CN114214448A - SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof - Google Patents
SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof Download PDFInfo
- Publication number
- CN114214448A CN114214448A CN202111275901.8A CN202111275901A CN114214448A CN 114214448 A CN114214448 A CN 114214448A CN 202111275901 A CN202111275901 A CN 202111275901A CN 114214448 A CN114214448 A CN 114214448A
- Authority
- CN
- China
- Prior art keywords
- rice
- bph30
- brown planthopper
- snp marker
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof. The SNP marker is located at 946632bp of the rice No. 4 chromosome, and the polymorphism is A/G. The invention designs a corresponding KASP detection primer aiming at the SNP locus, and judges whether the detected plant contains the brown planthopper resistant gene Bph30 or not by detecting the polymorphism of the SNP locus. The SNP marker provided by the invention can effectively identify the genotype of the brown planthopper resistant gene Bph30 in a plant. The SNP marker and the KASP primer thereof provided by the invention have the advantages of simple operation, low cost, short period and the like, and the marker is positioned in the Bph30 gene, has good stability, is not influenced by other gene effects or environmental factors, is applied to molecular auxiliary selection, can accelerate the application of the Bph30 gene in the anti-nilaparvata lugens breeding, obviously shortens the breeding period of the anti-nilaparvata lugens rice variety and reduces the breeding cost.
Description
Technical Field
The invention relates to the fields of molecular biology and plant molecular breeding, in particular to an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof.
Background
Rice is one of the most important grain crops in China and the world. Brown planthopper is a monophagic pest only harmful to rice, and a needle-shaped mouth device penetrates into the phloem of the rice to absorb juice, so that leaves turn yellow or wither, and the rice is reduced in yield and even completely harvested. Brown planthopper can also transmit rice virus diseases. The brown planthopper is migratory insect pests and has strong explosive power. The inhibition of the development and harm of brown planthopper is an important requirement for ensuring high and stable yield of rice in China. The main reasons for the perennial occurrence of brown planthopper are the generally poor pest resistance of rice varieties and the remarkable enhancement of the drug resistance of pests. Therefore, the mining and identification of the brown planthopper resistant gene from the rice seed resource and the cultivation of the brown planthopper resistant rice variety are key technical approaches for effectively preventing and controlling the brown planthopper which is a major agricultural pest. The resistance of the rice variety is utilized to control the brown planthopper, so that chemical insecticides can be obviously reduced or even not used, the production cost of rice is reduced, the ecological environment is protected, and green production and sustainable development of grains are realized.
The traditional rice insect-resistant breeding method is characterized in that phenotype selection is carried out on plants through insect-resistant character identification, time and labor are wasted, the plants are easily influenced and limited by environmental conditions, errors are easily caused in identification results, and the selection efficiency is low. Molecular marker assisted selection is a modern breeding technology which utilizes a functional marker closely linked with a resistance gene or in the gene and combines genotype and phenotype selection to screen target traits in later generations. The method can greatly improve the breeding efficiency, shorten the breeding period and save a large amount of labor and material cost. The brown planthopper resistance gene Bph30 is cloned on the rice chromosome 4 (GenBank accession number: MW176108.1), encodes a protein containing two leucoine-rich domains (LRDs), belongs to a new gene family for resisting the brown planthopper, and is a completely dominant insect-resistant gene, broad-spectrum brown planthopper and white back planthopper. The development of an efficient molecular marker identification system aiming at the Bph30 gene has important significance for the application of the gene in breeding, the accurate identification of insect-resistant traits and the further improvement of the brown planthopper resistance of rice.
Disclosure of Invention
The invention aims to provide an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof.
In order to achieve the purpose of the invention, the inventor develops a plurality of Bph30 genes or markers co-separated from the genes in the early stage, tests prove that the detection accuracy in a population is basically not different through screening, and the marker K _946632 which is positioned in the genes and has relatively good typing effect is selected.
In a first aspect, the invention provides an SNP marker (marked as K _946632) for identifying a brown planthopper resistant gene Bph30 of rice, wherein the SNP marker is positioned at 946632bp of a rice chromosome 4, the polymorphism of the SNP marker is A/G, and the SNP site is positioned at 2903bp of a Bph30 gene sequence (GenBank accession number: MW 176108.1).
Or the SNP marker contains a nucleotide sequence with the polymorphism of A/G at the 946632bp of the rice chromosome 4.
The physical position is based on the rice Nipponbare reference genome version number IRGSP 1.0.
Further, the nucleotide sequence of the SNP marker is shown as SEQ ID NO. 4, wherein the 101 st base n is a or g.
The rice material with the polymorphic site A containing the SNP marker contains a rice anti-brown planthopper gene Bph30, the rice material with the polymorphic site G does not contain a rice anti-brown planthopper gene Bph30, and the rice material with the polymorphic site A/G contains a brown planthopper resistant gene Bph30 which is of a hybrid type and shows the resistance to brown planthopper.
In a second aspect, the present invention provides a KASP primer combination for amplifying said SNP marker comprising two specific primers as shown in SEQ ID NO. 1 and 2 and one universal primer as shown in SEQ ID NO. 3.
Wherein, the two specific primers respectively contain different fluorescent groups, the primer shown in SEQ ID NO. 1 contains a fluorescent group FAM, and the primer shown in SEQ ID NO. 2 contains a fluorescent group HEX.
In a third aspect, the invention provides a detection reagent or kit comprising said KASP primer combination.
In a fourth aspect, the invention provides a method for identifying a brown planthopper resistant gene Bph30 of rice, which comprises the following steps:
1) extracting the genomic DNA of the rice to be detected;
2) performing PCR detection using the KASP primer combination of claim 4 using rice genomic DNA as a template;
3) analysis of the PCR products: if the PCR product contains the base with polymorphism A in the SNP marker, determining that the rice to be detected contains brown planthopper resistant gene Bph 30; and if the PCR product contains the base with the polymorphism G in the SNP marker, judging that the rice to be detected does not contain the brown planthopper resistant gene Bph 30.
Preferably, the PCR reaction system in step 2) comprises, in a total volume of 2 μ L: mu.L of template DNA, 0.007. mu.L of each of the 100. mu.M two specific primers, 0.015. mu.L of the 100. mu.M universal primer, and the balance of 2 XKASP Master Mix.
Preferably, the PCR reaction procedure is as follows:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94 ℃ for 20 seconds; annealing and extending at 65-57 ℃ for 60 seconds for 10 cycles, wherein the annealing and extending temperature of each cycle is reduced by 0.8 ℃;
denaturation at 94 ℃ for 20 seconds, annealing at 57 ℃ and extension for 60 seconds, 26 cycles.
Further, the step (3) is specifically:
if the PCR product detects a Fam fluorescent signal, the SNP marker is a G base group, and the rice sample to be detected does not contain brown planthopper resistant gene Bph 30; if a Hex fluorescence signal is detected, the SNP marker is an A base and the rice sample to be detected contains an anti-brown planthopper gene Bph30, if Fam and Hex fluorescence are detected simultaneously, the SNP marker is a heterozygous type A/G, and the Bph30 in the rice sample to be detected is a heterozygous type.
In a fifth aspect, the present invention provides any one of the following uses of the SNP markers, the KASP primer combinations, or a detection reagent or kit comprising the primer combinations:
(1) the method is used for breeding brown planthopper-resistant rice materials;
(2) used for identifying the brown planthopper resistant gene Bph30 of the rice;
(3) is used for rice molecular marker assisted breeding.
By the technical scheme, the invention at least has the following advantages and beneficial effects:
the SNP marker provided by the invention is a Bph30 gene internal marker, can specifically distinguish Bph30 gene donor parents and other rice varieties/resources, has no risk of recombination exchange compared with other reported markers, and has better accuracy.
The SNP marker and the detection method thereof provided by the invention can be used for screening brown planthopper resistant plants by carrying out gene identification on the plants in early stage of rice, so that the brown planthopper resistant phenotype identification is avoided, and a large amount of manpower and physical cost are saved.
And thirdly, the detection method provided by the invention is accurate and reliable, is simple and convenient to operate, is suitable for high-throughput genotype detection equipment, and can be efficiently applied to the breeding of brown planthopper resistant varieties in the commercial breeding of rice.
Drawings
FIG. 1 shows the result of typing of the SNP molecular marker K _946632 of the gene Bph30 in a natural population according to a preferred embodiment of the present invention.
FIG. 2 shows the result of typing of the SNP molecular marker K _946632 of the gene Bph30 in a segregating population according to a preferred embodiment of the invention.
Detailed Description
The invention provides an SNP marker identified by a brown planthopper resistant gene Bph30 and application thereof.
The invention adopts the following technical scheme:
the invention provides an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice, wherein the SNP site is located at 946632bp of a No. 4 chromosome of the rice, and the polymorphism is A/G.
Further, the SNP site is located at the 101 st base of the nucleotide sequence shown as follows:
CCAACGTTGTTCAGCCCTGCTAACGGCAATGGGCCTTCTCTTGCTTATTGTT CCGCCTAATTCAGAACCATCAGTAGTAGCAGTAGCAACACTAGCAGGA[A/G]GG GATGAGATCTCGATGCATGGTGCATCCAAGGGATATTCTGTATCATTTAGCGAGC GAAGGAGCCTTCTGTCCCTCACTGAAATATACCATTTAAATTC
furthermore, the rice sample with the SNP locus A contains the brown planthopper resistant gene Bph30, and the rice sample with the SNP locus G does not contain the brown planthopper resistant gene Bph 30.
The present invention also provides a KASP primer combination for identifying said SNP site, said KASP primer combination comprising the following primer sequences (SEQ ID NOS: 1-3):
K_946632_FAM：5’-gaaggtgaccaagttcatgctCAGTAGCAACACTAGCAGGAG-3’；
K_946632_HEX：5’-gaaggtcggagtcaacggattGCAGTAGCAACACTAGCAGGAA-3’；
K_946632_COM：5’-TGAGGGACAGAAGGCTCCTT-3’。
the invention further provides kits comprising the KASP primer combinations.
The invention also provides a method for detecting the brown planthopper resistant gene Bph30 in the rice sample, which comprises the following steps:
(1) obtaining the genome DNA of a plant to be detected;
(2) performing PCR detection using the KASP primer combination;
(3) and if the polymorphism of the SNP site is detected to be A, determining that the rice sample contains the brown planthopper resistant gene Bph30, and if the polymorphism of the SNP site is detected to be G, determining that the rice sample does not contain the brown planthopper resistant gene Bph 30.
Further, the reaction system for PCR detection in step (2) comprises, in a total volume of 2. mu.L:
mu.L of template DNA, 0.007. mu.L of each of 100. mu.M Fam and Hex primers, 0.015. mu.L of 100. mu.M Com primer, and the balance of 2 XKASP Master Mix.
The reaction program of PCR detection in the step (2) comprises:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94 ℃ for 20 seconds; annealing at 65-57 ℃ and extending for 60 seconds for 10 cycles, wherein the annealing and extending temperature of each cycle is reduced by 0.8 ℃;
denaturation at 94 ℃ for 20 seconds, annealing at 57 ℃ and extension for 60 seconds, 26 cycles.
Further, the step (3) is specifically:
if the PCR product detects a Fam fluorescent signal, the SNP marker is a G base group, and the rice sample to be detected does not contain brown planthopper resistant gene Bph 30; if a Hex fluorescent signal is detected, the SNP marker is an A base and the rice sample to be detected contains a brown planthopper resistant gene Bph 30; if the Fam fluorescence and the Hex fluorescence are detected simultaneously, the SNP marker is heterozygote type A/G, and the Bph30 in the rice sample to be detected is heterozygote type.
The invention further provides the SNP locus, the KASP primer combination, the kit and the application of the method in identifying brown planthopper-resistant rice varieties.
The invention further provides the SNP locus, the KASP primer combination, the kit and the application of the method in brown planthopper resistant rice breeding.
The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise indicated, the examples follow conventional experimental conditions, such as the Molecular Cloning handbook, Sambrook et al (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual,2001), or the conditions as recommended by the manufacturer's instructions.
Example 1 Bph30 Gene SNP marker site screening and KASP primer development
Obtaining a Bph30 genome sequence (GenBank accession number: MW176108.1) through an NCBI database, carrying out Blast analysis on the sequence to obtain SNP variant sites in a Bph30 gene interval, selecting SNP sites which are relatively conserved at the upstream and the downstream, further analyzing the distribution frequency of the SNP sites by using 3000 rice sequencing public database resources, screening the rare or unique SNP sites of a Bph30 gene, respectively obtaining 200bp sequences of the SNP locus on the upstream and downstream of the Nipponbare reference genome by taking the obtained SNP locus as a target point to design KASP primers, performing PCR amplification on the designed KASP primer to test the typing effect of the primer, finally selecting a KASP marker K _946632 which is designed by taking an SNP locus at 946632bp (at 2903bp of MW176108.1) of the Nipponbare 4 chromosome of a reference genome (IRGSP1.0) as a target point as a preferred primer for Bph30 identification, wherein the gene of Bph30 for resisting brown planthopper is A allelic at the SNP site, and the other rice resources are G allelic at the site. The primer K _946632 has the following sequence (SEQ ID NOS: 1-3):
K_946632_FAM：5’-gaaggtgaccaagttcatgctCAGTAGCAACACTAGCAGGAG-3’；
K_946632_HEX：5’-gaaggtcggagtcaacggattGCAGTAGCAACACTAGCAGGAA-3’；
K_946632_COM：5’-TGAGGGACAGAAGGCTCCTT-3’。
the marker is used for analyzing the rice sample, if a Fam fluorescent signal is detected, the rice sample to be detected does not contain the brown planthopper resistant gene Bph30, and if a Hex fluorescent signal is detected, the rice sample to be detected contains the brown planthopper resistant gene Bph 30.
Example 2 application of Bph30 Gene SNP marker in genotype identification of Natural population of Rice
1. Biological material
The rice samples used in this example included the Bph30 gene donor parent AC-1613 (the donor material was provided by professor Hokkera of Onagawa university, Wuhan university, Keyod laboratories) (Shi S, Wang H, Nie L, et al. Bph30 control resistance to brown Plant by for the purpose of transforming the genetic research in rice leaf plants [ J ]. Molecular Plant,2021,14(10):1714-1732) as well as 40 other rice varieties without Bph30, package: jing 4155S, Longke 638S, IRTA129, Huahui No. 4, Shuhui 527, Fengxianzhan, R1308, Zhonggang 143, Lonicera japonica 69, Nipponbare, C101A51, Huahui, extra green, 9311, CO2, Mf63, sea rice, Huarun No. 2, Chenghui 19, Kangdong bamboo rice, Huizuan 602, Jiangsu japonica 2, Zhejiang japonica 75, Xiangya kouxiang, Liaoning 287, Mihui 3728, Hot japonica 35, Yuzhen, Yandao 1531, Longyu No. 1129 glutinous, Fengyao, IR64, IR29, R1206, R8, Huizuan 5, R6444, Zhendao 819, Fukuniski, and nongxiang No. 18.
2. Genotype detection
The genomic DNA of rice to be tested is extracted as a template, and KASP reaction detection is carried out by using the primer combination (SEQ ID NO:1-3) of the invention.
The PCR amplification reaction system is calculated by 2 mu L: mu.L of template DNA, 0.007. mu.L of each of 100. mu.M Fam and Hex primers, and 0.015. mu.L of 100. mu.M Com primer, made up to a total volume of 2. mu.L with 2 XKASP Master Mix.
The PCR amplification reaction conditions are as follows: the reaction is finished in a water bath thermal cycler, and the Touchdown PCR reaction condition is 94 ℃ for pre-denaturation for 15 minutes;
performing a first-step amplification reaction, namely performing denaturation at 94 ℃ for 20 seconds, annealing at 65-57 ℃ and extending for 60 seconds for 10 cycles, wherein the annealing and extending temperature of each cycle is reduced by 0.8 ℃;
the second amplification reaction, denaturation at 94 ℃ for 20 seconds, annealing at 57 ℃ and extension for 60 seconds, 26 cycles.
After the reaction is finished, the LGC IntelliQube genotyping platform is used for carrying out fluorescence scanning on the PCR reaction product and carrying out genotyping.
3. Analysis of results
The genotype identification result is shown in figure 1, the AC-1613 sample detects a Hex fluorescent signal, the genotype is A type and contains brown planthopper resistant gene Bph30, the other 40 rice samples detect Fam fluorescent signals, the genotype is G type and does not contain brown planthopper resistant gene Bph 30. The molecular marker and the primer group thereof provided by the invention are proved to have accurate detection results and can effectively distinguish different allelic genotypes.
Example 3 application of Bph30 Gene SNP marker in genotyping segregating populations
1. Biological material
BC from 5781-1019/AC-1613/5781-10191F2500 individuals in the population are selected for Bph30 genotype identification.
2. Genotype detection
The detection method was the same as in example 2.
3. Analysis of results
The genotype of 500 individuals was tested, and the results showed that the ratio of 3 different genotypes A: A, A: G and G: G was 114:263:123, and the isolation ratio of Mendelian single genes (chi-shaped) was 1:2:1 according to the chi-square test2＝1.676<χ2 0.05And 5.99), so the marker is a codominant marker, two different homozygotes and heterozygotes can be distinguished, the detection sites simultaneously represent single gene separation, and the genotyping results of part of samples are shown in figure 2.
The SSR marker developed for identifying the gene Bph30 has the following disadvantages: (1) SSRs are gene-linked markers, which present an exchange risk and are less accurate than the intragenic molecular markers of the invention. (2) SSR marks are based on traditional polyacrylamide gel electrophoresis, inevitably use harmful chemical reagents such as formaldehyde, and are not favorable for the safety of operators. (3) The SSR marker detection method is relatively complicated in operation, limited in electrophoresis detection flux and difficult to meet the genotype screening work of a large number of samples in a short time in commercial breeding, and the KASP marker disclosed by the invention can be suitable for an automatic genotyping platform and can be used for high-throughput genotyping. (4) The SNP marker of the invention is peculiar to Bph30, has better specificity compared with SSR markers, and is suitable for identifying the genotype of Bph30 in different hybridization or natural populations.
The SNP molecular marker of the brown planthopper resistant gene Bph30 and the detection primer thereof can realize the efficient and accurate identification of the genotype of the brown planthopper resistant gene Bph30, can be used for screening and identifying rice resources, and can also be used for molecular genetic breeding of the brown planthopper resistant gene Bph30 of rice.
Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Yuan Longping agricultural high-tech stock company, Hunan Longping high-tech species science research institute, Hunan Yahua species science research institute, Wuhan university, Inc
<120> SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof
<130> KHP211122975.0
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 42
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gaaggtgacc aagttcatgc tcagtagcaa cactagcagg ag 42
<210> 2
<211> 43
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gaaggtcgga gtcaacggat tgcagtagca acactagcag gaa 43
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgagggacag aaggctcctt 20
<210> 4
<211> 201
<212> DNA
<213> Rice (Oryza sativa)
<400> 4
ccaacgttgt tcagccctgc taacggcaat gggccttctc ttgcttattg ttccgcctaa 60
ttcagaacca tcagtagtag cagtagcaac actagcagga ngggatgaga tctcgatgca 120
tggtgcatcc aagggatatt ctgtatcatt tagcgagcga aggagccttc tgtccctcac 180
tgaaatatac catttaaatt c 201
Claims (9)
1. The SNP marker for identifying the brown planthopper resistant gene Bph30 of rice is characterized in that the SNP marker is positioned at 946632bp of a No. 4 chromosome of the rice, and the polymorphism of the SNP marker is A/G;
the physical position is based on the Nipponbare genome version number IRGSP1.0 of rice.
2. The SNP marker according to claim 1, having a nucleotide sequence shown in SEQ ID NO 4, wherein the 101 st base n is a or g.
3. The SNP marker according to claim 1 or 2, wherein the rice material with the polymorphic site A contains a rice anti-brown planthopper gene Bph30, and the rice material with the polymorphic site G does not contain a rice anti-brown planthopper gene Bph 30.
4. A KASP primer combination for amplifying a SNP marker according to any one of claims 1 to 3, comprising two specific primers as set forth in SEQ ID NO 1 and 2 and one universal primer as set forth in SEQ ID NO 3;
wherein, the two specific primers respectively contain different fluorescent groups;
preferably, the primer shown in SEQ ID NO. 1 contains a fluorescent group FAM, and the primer shown in SEQ ID NO. 2 contains a fluorescent group HEX.
5. A detection reagent or kit comprising the KASP primer combination of claim 4.
6. The method for identifying the brown planthopper resistant gene Bph30 of rice is characterized by comprising the following steps:
1) extracting the genomic DNA of the rice to be detected;
2) performing PCR detection using the KASP primer combination of claim 4 using rice genomic DNA as a template;
3) analysis of the PCR products: if the PCR product contains a base with polymorphism A in the SNP marker according to any one of claims 1 to 3, determining that the rice to be detected contains a brown planthopper resistant gene Bph 30; and if the PCR product contains the base with the polymorphism G in the SNP marker, judging that the rice to be detected does not contain the brown planthopper resistant gene Bph 30.
7. The method of claim 6, wherein the PCR reaction system in step 2) comprises, in a total volume of 2 μ L: 1 uL template DNA, 100 uM of each of the two specific primers 0.007 uL, 100 uM of the universal primer 0.015 uL, the balance of 2 xKASP Master Mix;
the PCR reaction procedure was as follows:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94 ℃ for 20 seconds; annealing and extending at 65-57 ℃ for 60 seconds for 10 cycles, wherein the annealing and extending temperature of each cycle is reduced by 0.8 ℃;
denaturation at 94 ℃ for 20 seconds, annealing at 57 ℃ and extension for 60 seconds, 26 cycles.
8. The method according to claim 6 or 7, characterized in that step (3) is in particular:
if the PCR product detects a Fam fluorescent signal, the SNP marker is a G base group, and the rice sample to be detected does not contain brown planthopper resistant gene Bph 30; if a Hex fluorescence signal is detected, the SNP marker is an A base and the rice sample to be detected contains an anti-brown planthopper gene Bph30, if Fam and Hex fluorescence are detected simultaneously, the SNP marker is a heterozygous type A/G, and the Bph30 in the rice sample to be detected is a heterozygous type.
9. Use of the SNP marker according to any one of claims 1 to 3, the KASP primer combination according to claim 4 or the detection reagent or kit according to claim 5 for any one of the following:
(1) the method is used for breeding brown planthopper-resistant rice materials;
(2) used for identifying the brown planthopper resistant gene Bph30 of the rice;
(3) is used for rice molecular marker assisted breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111275901.8A CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111275901.8A CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114214448A true CN114214448A (en) | 2022-03-22 |
| CN114214448B CN114214448B (en) | 2023-10-13 |
Family
ID=80696276
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111275901.8A Active CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114214448B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116814841A (en) * | 2023-08-16 | 2023-09-29 | 湖北省农业科学院粮食作物研究所 | Primer group for identifying rice black brown glume gene HK4, and method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868842A (en) * | 2017-12-04 | 2018-04-03 | 华智水稻生物技术有限公司 | For detecting SNP marker and the application of rice brown planthopper resistant Bph3 genes |
| CN112458198A (en) * | 2020-12-17 | 2021-03-09 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof |
| CN112592997A (en) * | 2020-12-17 | 2021-04-02 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof |
-
2021
- 2021-10-29 CN CN202111275901.8A patent/CN114214448B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868842A (en) * | 2017-12-04 | 2018-04-03 | 华智水稻生物技术有限公司 | For detecting SNP marker and the application of rice brown planthopper resistant Bph3 genes |
| CN112458198A (en) * | 2020-12-17 | 2021-03-09 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof |
| CN112592997A (en) * | 2020-12-17 | 2021-04-02 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| GUANGCUN HE ETAL.: "Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths", MOLECULAR PLANT, pages 1729 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116814841A (en) * | 2023-08-16 | 2023-09-29 | 湖北省农业科学院粮食作物研究所 | Primer group for identifying rice black brown glume gene HK4, and method and application thereof |
| CN116814841B (en) * | 2023-08-16 | 2024-02-06 | 湖北省农业科学院粮食作物研究所 | Primer group for identifying rice black brown glume gene HK4, and method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114214448B (en) | 2023-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN109628627B (en) | Development and application of SNP (single nucleotide polymorphism) marker of broad-spectrum rice blast resistance gene Pigm of rice | |
| CN107815507B (en) | SNP molecular marker for detecting brown planthopper resistant Bph14 gene of rice and application | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN109055598B (en) | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN107400715A (en) | The exploitation and its application of the special chemoattractant molecule mark of Thinopyrum ponticum and probe | |
| CN109628629A (en) | The SNP marker development and application of rice bacterial leaf spot resistant gene xa5 | |
| CN112695114B (en) | SNP molecular marker for detecting rice blast resistance Pik gene and application thereof | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN114214448B (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| US10174387B2 (en) | Soybean markers linked to phytophthora resistance | |
| CN111961753A (en) | SNP (Single nucleotide polymorphism) marker related to resistance gene of pepper and tomato leaf blight virus, and specific primer and application thereof | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN112626258B (en) | SNP (Single nucleotide polymorphism) site related to rice cadmium low-absorption gene OsNramp5 and application thereof | |
| CN113736907A (en) | SNP locus combination for detecting tomato gray leaf spot resistance and application thereof | |
| CN109652579B (en) | Codominant molecular marker of rice blast resistance gene Pi2, detection method and application thereof | |
| CN113699273B (en) | SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof | |
| NL2031136B1 (en) | Set of kompetitive allele specific pcr (kasp)-based core single nucleotide polymorphism (snp) markers for eggplant and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |