawn
Object.
Using the 3 couples of primer amplification parents ' DNA of CR BJN3-2 ' and ' BJN3-2 ' of design, wherein there is 2 pairs of primers in parent
This has polymorphism, and is respectively designated as TCR540 and TCR541, the sequence of TCR540 and the corresponding molecular labelings of TCR541
Respectively：
(1) nucleotide sequence of TCR540 (148bp) is as shown in SEQ ID NO.1：
5’-TGACATTGTTGATGTGCTGATAAAAAAATCAGTAAGTCTAAGCAAATGTATATATTTTAGTTCTAT
TGGAACTTTGGATTACTGCTTTCTTCGCTTAGAAAAGTTTGCATTTTTACTTCAGGGAACCGAAGCAATTGAAGGCA
TATTT-3’。
(2) nucleotide sequence of TCR541 (252bp) is as shown in SEQ ID NO.4:
5'-TGCTTGAGCAGAAACAATATCAAAAATCTACCTGGAAGCATCAAGAAACTTCATCATCTCAAATCT
CTTTACTTGCATTGTCAACAGCTCGTTTCTCTTCCACTGCTTCCATCAAATCTGCAGTATCTGGATGCTCATGGCTG
TATCTCACTCGAAACAGTGGCTAAACCCATGACGCTTCTTGTGGTAGCTGAAAGGAACCAGTCTACTTTCGTCTTCA
CTGATTGTTTCAAGCTAAACAGAGATGCGCAA-3’。
The pair of primers F TCR540/R TCR540 for TCR540 are separately designed and synthesized according to above-mentioned sequence, with
And the pair of primers F TCR541/R TCR541 for TCR541, particular sequence are as follows：
(1) primer of TCR540：
F TCR540:5 '-TGACATTGTTGATGTGCTGA-3 ' (nucleotide sequence is as shown in SEQ ID NO.2)
R TCR540:5 '-AAATATGCCTTCAATTGCTTC-3 ' (nucleotide sequence is as shown in SEQ ID NO.3).
(2) primer of TCR541：
F TCR541：5-TGCTTGAGCAGAAACAATATCAA-3 ' (nucleotide sequence is as shown in SEQ ID NO.5)
R TCR541：5 '-TTGCGCATCTCTGTTTAGCTT-3 ' (nucleotide sequence is as shown in SEQ ID NO.6).
2, the identification of molecular labeling
In order to verify the reliability of these molecular labelings, first, seen using CRb both wings linked markers TCR79 and TCR74
(Zhang etc., Fine genetic and physical mapping of the CRb gene conferring
Resistance to clubroot disease in Brassica rapa., Mol Breeding, 34:1173-1183) sieve
Select 1142 plants of F2For the recombinant in susceptible individual；Then, using the primer of TCR540 (F TCR540/R TCR540) and
The primer (F TCR541/R TCR541) of TCR541 respectively to containing anti-clubroot gene C Rb Chinese cabbage ' CR BJN3-2 ' and easily
Feel the Chinese cabbage inbred lines ' BJN3-2 ' and its 44 F of clubroot2PCR amplification has been carried out for susceptible recombinant.Amplification table
It is bright as shown in Figure 1, Figure 1A be TCR540 in disease-resistant material ' CR BJN3-2 ' (R swimming lanes), susceptible material ' BJN3-2 ' (S swimming lanes)
And the amplification in recombinant (1-44 swimming lanes), it is expanded using the primer of TCR540, in disease-resistant parent ' CR
The band that a 148bp can be amplified on BJN3-2 ', in Susceptible parent ' BJN3-2 ' and 44 plants of F2For equal energy on susceptible recombinant
Amplify a band for being more than 148bp；Figure 1B is TCR541 in disease-resistant material ' CR BJN3-2 ' (R swimming lanes), susceptible material
Amplification in ' BJN3-2 ' (S swimming lanes) and recombinant (1-44 swimming lanes), is expanded using the primer of TCR541,
The band that a 252bp can be amplified on disease-resistant parent ' CRBJN3-2 ', in Susceptible parent ' BJN3-2 ' and 44 plants of F2For susceptible
A band for being more than 252bp can be amplified on recombinant.
The primer of TCR540 amplifies the sequence come in disease-resistant material：
5’-TGACATTGTTGATGTGCTGATAAAAAAATCAGTAAGTCTAAGCAAATGTATATATTTTAGTTCTAT
TGGAACTTTGGATTACTGCTTTCTTCGCTTAGAAAAGTTTGCATTTTTACTTCAGGGAACCGAAGCAATTGAAGGCA
TATTT-3’。
The primer of TCR540 amplifies the sequence come in susceptible material：
5’-TGACATTGTTGATGTGCTGACCAACAACTCAGTAAGTCAGAGAAAATGTATATCTGTTACTTCCAC
TGCTAGAAAATGTATATCTATTACTTCCACTGAAATTTAGAATACTGTTTAGGTTCCTTTGTACACTTAGAAGCTTA
TGTTTCTGAACTCATTTGCCATTTTTCTTCAGGGAACAGAAGCAATTGAAGGCATATTT-3’。
The comparing result of above-mentioned two sequence is as shown in Figure 2, the results showed that, two sequences are said there are larger otherness
The molecular labeling of bright TCR540 can be good at distinguishing the disease-resistant material of Chinese cabbage and susceptible material, and can be used for Vegetable Crops of Brassica includes balling
The auxiliary choosing of the molecular labeling of Chinese cabbage and the anti-knee ospc gene of green stem vegetable.
3, the structure of genetic map
According to F2As a result, calculating each label and the intergenic recombination fractions of CRb, Mapchart2.1 is painted the screening and identification of group
The genetic linkage maps (Fig. 3) of CRb genes processed, figure right side label between digital representation label between recombinant number, figure left side
Digital representation two mark between genetic distance, TCR79, TCR108, TCR30, TCR37, TCR74 as seen from the figure are fixed respectively
At distance CRb genes 0.03cM, 0.04cM, 0.36cM, 0.43cM, 0.49cM.And molecular labeling TCR540 newly developed,
TCR541 exists with CRb genes isolates relationship.Accordingly, it is determined that this 2 labels can apply to the anti-clubroot of Chinese cabbage from now on
In the molecular marking supplementary breeding process of CRb genes, and since this 2 molecular labeling is to isolate label, and before
Linked marker is compared, and Linkage drag phenomenon can be eliminated in the application of molecular mark, greatly improves transformation efficiency.
Three, Chinese cabbage anti-clubroot CRb genes isolate molecular labeling TCR540 and TCR541 in assisted Selection great Bai
Application process in the anti-clubroot plant of dish, specifically includes：
1, the genomic DNA of detected materials is extracted with CTAB methods
Extract the genomic DNA of Chinese cabbage material to be measured with CTAB methods, specific steps with reference to above " one, Chinese cabbage
" 2, CTAB methods extract DNA " part is remembered in the acquisition for isolating molecular labeling TCR540, TCR541 of anti-clubroot CRb genes "
The content of load.
2, PCR amplification
A. reaction system：The content of 10 μ L systems, each component substance is respectively 15ng template DNAs；5pmol·L-1Primer；
1.0mmol·L-1dNTP；1.0uL 10×PCR Buffer；0.5U Taq archaeal dna polymerases；ddH210 μ L of O polishings, mixing, from
The heart,
Wherein, the sequence for the primer that TCR540 is used is：
F TCR540:5 '-TGACATTGTTGATGTGCTGA-3 ',
R TCR540:5 '-AAATATGCCTTCAATTGCTTC-3 ',
The sequence for the primer that TCR541 is used is：
F TCR541:5 '-TGCTTGAGCAGAAACAATATCAA-3 ',
R TCR541:5’-TTGCGCATCTCTGTTTAGCTT-3’；
B. amplification program：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；60 DEG C of annealing 45s；72 DEG C of extension 30s；35 are followed
After ring；72 DEG C of extension 10min；Last 4 DEG C of preservations.
3, electrophoresis：
TCR540：Amplified production is mixed with isometric sample-loading buffer, 94 DEG C of denaturation 6min, later in DNA sequencing
Carry out 6% denaturing polyacrylamide gel electrophoresis on electrophoresis apparatus, electrophoresis 1.5 hours under the conditions of 70W after electrophoresis, carries out silver
Dye；
TCR541：Amplified production is mixed with isometric sample-loading buffer, 94 DEG C of denaturation 6min, later in DNA sequencing
Carry out 6% denaturing polyacrylamide gel electrophoresis on electrophoresis apparatus, electrophoresis 2 hours under the conditions of 70W after electrophoresis, carries out silver staining.
It should be noted that sample-loading buffer uses the common buffer solution of polyacrylamide gel electrophoresis, wherein including
The formamide of 98% (w/v), the EDTA of 10mM, the xylene cyanol of 0.001% (w/v) and 0.001% (w/v's)
bromphenol blue。
4, interpretation of result
1. if being able to detect that the band of 148bp, detected materials in the amplification using the primer of TCR540
In the probability containing the anti-clubroot gene C Rb of Chinese cabbage be 100%.
2. if being able to detect that the band of 252bp, detected materials in the amplification using the primer of TCR541
In the probability containing the anti-clubroot gene C Rb of Chinese cabbage be 100%.
1. if, 2. the amplification in 2 can get, detected materials have the anti-clubroot gene C Rb of Chinese cabbage
Probability be 100%.
Although preferred embodiments of the present invention have been described, it is created once a person skilled in the art knows basic
Property concept, then additional changes and modifications may be made to these embodiments.So it includes excellent that the following claims are intended to be interpreted as
It selects embodiment and falls into all change and modification of the scope of the invention.
Obviously, various changes and modifications can be made to the invention without departing from essence of the invention by those skilled in the art
God and range.In this way, if these modifications and changes of the present invention belongs to the range of the claims in the present invention and its equivalent technologies
Within, then the present invention is also intended to include these modifications and variations.
Claims (5)
1. a kind of anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, which is characterized in that the Chinese cabbage is anti-
The nucleotide sequence for isolating molecular labeling TCR540 of clubroot CRb genes is as shown in SEQ ID NO.1：
5’-TGACATTGTTGATGTGCTGATAAAAAAATCAGTAAGTCTAAGCAAATGTATATATTTTAGTTCTATTGGA
ACTTTGGATTACTGCTTTCTTCGCTTAGAAAAGTTTGCATTTTTACTTCAGGGAACCGAAGCAATTGAAGGCATATT
T-3’。
2. a kind of PCR for isolating molecular labeling TCR540 of the anti-clubroot CRb genes of Chinese cabbage described in claim 1 is special
Property amplimer includes：
F TCR540:5’-TGACATTGTTGATGTGCTGA-3’
R TCR540:5’-AAATATGCCTTCAATTGCTTC-3’。
3. the anti-clubroot CRb genes of Chinese cabbage according to claim 1 isolate molecular labeling TCR540, in molecule mark
Remember the application in assisted Selection.
4. the anti-clubroot CRb genes of Chinese cabbage according to claim 1 isolate molecular labeling TCR540, in Chinese cabbage
Application in anti-clubroot molecular marker assisted selection.
5. a kind of application side for isolating molecular labeling TCR540 of the anti-clubroot CRb genes of Chinese cabbage described in claim 1
Method specifically includes：
(1) genomic DNA of CTAB methods extraction detected materials is used
(2) PCR amplification
A. reaction system：The content of 10 μ L systems, each component substance is respectively 15ng template DNAs；5pmol·L-1Primer；
1.0mmol·L-1dNTP；1.0uL 10×PCR Buffer；0.5U Taq archaeal dna polymerases；ddH210 μ L of O polishings, mixing, from
The heart,
Wherein the sequence of primer is F TCR540:5 '-TGACATTGTTGATGTGCTGA-3 ',
R TCR540:5’-AAATATGCCTTCAATTGCTTC-3’；
B. amplification program：94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s；60 DEG C of annealing 45s；72 DEG C of extension 30s；After 35 cycles；
72 DEG C of extension 10min；Last 4 DEG C of preservations；
C. electrophoresis：Amplified production is mixed with isometric sample-loading buffer, 94 DEG C of denaturation 6min, later in DNA sequencing electrophoresis
Carrying out 6% denaturing polyacrylamide gel electrophoresis on instrument, electrophoresis 1.5 hours under the conditions of 70W after electrophoresis, carries out silver staining, and
Observe amplification；
D. judge：If being able to detect that the band of 148bp in amplification, the anti-clubroot of Chinese cabbage is contained in detected materials
The probability of gene C Rb is 100%.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459379.1A CN106011134B (en) | 2016-06-22 | 2016-06-22 | The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610459379.1A CN106011134B (en) | 2016-06-22 | 2016-06-22 | The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106011134A CN106011134A (en) | 2016-10-12 |
| CN106011134B true CN106011134B (en) | 2018-10-19 |
Family
ID=57086087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610459379.1A Expired - Fee Related CN106011134B (en) | 2016-06-22 | 2016-06-22 | The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106011134B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108285929B (en) * | 2018-04-19 | 2020-07-14 | 青岛市农业科学研究院 | Indel molecular marker P29 linked with anti-clubroot property of Degao CR117 Chinese cabbage, kit and application thereof |
| CN108285930B (en) * | 2018-04-19 | 2020-07-31 | 青岛市农业科学研究院 | SSR molecular marker closely linked with anti-clubroot trait of Degao CR117 Chinese cabbage, kit and application thereof |
| CN108588264B (en) * | 2018-06-08 | 2021-05-28 | 西南大学 | Molecular marker and primer for identifying cabbage clubroot disease resistance and application of molecular marker and primer |
| CN109295247B (en) * | 2018-10-22 | 2021-11-23 | 沈阳农业大学 | Closely linked molecular marker yau403 of clubroot-resistant CRd gene of Chinese cabbage, primer and application |
| CN110734999B (en) * | 2019-11-12 | 2020-06-16 | 北京市农林科学院 | SNP molecular marker tightly linked with new clubroot-resistant gene CRw of Chinese cabbage and application thereof |
| CN112553359B (en) * | 2021-02-04 | 2023-05-05 | 沈阳农业大学 | Clubroot molecular marker syau3008 coseparated from Chinese cabbage genes, primer and application |
| CN114381463B (en) * | 2022-02-23 | 2023-11-07 | 华中农业大学 | Application of BraA08g039212E gene derived from European turnip ECD04 in improving resistance of rhizopus |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0217406D0 (en) * | 2002-07-26 | 2002-09-04 | Syngenta Participations Ag | Disease resistant brassicas |
| US8754290B2 (en) * | 2011-02-09 | 2014-06-17 | Dow Agrosciences, Llc | HO/LL canola with resistance to clubroot disease |
| CN104894228B (en) * | 2012-09-05 | 2017-12-01 | 沈阳农业大学 | Linkage molecule mark, primer and the system of selection of anti-clubroot plant of the anti-clubroot CRb genes of Chinese cabbage |
| CN105543391A (en) * | 2016-02-05 | 2016-05-04 | 北京市农林科学院 | InDel molecular marker for identifying clubroot-resistant QTL (quantitative trait locus) located on Chinese cabbage A03 chromosome and application thereof |
| CN105525024B (en) * | 2016-02-16 | 2019-01-22 | 北京市农林科学院 | A kind of special SNP marker and application identifying No. 4 biological strain resistances of celery cabbage clubroot |
-
2016
- 2016-06-22 CN CN201610459379.1A patent/CN106011134B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN106011134A (en) | 2016-10-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106011134B (en) | The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application | |
| CN104894228B (en) | Linkage molecule mark, primer and the system of selection of anti-clubroot plant of the anti-clubroot CRb genes of Chinese cabbage | |
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN105063033B (en) | A kind of molecular labeling of Brassica Napus knee ospc gene and its application in anti-clubroot breeding | |
| CN102154471B (en) | Molecular marking method for major quantitative trait loci(QTL) for rice grain length | |
| CN110512018B (en) | PCR primer and kit for screening cabbage self-affinity material and application of PCR primer and kit | |
| CN109628627A (en) | The SNP marker development and application of broad-spectrum rice-blast resistant gene of paddy rice Pigm | |
| CN105969881B (en) | The anti-clubroot CRb gene of Chinese cabbage isolates molecular labeling TCR541, primer and application | |
| CN109295247A (en) | Compact linkage molecule label yau403, primer and the application of the anti-clubroot CRd gene of Chinese cabbage | |
| CN105441457B (en) | A kind of QTL molecule labelling method relevant to low nitrogen Rice under Condition mass of 1000 kernel | |
| CN107400721A (en) | With two InDel marks of cucumber yellow-white pericarp close linkage and application | |
| CN109913582A (en) | A kind of molecular labeling and its application with resistance gene of rice blast close linkage | |
| CN105200143B (en) | Grain Weight in Common Wheat main effect QTL QTgw 4A.1 close linkage mark and its application | |
| CN110777218B (en) | Molecular marker linked with wheat powdery mildew resistance gene Pm37 and application thereof | |
| CN105803083B (en) | The molecular labeling of pear fruit single fruit weight main effect QTL site MSF and application | |
| CN104498612B (en) | With the rice blast closely linked molecular marker of Pi9 gene and application thereof | |
| CN111944920B (en) | InDel marker closely linked with melon epidemic disease resistance gene and application thereof | |
| CN109468410A (en) | The gene molecule marker and its application that a kind of and capsicum genic male sterile gene msc-2 is isolated | |
| CN106636358B (en) | The functional molecular marker of rice blast resistance gene Pi2 a kind of and its application | |
| CN102690817B (en) | With the closely linked molecular labeling SIsv0659 of millet pollen color gene | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof | |
| CN100393740C (en) | High yield rice cultivation method and specific molecular mark | |
| CN106350514B (en) | With the molecular labeling OSblb-SV4 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN109913580A (en) | A kind of application with the molecular labeling of resistance gene of rice blast close linkage | |
| CN109797235A (en) | With the molecular labeling R112823 of resistance gene of rice blast Pi1 close linkage |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20181019 Termination date: 20190622 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |