CN111378781A - Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application - Google Patents
Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application Download PDFInfo
- Publication number
- CN111378781A CN111378781A CN202010347956.4A CN202010347956A CN111378781A CN 111378781 A CN111378781 A CN 111378781A CN 202010347956 A CN202010347956 A CN 202010347956A CN 111378781 A CN111378781 A CN 111378781A
- Authority
- CN
- China
- Prior art keywords
- primer
- salt
- skc1
- tolerant
- rice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a molecular marker primer for quickly and efficiently identifying a rice salt-tolerant gene SKC1 and application thereof. Aiming at specific difference sites of SKC1 gene sequences of salt-tolerant type (Nona type) and salt-sensitive type (overshadowing type) which are originally reported, a molecular marker primer SKC 1-Allle 1/Allle 2/Common for distinguishing the salt-tolerant genotype and the sensitive type of the rice salt-tolerant gene SKC1 is designed, so that the Allele type of SKC1 is accurately, quickly and efficiently identified, and a powerful tool is provided for the subsequent cultivation of new salt-tolerant rice strains. Compared with the existing marker, the method is quicker and more time-saving, saves the time and energy of running an agarose electrophoresis test, can obtain a result only by 30 seconds of fluorescence scanning after the PCR amplification procedure is finished, is clear at a glance, and improves the accuracy.
Description
Technical Field
The invention relates to a molecular marker primer for quickly and efficiently identifying salt-tolerant genes SKC1 (salt-tolerant type and salt-sensitive type) of rice and application thereof, belonging to the technical field of plant biology.
Background
Rice is one of the important food crops in the world, and rice is taken as the staple food in about half of the global population. Stress such as low temperature, saline-alkali, drought, plant diseases and insect pests and the like can be encountered in the growth and development process of rice, and serious influence is caused on the yield and quality of the rice, so that research on improving the stress resistance is an important way and means for improving the rice. 15 hundred million acres of barren saline-alkali soil are increased every year in China, and soil salinization seriously restricts sustainable development of agriculture in China. The cultivation of the salt-tolerant rice variety has important significance for expanding the rice planting area and improving the utilization rate of saline-alkali soil. SKC1 is used as the first cloned salt-tolerant major QTL, is positioned on No.1 chromosome of rice, and has a contribution rate to salt-tolerant phenotype of more than 40% (Ren et al, 2005; Lin et al, 2004). The initial donor parent is Nona Bokra of high salt tolerant indica rice variety, which is maintained in the aerial part of K under salt stress+To improve the salt tolerance of rice.
The Nona genotype of SKC1 is introduced into rice excellent receptor material to raise the salt tolerance of rice variety and has wide application foreground. The molecular marker is a specific DNA fragment capable of reflecting genome difference between varieties, and is a detection technology with simple operation and low cost by using molecular marker-assisted selection. Wangchaofen et al (molecular plant breeding, 2015) designed CAPS markers by using SKC1 mutants generated by EMS mutagenesis, but only aimed at specific mutant materials of SKC1 and did not design specific co-dominant molecular markers in SKC1 genes in natural resource materials. Jiang Yi mu et al (molecular plant breeding, 2018) design PCR primers through specific SNP loci, although the method can distinguish alleles of SKC1, the alleles must be identified and distinguished through agarose electrophoresis test, the test time is prolonged, toxic reagent operation exists, and the reading error of an electrophoresis strip cannot be completely avoided.
Disclosure of Invention
The invention aims to provide a PARMS molecular marker primer which is rapid, time-saving (electrophoresis test detection is omitted), healthy, environment-friendly (toxic reagent ethidium bromide is avoided to be used) and accurate (electrophoresis detection observation error is avoided) aiming at specific difference sites of SKC1 gene sequences of salt-resistant type (Nona type) and salt-sensitive type (overtopping type) which are reported initially and an application thereof.
The invention relates to a molecular marker primer for quickly and efficiently identifying a rice salt-tolerant gene SKC1, which is characterized by comprising the following components in parts by weight:
the upstream primer SKC1-Allele 1:
5’-GAAGGTGACCAAGTTCATGCTGCTCGGCAACAGGTGGTG-3’(Seq No.3)；
downstream primer SKC 1-Allole 2:
5’-GAAGGTCGGAGTCAACGGATTGCTCGGCAACAGGTGGTC-3’(Seq No.4)；
the general primer SKC 1-common:
5’-CTCGGCGAGCTCCTGATC-3’(Seq No.5)。
the primer of the molecular marker can be used for the generation population separation, screening and detection of rice SKC1 salt-tolerant introduction line (such as BC)4F2Population), and can also be used for identifying whether the SKC1 genotype of the rice material is a salt-tolerant genotype (Nona type), a sensitive genotype (overtight type) and a heterozygous type of SKC 1.
The invention discloses a method for separating, screening and detecting generation populations of a rice SKC1 salt-tolerant introgression line by using the primer (or a method for identifying that SKC1 genotype of a rice material is genotype (Nona type), sensitive type (overluminous type) and heterozygote type), which is characterized by comprising the following steps:
(1) PCR amplification is carried out on rice genome DNA by using an upstream primer SKC 1-Allle 1, a downstream primer SKC 1-Allle 2 and a universal primer SKC 1-common;
(2) transferring the PCR amplification product to a fluorescence scanning enzyme-linked immunosorbent assay (three channels of HEX, FAM and ROX) to detect the intensity of a fluorescence signal, analyzing the signal value by adopting SNP decoder software, outputting the signal value by using a scatter diagram format, and genotyping the product;
(3) in the scatter plot, the red signal is salt tolerant genotype (Nona type), the blue signal is sensitive (overtight type), and the green signal is heterozygous type.
The invention also provides another detection method, which specifically comprises the following steps: an upstream primer SKC 1-Allole 1, a downstream primer SKC 1-Allle 2 and a universal primer SKC1-common are used, a QuantStaudio 5 fluorescent quantitative PCR instrument and a Genotyping model are adopted to collect FAM and HEX fluorescent signal values and perform automatic Genotyping.
The PCR amplification system in step (1) is amplified by using 2 × PARMS master Mix (10 uL system is preferred), the test adopts 2 × PARMS Pro PCR Mix (10 uL) of Jingji biology company, and the reaction system comprises 5 uL of 2 × PARMS Pro PCR Mix (containing 2 universal fluorescent primers), 0.15 uL of 10mmol/L Allele1 primer, 0.15 uL of 10mmol/LAllel 2 primer, 0.4 uL of universal primer common, 0.5 uL of template DNA, and 0.5 uL of ddH2O 3.8μL。
The reaction procedure of PCR amplification and scanning in step (1) is preferably as follows: denaturation at 94 deg.C for 15 min; pre-denaturation at 94 ℃ for 20s, annealing and extension at 65 ℃ (-0.8 ℃ per cycle) for 1min, and amplification for 10 cycles; denaturation at 94 ℃ for 20s, annealing and extension at 57 ℃ for 1min, and amplification for 28-30 cycles; extending for 1min at 25 ℃; fluorescence scan at 25 ℃ for 30 s.
Compared with the prior art, the invention has the following advantages and effects:
(1) a molecular marker primer SKC1-Allele1/Allele2/Common for distinguishing the salt-tolerant genotype (Nona type) and the sensitive type (overshadowing type) of a rice salt-tolerant gene SKC1 is developed, so that the SKC1 allelic genotype is accurately, quickly and efficiently identified, and a powerful tool is provided for the subsequent cultivation of new salt-tolerant rice strains.
(2) In the past, the method of distinguishing genotypes by electrophoresis bands has high requirements on electrophoresis results, and band reading errors are inevitable; compared with the existing marker, the marker is quicker and more time-saving, saves the time and energy of running agarose electrophoresis test, and can obtain the result only by 30 seconds of fluorescence scanning after the PCR amplification program is finished. The mark presents results in a fluorescent signal mode, is clear at a glance and improves the accuracy.
Drawings
FIG. 1 shows the comparison results of partial sequence difference sites of salt-tolerant genotype and salt-sensitive genotype of rice SKC 1;
FIG. 2 shows the results of PCR amplification using the present marker primers SKC 1-Allle 1/Allle 2/Common and 2 × PARMS Pro PCRMix (10. mu.L), wherein the red images are HD86 and SKC1 salt-tolerant individuals, the blue images are SANGDAO 19 and SKC1 salt-sensitive individuals, and the green images are heterozygous genotypes;
FIG. 3 shows the sample positions on the PCR sample application plate corresponding to the scattergram.
Detailed Description
The present invention will be described in further detail with reference to the following examples and accompanying drawings. From the following description and these examples, one skilled in the art can determine the essential features of the present invention, but the embodiments of the present invention are not limited thereto.
Example 1: establishment of molecular marker for quickly and efficiently identifying salt-tolerant gene SKC1 of rice
(1) Primer design
We extracted the genome sequence of SKC1 from rice 3K database, wherein SKC1 salt-tolerant genotype rice varieties (Nona, HD86, Pokkali, IR42, Zhenshan 97, Minghui 63, Gui 630) and SKC1 salt-sensitive genotype rice varieties (Yueshuang, Nip, Shengxiu 19, Huai rice 5, Guangdong short No.4, Su 867, Runong 11). Through multiple sequence alignment, the following results are found: a G-C base specific differential site was present 994bp after the initiation codon ATG, as shown in FIG. 1. The site is consistent with the design site of the existing reporter molecule marker (Jiang Yi mu et al, 2018), has specificity and representativeness of the SKC1 genotype, and can be used as a molecular marker development site.
The nucleotide sequence associated with the detection of the salt-tolerant (Nona-type) site is shown below (seqno.1):
CCGGAGCTCGGCGAGCTCCTGATCCGGCGGCGGAGGGGCGGCGGCGAGGGCTACGACCACCTGTTGCC GAGCTC。
the nucleotide sequence associated with the detection of the salt-sensitive (overtravel-type) site is shown below (seqno.2):
CCGGAGCTCGGCGAGCTCCTGATCCGGCGGCGGAGGGGCGGCGGCGAGGGCTACCACCACCTGTTGCC GAGCTC。
based on the sequence differences, SNPway (http:// www.snpway.com) was used to design primers on-line, the sequences of which were as follows:
the upstream primer SKC1-Allele 1:
5’-GAAGGTGACCAAGTTCATGCTGCTCGGCAACAGGTGGTG-3’(Seq No.3)；
downstream primer SKC 1-Allole 2:
5’-GAAGGTCGGAGTCAACGGATTGCTCGGCAACAGGTGGTC-3’(Seq No.4)；
the general primer SKC 1-common:
5’-CTCGGCGAGCTCCTGATC-3’(Seq No.5)。
(2) theoretical analysis of amplified fragments
The rice SKC1 salt-tolerant (Nona) and salt-sensitive (overtight) genomes can respectively amplify fragments with FAM and HEX fluorescent labels, and the lengths of the fragments are both 66 bp; after the images were processed by fluorescence scanning, the salt tolerant (Nona) and salt sensitive (overtight) samples showed red and blue images, respectively, and the heterozygote genotype showed green.
Example 2: analysis of the BC of Saint Rice 19, HD86 and carrying HD86 fragment with Saint Rice 19 as recurrent parent by SKC 1-Allle molecular marker4F2Genotype of segregating population
(1) Extraction of rice leaf genome DNA
The test materials included Saint Rice 19 (No. A1), HD86 (No. A2) and 22 BC4F2Segregating population (accession number A3-12, B1-12)
Selecting young leaves of a single rice plant, and extracting the genomic DNA of the rice by adopting an SDS method, wherein the method comprises the following specific steps:
① placing appropriate amount of leaves in 2mL centrifuge tube, adding 300 μ L DNA extract, adding one steel ball, and shaking with tissue disruption grinder for about 30 s;
② placing the centrifuge tube in 65 deg.C water bath for 30min, and mixing for 2-3 times while turning upside down;
③ standing to room temperature, adding equal volume of chloroform, shaking vigorously, and mixing;
④ 12000 at 12000rpm for 10min, and aspirating about 200. mu.L of the supernatant into a fresh sterilized 1.5mL centrifuge tube;
⑤ adding equal volume of pre-cooled isopropanol, and mixing by up-down inversion, standing at-20 deg.C for about 30min to precipitate DNA;
⑥ 12000 centrifuging at 12000rpm for 10min, removing supernatant, adding 500 μ L75% ethanol, and rinsing once;
⑦ 12000 centrifugal instantly at 12000rpm, pouring out supernatant, placing the centrifugal tube upside down on paper towel, and standing for 2 min;
⑧ drying DNA in a ventilated kitchen, adding a proper amount of 1 × TE buffer to dissolve the DNA;
⑨ storing at-20 deg.C for use.
(2) Analysis of Saint Rice 19, HD86 and BC Using molecular marker SKC 1-Allle4F2Genotype of segregating population
PCR amplification and fluorescence scanning were performed using the identifying primers SKC 1-Allle 1(Seq No.3)/SKC 1-Allle 2(Seq No.4) and SKC1-common (Seq No. 5). And (3) performing conventional amplification by using a common PCR instrument, transferring the product to a fluorescence scanning microplate reader (three channels of HEX, FAM and ROX) to detect the intensity of a fluorescence signal, finally analyzing the signal value on SNPdecoder software, outputting the signal value in a scatter diagram format, and performing genotyping on the product.
The test adopts 2 × PARMS Pro PCR Mix (10 μ L) of Jingtai biology corporation, and the reaction system comprises 5 μ L of 2 × PARMS Pro PCR Mix (containing 2 universal fluorescent primers), 0.15 μ L of 10mmol/L Allole 1 primer, 0.15 μ L of 10mmol/LALLE 2 primer, 0.4 μ L of universal primer common, 0.5 μ L of template DNA, and ddH2O 3.8μL。
The reaction procedure for PCR amplification and scanning was: denaturation at 94 deg.C for 15 min; pre-denaturation at 94 ℃ for 20s, annealing and extension at 65 ℃ (-0.8 ℃ per cycle) for 1min, and amplification for 10 cycles; denaturation at 94 ℃ for 20s, annealing and extension at 57 ℃ for 1min, and amplification for 28-30 cycles; extending for 1min at 25 ℃; fluorescence scan at 25 ℃ for 30 s.
(3) Genotype determination
After the fluorescence scan processing, the red dot pattern was SKC1 salt-resistant (Nona type), blue sensitive (overtaking type), and green heterozygous (fig. 2). The genotype scattergram results described above were consistent with the corresponding material genotypes (fig. 3), consistent with expected results. The developed marker is proved to be capable of quickly and effectively distinguishing the SKC1 genotype.
SEQUENCE LISTING
<110> institute for rice of Shandong province
<120> molecular marker primer for rapidly and efficiently identifying salt-tolerant gene SKC1 of rice and application
<130>0
<160>5
<170>PatentIn version 3.3
<210>1
<211>74
<212>DNA
<213>artificial
<220>
<223> nucleotide sequence related to detection of salt-tolerant (Nona-type) site
<400>1
ccggagctcg gcgagctcct gatccggcgg cggaggggcg gcggcgaggg ctacgaccac 60
ctgttgccga gctc 74
<210>2
<211>74
<212>DNA
<213>artificial
<220>
<223> nucleotide sequences related to the detection of salt-sensitive (overtaking) sites
<400>2
ccggagctcg gcgagctcct gatccggcgg cggaggggcg gcggcgaggg ctaccaccac 60
ctgttgccga gctc 74
<210>3
<211>39
<212>DNA
<213>artificial
<220>
<223> upstream primer SKC 1-Allole 1
<400>3
gaaggtgacc aagttcatgc tgctcggcaa caggtggtg 39
<210>4
<211>39
<212>DNA
<213>artificial
<220>
<223> downstream primer SKC 1-Allole 2
<400>4
gaaggtcgga gtcaacggat tgctcggcaa caggtggtc 39
<210>5
<211>18
<212>DNA
<213>artificial
<220>
<223> Universal primer SKC1-common
<400>5
ctcggcgagc tcctgatc 18
Claims (7)
1. A molecular marker primer for quickly and efficiently identifying a rice salt-tolerant gene SKC1, which is characterized in that,
the upstream primer SKC1-Allele 1:
5’-GAAGGTGACCAAGTTCATGCTGCTCGGCAACAGGTGGTG-3’；
downstream primer SKC 1-Allole 2:
5’-GAAGGTCGGAGTCAACGGATTGCTCGGCAACAGGTGGTC-3’；
the general primer SKC 1-common:
5’-CTCGGCGAGCTCCTGATC-3’。
2. the molecular marker primer of claim 1, wherein the molecular marker primer is used for the separation, screening and detection of the generation population of the salt-tolerant introgression line of rice SKC 1.
3. The application of the molecular marker primer of claim 1 in identifying the SKC1 genotype of rice material as salt-tolerant genotype, sensitive genotype and hybrid genotype.
4. The method for identifying the SKC1 genotypes of the rice materials as the salt-tolerant genotypes, the sensitive genotypes and the heterozygous genotypes by adopting the primer of claim 1, which is characterized by comprising the following steps:
(1) PCR amplification is carried out on rice genome DNA by using an upstream primer SKC 1-Allle 1, a downstream primer SKC 1-Allle 2 and a universal primer SKC 1-common;
(2) transferring the PCR amplification product to a fluorescence scanning microplate reader with three channels of HEX, FAM and ROX to detect the intensity of a fluorescence signal, analyzing the signal value by adopting SNP decoder software, outputting the signal value by using a scatter diagram format, and genotyping the product;
(3) in the scatter plot, the red signal is the salt-tolerant genotype, the blue signal is the sensitive type, and the green signal is the heterozygous type.
5. The method for identifying the SKC1 genotypes of the rice materials as the salt-tolerant genotypes, the sensitive genotypes and the heterozygous genotypes by adopting the primers of claim 1, which is characterized in that an upstream primer SKC1-Allele1, a downstream primer SKC1-Allele2 and a universal primer SKC1-common are utilized, a Quantstudio 5 fluorescent quantitative PCR instrument is adopted, and a Genotyping model is adopted to collect FAM and HEX fluorescent signal values and carry out automatic Genotyping.
6. The method for identifying the SKC1 genotypes as the salt-tolerant genotype, the sensitive genotype and the heterozygous genotype of the rice material as claimed in claim 4 or 5, wherein the PCR amplification in step (1) adopts a2 × PARMS Pro PCR Mix reaction system comprising 5 μ L of 2 × PARMS Pro PCR Mix containing 2 universal fluorescent primers, 0.15 μ L of 10mmol/L Allel 1 primer, 0.15 μ L of 10mmol/L Allel 2 primer, 0.4 μ L of universal primer common, 0.5 μ L of template DNA, ddH 1 primer, and 0.15 μ L of universal primer common primer2O 3.8μL。
7. The method for identifying SKC1 genotypes as salt-tolerant genotype, sensitive genotype and heterozygous genotype of rice material according to claim 6, wherein the reaction procedure of PCR amplification and scanning in step (1) is as follows: denaturation at 94 deg.C for 15 min; pre-denaturation at 94 ℃ for 20s, annealing and extension at 65 ℃ for 1min, and amplification for 10 cycles; denaturation at 94 ℃ for 20s, annealing and extension at 57 ℃ for 1min, and amplification for 28-30 cycles; extending for 1min at 25 ℃; fluorescence scan at 25 ℃ for 30 s.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010347956.4A CN111378781A (en) | 2020-04-28 | 2020-04-28 | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010347956.4A CN111378781A (en) | 2020-04-28 | 2020-04-28 | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111378781A true CN111378781A (en) | 2020-07-07 |
Family
ID=71217613
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010347956.4A Pending CN111378781A (en) | 2020-04-28 | 2020-04-28 | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111378781A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458199A (en) * | 2020-12-24 | 2021-03-09 | 华智生物技术有限公司 | SNP molecular marker of rice salt-tolerant gene SKC1 and application thereof |
| CN113322344A (en) * | 2021-06-23 | 2021-08-31 | 上海市农业科学院 | Detection of rice salt tolerance gene SKC1NBKASP molecular marker and method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103270A (en) * | 2013-01-23 | 2013-05-15 | 中国水稻研究所 | Specific PCR (polymerase chain reaction) molecular marker for detecting alleles controlling salt tolerance of rice |
| CN108411028A (en) * | 2018-05-24 | 2018-08-17 | 湖北省农业科学院粮食作物研究所 | Special SNP codominant markers primer and application in Rice Salt gene SKC1 genes |
-
2020
- 2020-04-28 CN CN202010347956.4A patent/CN111378781A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103270A (en) * | 2013-01-23 | 2013-05-15 | 中国水稻研究所 | Specific PCR (polymerase chain reaction) molecular marker for detecting alleles controlling salt tolerance of rice |
| CN108411028A (en) * | 2018-05-24 | 2018-08-17 | 湖北省农业科学院粮食作物研究所 | Special SNP codominant markers primer and application in Rice Salt gene SKC1 genes |
Non-Patent Citations (2)
| Title |
|---|
| JACQUELINE BATLEY: "Methods in Molecular Biology", 《施普林格科学出版社》 * |
| 蒋医蔚等: "水稻耐盐基因SKC1特异性分子标记开发及应用", 《分子植物育种》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112458199A (en) * | 2020-12-24 | 2021-03-09 | 华智生物技术有限公司 | SNP molecular marker of rice salt-tolerant gene SKC1 and application thereof |
| CN112458199B (en) * | 2020-12-24 | 2021-11-16 | 华智生物技术有限公司 | SNP molecular marker of rice salt-tolerant gene SKC1 and application thereof |
| CN113322344A (en) * | 2021-06-23 | 2021-08-31 | 上海市农业科学院 | Detection of rice salt tolerance gene SKC1NBKASP molecular marker and method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107385024B (en) | Rice fertility restorer gene assisted breeding molecular marker and application thereof | |
| CN109628627B (en) | Development and application of SNP (single nucleotide polymorphism) marker of broad-spectrum rice blast resistance gene Pigm of rice | |
| CN113584216B (en) | Development and application of KASP marker of wheat grain weight gene TaCYP78A16 | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| Noh et al. | A high-throughput marker-assisted selection system combining rapid DNA extraction high-resolution melting and simple sequence repeat analysis: Strawberry as a model for fruit crops | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN113637787B (en) | DNA fragment related to quality of single oil tea fruit and application thereof | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN109628629A (en) | The SNP marker development and application of rice bacterial leaf spot resistant gene xa5 | |
| Hu et al. | Fine mapping of a major quantitative trait locus, qgnp7 (t), controlling grain number per panicle in African rice (Oryza glaberrima S.) | |
| CN107988418B (en) | Primer group, kit and method for pure heterozygous identification of transgenic papaya YK16-0-1 transformant | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN113736907B (en) | SNP locus combination for detecting tomato gray leaf spot resistance and application thereof | |
| CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
| CN116064904A (en) | Molecular marker closely linked with wheat stem rot resistance QTL Qfcr.sicau.2A and application | |
| CN111647677B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-6D and application | |
| CN114214448A (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| CN109913575B (en) | KASP molecular marker for identifying CMS male sterility restoring gene of pepper, kit and application thereof | |
| CN113930532A (en) | KASP molecular marker and method for detecting rice high-temperature-resistant gene TT1 | |
| CN108707685B (en) | SNP (Single nucleotide polymorphism) marker related to tillering number character of millet as well as detection primer and application thereof | |
| CN112609018A (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| Wang et al. | Development of 5Ns chromosome-specific SCAR markers for utilization in future wheat breeding programs | |
| JP5750672B2 (en) | A short-term Koshihikari-type paddy rice cultivar Hikari | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200707 |
|
| RJ01 | Rejection of invention patent application after publication |