CN113637787B - DNA fragment related to quality of single oil tea fruit and application thereof - Google Patents

DNA fragment related to quality of single oil tea fruit and application thereof Download PDF

Info

Publication number
CN113637787B
CN113637787B CN202110844658.0A CN202110844658A CN113637787B CN 113637787 B CN113637787 B CN 113637787B CN 202110844658 A CN202110844658 A CN 202110844658A CN 113637787 B CN113637787 B CN 113637787B
Authority
CN
China
Prior art keywords
quality
oil tea
camellia oleifera
snp molecular
molecular marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110844658.0A
Other languages
Chinese (zh)
Other versions
CN113637787A (en
Inventor
常君
林萍
姚小华
王开良
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Research Institute of Subtropical Forestry of Chinese Academy of Forestry
Original Assignee
Research Institute of Subtropical Forestry of Chinese Academy of Forestry
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Institute of Subtropical Forestry of Chinese Academy of Forestry filed Critical Research Institute of Subtropical Forestry of Chinese Academy of Forestry
Priority to CN202110844658.0A priority Critical patent/CN113637787B/en
Publication of CN113637787A publication Critical patent/CN113637787A/en
Application granted granted Critical
Publication of CN113637787B publication Critical patent/CN113637787B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
    • Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
    • Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
    • Y02P60/87—Re-use of by-products of food processing for fodder production

Abstract

The invention relates to the technical field of molecular markers and genetic breeding of camellia oleifera, in particular to a DNA fragment related to single fruit quality of camellia oleifera and application thereof. The DNA fragment related to the quality of the single oil tea fruit provided by the invention is wsf.10-2 of the linkage group 10 of the linkage map of the oil tea, and the confidence interval is 198.095cM-205.399cM. The invention also provides SNP molecular markers Chr10-85853737 closely linked with the wsf.10-2, wherein the SNP molecular markers contain a nucleotide sequence with the polymorphism of C/T at the 252 th position of the sequence shown as SEQ ID NO.1, and can explain the phenotypic variance of single fruit quality of 44.3 percent. Through detecting the SNP molecular marker, identification and auxiliary screening can be performed in the seedling stage, so that the production cost is greatly saved, and the selection efficiency of fruit size selection breeding is improved.

Description

DNA fragment related to quality of single oil tea fruit and application thereof
Technical Field
The invention relates to the technical field of molecular markers and genetic breeding of oil tea. In particular to a DNA fragment related to the quality of single fruits of oil tea, a molecular marker closely linked with the DNA fragment and application of the DNA fragment.
Background
The oil tea (Camellia oleifera) is used as one of four large oil plants (rape, peanut, soybean and oil tea), and is widely planted in subtropical areas, and the planting area reaches over 6500 mu. The oil tea seed oil has unsaturated fatty acid content of more than 90%, is rich in squalene, vitamin E and other nutrient components, and is high-quality edible oil called as 'Oriental olive oil'. Breeding of high-yield (oil) excellent varieties of oil tea is always the basis and guarantee of healthy development of oil tea industry. In the past, the camellia oleifera breeding work taking selection and cross breeding as main means has made a long progress, but the conventional breeding period of the camellia oleifera is long, the breeding of new varieties is slow, and the breeding speed of improved varieties can not meet the requirements of industrial development, which has become one of important factors limiting the development of the camellia oleifera industry.
Compared with the traditional breeding technology, molecular marker assisted breeding can be selected from the seedling stage, so that the breeding period is greatly shortened, and the advantage of economic forest breeding with fruits as main purposes is particularly obvious. The molecular marker assisted breeding is not separated from effective molecular markers, so that the development of the molecular markers related to fruit size, oil tea fruit yield and oil quality phenotype is of great significance to the molecular marker assisted breeding of oil tea oil yield and quality and the genetic improvement of related characters.
The indexes such as fruit size, fruit yield, kernel oil content and the like directly determine the oil yield (oil) of the oil tea in unit area, and meanwhile, the breeding of large-sized new varieties has important significance for improving picking efficiency and reducing labor cost. Therefore, the research of breeding large-fruit new varieties of the oil tea is developed, is an important way for improving the yield of the oil tea and reducing the labor cost, and has very important significance for the promotion and healthy development of the oil tea industry.
Disclosure of Invention
The invention aims to provide a single-fruit quality gene locus of camellia oleifera, a molecular marker closely linked with the gene locus, and application of the molecular marker in large-fruit germplasm phenotype identification and breeding of camellia oleifera.
The development of the camellia oleifera single-fruit quality gene locus and the molecular marker closely linked with the gene locus is realized by developing high-density genetic linkage map construction and QTL positioning of single-fruit quality traits based on established camellia oleifera F1 generation hybridization groups. The simplified genome sequence of the camellia oleifera is a region for marker development of the invention.
The development process of the key gene locus and the linked SNP molecular marker in the invention is basically as follows:
(1) The camellia oleifera clone longlin No. 53 (20.38 g) and longlin No. 81 (14.31 g) with remarkable fruit size difference are used for controlling pollination, so that a camellia oleifera F1 hybrid population with widely separated fruit sizes is created.
(2) The fully mature fruits of 180 individual plants of the hybrid population are collected, and the weight of the individual fruits is measured.
(3) Collecting tender leaves of 180 single plants and two parents of a hybridization population, extracting DNA by using a TaKaRa MiniBEST plant genome DNA extraction kit (TaKaRa, dalia, china), constructing a simplified genome (ddRAD) sequencing library by using EcoRI and NlaIII (Hin 1 II) double enzyme digestion of each sample, and sequencing by using a Illumina HiSeqXten platform.
(4) Analyzing 180 samples obtained in the step (3) and SNP loci of 2 parent simplified genomes by taking diploid camellia oleifera genome as a reference sequence. SNP data were filtered according to the following principle: parent sequencing depth is more than or equal to 10X, and offspring sequencing depth is more than or equal to 8X; the genotype deletion rate is less than or equal to 30 percent; the SNP mass value is more than or equal to 30. The software BWA used in the process is public free.
(5) Linkage map construction is carried out by using Joinmapl 4.0 software, and parameters are set as follows: rec is less than or equal to 0.4, LOD is more than or equal to 3.0, jump=5, and a mapping function uses Kosambi; and analyzing the arrangement sequence of the markers in the linkage group, and calculating the genetic distance between adjacent markers.
(6) The QTL Icimapping software is used for data analysis, and a complete interval mapping method (ICIM) is used for QTL positioning. The scanning step length is set to be 1cM; the probability of stepwise regression marker entry (PIN) was 0.002 (pout=2×pin=0.002); LOD value was 2.5.
By utilizing the technical measures, the invention obtains the single-fruit quality gene locus wsf.10-2 of the camellia oleifera located on the linkage group 10 (LG 10), the contribution rate of the gene locus is 44.3%, the SNP marker closely linked with the locus is Chr10-85853737, and the genotype is C/T (table 1).
TABLE 1 Gene loci and linkage SNP molecular marker information
Gene locus Linkage group Position of Confidence interval Linkage SNP Parental genotype LOD Contribution rate
wsf.10-2 LG10 205.399cM 198.095cM-205.399cM Chr10-85853737 CT*CC 3.82 44.3％
Specifically, the invention provides the following technical scheme:
in a first aspect, the invention provides a DNA fragment related to the quality of single fruits of camellia oleifera, which is wsf.10-2 of linkage groups positioned in a camellia oleifera linkage map No. 10; the confidence interval is 198.095cM-205.399cM.
The contribution rate of the DNA fragment to the phenotype is 44.3%, and the DNA fragment can be used for map-based cloning and molecular marker assisted selection.
SNP molecular markers closely linked with the DNA fragment are Chr10-85853737, wherein the Chr10-85853737 is positioned at 85853737bp of chromosome 10 of the camellia oleifera genome, and the polymorphism is C/T.
In a second aspect, the invention provides an SNP molecular marker closely linked with a single-fruit quality locus of camellia oleifera, which comprises an SNP molecular marker Chr10-85853737, wherein Chr10-85853737 is positioned at 85853737bp of chromosome 10 of a camellia oleifera genome, and the polymorphism is C/T.
The SNP molecular marker is tightly linked with a single-fruit quality locus wsf.10-2 of the camellia oleifera.
Specifically, SNP molecular marker Chr10-85853737 contains the nucleotide sequence with polymorphism C/T at 252 th site of the sequence shown in SEQ ID NO. 1.
Preferably, the SNP molecular marker Chr10-85853737 comprises a nucleotide sequence with the polymorphism of 252 th position of the sequence shown as SEQ ID NO.1 being C/T.
SEQ ID NO.1：
CACAGTCATTAGAGTTAGCACCTAGTGATGTTTCTAGTTCATCTCAGCCTTTAGTCATCACTGCTTTTGTGGAAACTTCATCCAGAATTGCTCAAAGAGAGACAATAATGGCTAAAGATATTGTGCAATTATTTAAATAGAACAATTATACTAATTTGTGCTTTCAAACTGTAGGAAAGCAACTAACCAGAATTGAGGTAGCTATAAATACTTTTAAAAATCATAAAATGGTACGACCTTCCACCTCAACTCTTTAACCAGTAAATAGTAAACCACCTTTAGAAGTAACTAATTTTAAGTTACGTTTTGATAAATTGGGTAGTGAATTCATGGATACCCTTTTACAAAAAATGAGTGATTTAAATTTAGGGA AATCAGCACCAGGCAGT。
Further, SNP molecular markers Chr10-85853737 are obtained by PCR amplification by using a primer pair with a sequence shown as SEQ ID NO.2-3 and using camellia oleifera genome DNA as a template.
SEQ ID NO.2：5’-CACAGTCATTAGAGTTAGCA-3’；
SEQ ID NO.3：5’-ACTGCCTGGTGCTGATTTCC-3’。
SNP molecular marker Chr10-85853737, the genotype of the locus with polymorphism is C/T, and the locus corresponds to high single fruit quality; genotype C/C, corresponding to low single fruit quality. The quality of the single fruit is the quality of fully mature fresh fruits, and the unit gram.
In a third aspect, the present invention provides primers for amplifying the SNP molecular markers.
As one embodiment of the present invention, the primer includes a primer shown as SEQ ID NO. 2-3.
The invention also provides a reagent or a kit containing the primer.
In a fourth aspect, the present invention provides a DNA fragment related to quality of single fruit of camellia oleifera, or any one of the following applications of the above SNP molecular markers, the above primers, the above reagents or the above kits:
(1) Application in identifying size phenotype of oil tea fruits;
(2) The method is applied to early prediction of the quality of the oil tea fruits;
(3) The method is applied to the quality improvement of the oil tea fruits or the auxiliary breeding of the oil tea fruits by molecular markers of the quality and the size of the oil tea fruits;
(4) The method is applied to screening of large-fruit oil tea.
In a fifth aspect, the invention provides a method for identifying the quality of camellia oleifera fruits, comprising the following steps:
(1) Extracting genomic DNA of the oil tea to be identified;
(2) Using genome DNA as a template, and performing PCR amplification by using primers with sequences shown as SEQ ID NO. 2-3;
(3) Analyzing the genotype of the SNP molecular marker in the PCR amplification product, and judging the phenotype of the quality of the single fruit of the camellia oleifera to be identified according to the genotype;
in the step (1) of the method, the oil tea to be identified is specifically selected from hybrid F1 generation individuals of longlin No. 53×longlin No. 81.
The camellia oleifera genome DNA was extracted using TaKaRa MiniBEST plant genome DNA extraction kit (TaKaRa, dalia, china).
In step (2), the reaction procedure for PCR amplification is: 94-95 ℃ for 3-5min;94-95 ℃,15-30s,65-69 ℃,40-60s,38-45 cycles; 67-70 deg.C for 3-6min. Preferably, the pre-denaturation is carried out at 95℃for 3min for 1 cycle; denaturation at 95 ℃,15s, 68 ℃, extension at 45s, 40 cycles; at 68℃for 5min,1 cycle was extended thoroughly.
In step (2), after amplification, the resulting PCR product is detected and recovered by agarose gel electrophoresis.
As one embodiment, the concentration of agarose gel in agarose gel electrophoresis is 1.2%. AxyPrep DNA gel recovery kit (AxyGEN, code No. AP-GX-50) was used for gel recovery.
In the step (3), the genotype of the SNP molecular marker can be analyzed by adopting the conventional technical means in the field, such as sequencing and the like, and the sequence can be determined by taking SEQ ID NO.2-3 as a sequencing primer.
The method for judging the quality, the size and the phenotype of the single fruit of the camellia oleifera to be identified in the step (3) comprises the following steps:
if the genotype of the locus with polymorphism of the SNP molecular marker Chr10-85853737 is C/T, the camellia oleifera to be identified is high single-fruit quality camellia oleifera; if the genotype is C/C, the oil tea to be identified is low single-fruit quality oil tea.
The method for identifying the high single-fruit quality oil tea provided by the invention comprises the following steps:
(1) Extracting genomic DNA of the oil tea to be identified;
(2) Using DNA as a template, and carrying out PCR amplification by using the primer;
(3) Analyzing the genotype of SNP molecular markers in PCR amplification products, and judging whether the oil tea to be identified is high single-fruit quality oil tea according to the genotype.
If the genotype of the locus with polymorphism of the SNP molecular marker Chr10-85853737 is C/T, the camellia oleifera to be identified is of high single fruit quality; if the genotype is C/C, the camellia oleifera to be identified is low in single fruit quality.
The invention has the beneficial effects that: the invention provides a single-fruit quality major gene locus of oil tea, the contribution rate of the single-fruit quality major gene locus to the single-fruit quality phenotype is 44.3%, and SNP loci closely linked with the gene locus are developed. The SNP marker is used for carrying out auxiliary selection on hybrid F1 generation individuals of the Changlin No. 53 and Changlin No. 81, and the result shows that in the single plant with high single fruit quality genotype, the single fruit quality of 74.68 percent of individuals is higher than the average value (19.25 g) of the single fruit quality of the group; of the individuals of low single fruit quality genotypes, 77.22% of individuals had individual fruit quality below the population average (19.25 g). This shows that the marking is practically effective for assisting the selection.
In conventional selection breeding of camellia oleifera, the identification of fruit size traits can be achieved only by 5-6 years of seedling forestation, and time and labor are wasted. The SNP locus has definite position, convenient and quick detection method, stronger purposiveness, less workload, higher efficiency and low cost, and is not influenced by environment. Therefore, by detecting the SNP locus, identification and auxiliary screening can be performed in the seedling stage, so that the production cost is greatly saved and the selection efficiency is improved. In the breeding of the camellia oleifera, the molecular marker and the detection method thereof can be selected to identify the camellia oleifera with high single fruit quality for breeding, so that the selection efficiency of the breeding of the camellia oleifera can be improved, and the breeding process can be accelerated.
Drawings
FIG. 1 is a schematic diagram showing the position of the single fruit quality gene locus wsf.10-2 of the oil tea in example 3 of the present invention.
Detailed Description
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Modifications and substitutions to methods, procedures, or conditions of the present invention may be made without departing from the spirit and nature of the invention and are intended to be within the scope of the present invention.
Unless otherwise indicated, the experimental materials, reagents, instruments, etc. used in the examples of the present invention are commercially available; all technical means in the embodiments of the present invention are conventional means well known to those skilled in the art unless specifically indicated.
The individual hybrid F1 generation plants of Changlin No. 53×Changlin No. 81 used in the following examples were collected and evaluated by the woody oil breeding and cultivation research group of the subtropical forestry institute of the national forestry institute, and were stored in the Oriental red forest farm germplasm resource nursery in the Chebula urban area of Zhejiang.
Example 1 construction and trait determination of Single fruit quality separation population of Camellia oleifera
In the embodiment, long forest No. 53 and long forest No. 81 are used as female parent and male parent respectively, and a controlled pollination technology is adopted to create a hybrid F1 generation group with widely separated economic characters. The F1 group is repeatedly designed and stored in the Oriental red forest farm of urban area of Zhejiang province for 3 times by adopting a random block. After the fruits of 180 sub-generation individuals are fully ripe (5% of fruits are cracked), 20-30 fresh fruits are collected per sample, the fresh fruit quality is measured, and the average single fruit quality is calculated. The result shows that the quality of single fruits of the hybridization group is obviously separated, which indicates that the character has the characteristic of quantitative characters.
Example 2 construction of tea-oil camellia linkage map
1. Genomic DNA extraction
180 individuals of Changlin No. 53X Changlin No. 81 family and their double parents were collected at 3 months, and their spring tender leaves were used to extract total genomic DNA by KAC method (TaKaRa kit Code No. 9768). The method comprises the following specific steps:
(1) Firstly, adding 500 mu l of Buffer HS II into a 1.5ml centrifuge tube; accurately weighing 100mg of tender tea leaves of the camellia oleifera, and carrying out liquid nitrogen grinding; the ground powder was rapidly added to a centrifuge tube and mixed well, followed by 10. Mu.l of RNase A (10 mg/ml) and thoroughly mixed by shaking and incubated in a water bath at 56℃for 10 minutes.
(2) 62.5. Mu.l Buffer KAC was added and mixed well. Placed on ice for 5 minutes and centrifuged at 12,000rpm for 5 minutes. Taking supernatant, adding Buffer GB with the same volume as the supernatant, and fully and uniformly mixing.
(3) Spin Column was placed in a Collection Tube and the solution was transferred to Spin Column (since more solution was needed, column passing was typically performed in two passes, each pass having a volume of no more than 700 μl), and the filtrate was discarded by centrifugation at 12,000rpm for 1 minute.
(4) Mu.l Buffer WA WAs added to Spin Column and centrifuged at 12,000rpm for 1 min, and the filtrate WAs discarded.
(5) Mu.l of Buffer WB was added to Spin Column and centrifuged at 12,000rpm for 1 min, and the filtrate was discarded.
(6) Repeating the operation step (5).
(7) Spin Column was mounted on a Collection Tube and centrifuged at 12,000rpm for 2 minutes.
(8) The Spin Column was placed on a new 1.5ml centrifuge tube, and 30 to 50. Mu.l of an Elution Buffer or sterilized distilled water was added to the center of the Spin Column membrane and allowed to stand at room temperature for 5 minutes.
(9) The DNA was eluted by centrifugation at 12,000rpm for 2 minutes.
2. dd-RAD simplified genome sequencing
The genome DNA of each sample is subjected to double digestion by the optimal digestion combination EcoRI and NlaIII, and then is connected with a connector which comprises 3 parts, namely a sequencing primer, a molecular recognition sequence (barcode) and a sequence complementary to a cohesive end generated after the genome is digested by the endonuclease. Each sample was then subjected to PCR amplification. Amplification procedure: 98 ℃ for 2min;98℃30s,60℃30s,72℃15s,13 cycles; and at 72℃for 5min. The PCR product was electrophoresed on a 2% agarose gel, and fragments of 300-500bp in length were recovered and purified from the gel using the AxyPrep DNA gel recovery kit. Purified DNA samples with different barcode were pooled as one sample for every 12 individuals, a dd-RAD sequencing library was constructed and sequenced using a Illumina HiSeqXten platform.
3. SNP locus recognition and genotyping
(1) Sequencing data is filtered, and raw sequence data obtained by sequencing is firstly filtered according to the following steps:
1) According to the barcode on the sequence, a custom Perl script is used for rapidly separating the mixed data of 12 samples according to individuals;
2) The sequence with the barcode followed by the recognition site for the endonuclease remains and the remaining sequence is discarded;
3) Sequences with a number of missing nucleotides > 3 were discarded;
4) Other low quality, contaminated sequences were further filtered using the NGS QC Toolkit software package (Patel R K, jain m.ngs QC Toolkit: A Platform for Quality Control of Next-Generation SequencingData [ M ]. Springer US, 2015.).
(2) SNP identification and filtration: the high quality reads of each sample were aligned to the reference genomic sequence. Sequences without alignment are removed, and the rest sequences recognize SNP sites. The identified SNP loci are strictly filtered, and high-quality SNPs data are obtained. The software Tophat v2.1.1, bcftools v1.9 and BWA are used in the process for free of disclosure. The SNPs filtration criteria were as follows:
1) Parent sequencing depth is more than or equal to 10X, and offspring sequencing depth is more than or equal to 8X;
2) The genotype deletion rate is less than or equal to 30 percent;
3) The SNP mass value is more than or equal to 30.
4. Genetic map construction
(1) Mark separation mode detection: all SNPs detected were analyzed using the CP function in JoinMap4.0 software, the marker isolation ratios were calculated using chi-square test to determine the isolation pattern of each marker, such as ab×cd, ef×eg, hk×hk, lm×ll, nn×np, cc×ab, ab×cc, etc., and significantly abnormal isolation (P < 0.05) or markers containing abnormal bases were filtered and rejected. Four types of markers, ef Xeg, hk Xhk, lm Xll and nn Xnp, were used for subsequent linkage map construction.
(2) Construction of a genetic linkage map: linkage map was constructed with the JoinMap4.0 software, parameters set as: rec is less than or equal to 0.4, LOD is more than or equal to 3.0, jump=5, and a mapping function uses Kosambi; and analyzing the arrangement sequence of the markers in the linkage group, and calculating the genetic distance between adjacent markers. The constructed linkage map has 15 linkage groups, 2780 molecular markers on the linkage map, and is covered by 3327cM, and the average distance is 1.20cM.
Example 3 Single fruit quality Gene locus and linkage SNP locus excavation of Camellia oleifera
The QTL Icimapping software is used for data analysis, and a complete interval mapping method (ICIM) is used for QTL positioning of single fruit quality. The scanning step length is set to be 1cM; the probability of stepwise regression mark entry (PIN) was set to 0.002 (pout=2×pin=0.002); the LOD value was set to 2.5. The LOD significance threshold was determined by running 1000 permutation tests. The single-fruit quality gene locus wsf.10-2 of the camellia oleifera is located on chromosome 10 of the camellia oleifera, the contribution rate is 44.3%, and the SNP molecular marker closely linked with the single-fruit quality gene locus wsf.10-2 is Chr10-85853737 (see table 1, figure 1).
Example 4 application of high single fruit quality gene locus and linkage SNP molecular marker in oil tea breeding
1. 158 individual plants are randomly selected from the longlin No. 53×longlin No. 81 tea-oil tree hybrid F1 generation family group obtained in the example 1 as materials, and tender leaves are collected to extract total DNA (the extraction method is the same as in the example 2). The DNA solution was diluted 100-fold to be used as a working solution.
2. PCR amplification was performed on the DNA working solution using the primer set shown in SEQ ID NO.2-3, and the reaction system is shown in Table 2:
TABLE 2PCR reaction System
The PCR amplification procedure was:
3. and (3) carrying out gel detection, purification recovery, sequencing and genotyping on the PCR amplified product. Gel detection and purification recovery were performed according to the instructions of AxyPrep DNA gel recovery kit (AxyGEN, code No. AP-GX-50), the procedure was as follows:
(1) A1.2% agarose gel was prepared, 50. Mu.l of the whole amplification product was loaded, the electrophoresis voltage was 5V/cm, and the electrophoresis was stopped when the xylene blue in the loading buffer reached a distance of 1cm from the front end of the gel for about 20 minutes.
(2) Agarose gel containing the target DNA was excised under an ultraviolet lamp, and the gel surface was blotted with a paper towel and minced. The gel weight was calculated as a gel volume (e.g. 100mg = 100 μl volume).
(3) Adding 3 gel volumes of Buffer DE-A, mixing, heating at 75deg.C, and intermittently mixing every 2-3 min until gel block is completely melted.
(4) Adding 0.5 Buffer DE-A volume Buffer DE-B, and mixing.
(5) The above solution was transferred to a DNA preparation tube, centrifuged at 12000rpm for 1 minute, and the filtrate was discarded.
(6) Mu.l Buffer W1 was added and centrifuged at 12000rpm for 30 seconds, and the filtrate was discarded.
(7) Mu.l Buffer W2 was added and centrifuged at 12000rpm for 30 seconds, and the filtrate was discarded. The mixture was washed once with 700. Mu.l buffer W2 in the same manner, centrifuged at 12000rpm for 1 minute, and the filtrate was discarded.
(8) The preparation tube was placed back into the centrifuge tube and centrifuged at 12000rpm for 1 minute.
(9) The preparation tube was placed in a clean 1.5ml centrifuge tube, 25-30. Mu.l deionized water was added to the center of the preparation film, and the tube was allowed to stand at room temperature for 1 minute. DNA was eluted by centrifugation at 12000rpm for 1 min.
(10) The gel is used for recovering DNA, the corresponding amplification primer is used as a sequencing primer, the nucleotide sequence of the amplified product is determined by adopting first-generation sequencing, and the genotype of the SNP locus on the sequencing peak diagram is interpreted by using Chromas software.
4. The genotypes of the Chr10-85853737 sites were identified separately for all individuals. Comparing the relation between the genotype of each locus and the quality of single fruit, if the genotype of the locus is C/T, the individual oil tea is high single fruit quality oil tea; if the genotype is C/C, the individual tea-oil camellia is low single-fruit quality tea-oil camellia.
5. 158F 1 generation individuals and parent fully mature fruits are collected, and the single fruit quality is measured. The results in Table 3 show that in the single plant with the high single fruit quality genotype at the Chr10-85853737 locus, 74.68% of individuals have fruit quality higher than the average value of single fruit quality of the population (19.25 g); of the individuals whose genotypes were low single fruit quality genotypes, 77.22% had single fruit quality below the population average (19.25 g). The marker is practically effective for auxiliary selection, can be used for early identification or auxiliary identification, can greatly save production cost, improve selection efficiency and accelerate the breeding process of the camellia oleifera.
TABLE 3 Single fruit quality and genotype data for Changlin No. 53, changlin No. 81 and F1 individuals of male parent
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> China national institute of forestry science subtropical forestry institute
<120> DNA fragment related to quality of single fruit of Camellia oleifera and application thereof
<130> KHP211117270.2
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 389
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cacagtcatt agagttagca cctagtgatg tttctagttc atctcagcct ttagtcatca 60
ctgcttttgt ggaaacttca tccagaattg ctcaaagaga gacaataatg gctaaagata 120
ttgtgcaatt atttaaatag aacaattata ctaatttgtg ctttcaaact gtaggaaagc 180
aactaaccag aattgaggta gctataaata cttttaaaaa tcataaaatg gtacgacctt 240
ccacctcaac tctttaacca gtaaatagta aaccaccttt agaagtaact aattttaagt 300
tacgttttga taaattgggt agtgaattca tggataccct tttacaaaaa atgagtgatt 360
taaatttagg gaaatcagca ccaggcagt 389
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
cacagtcatt agagttagca 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
actgcctggt gctgatttcc 20

Claims (9)

1. SNP molecular markers closely linked with single fruit quality sites of oil tea, characterized by comprising: SNP molecular marker Chr10-85853737, said Chr10-85853737 contains the nucleotide sequence of 252 th polymorphism C/T as shown in SEQ ID NO. 1.
2. The SNP molecular marker according to claim 1, wherein the primer pair with the sequence shown as SEQ ID NO.2-3 is obtained by PCR amplification by taking camellia genomic DNA as a template.
3. The SNP molecular marker according to any one of claims 1-2, wherein in the SNP molecular marker Chr10-85853737, the genotype of the site with the polymorphism is C/T, corresponding to high single-fruit quality; genotype C/C, corresponding to low single fruit quality.
4. A primer for amplifying the SNP molecular marker as set forth in any one of claims 1-3, characterized by comprising a primer having a sequence as set forth in SEQ ID No. 2-3.
5. A reagent or kit comprising the primer according to claim 4.
6. Use of the SNP molecular marker of any one of claims 1-3 or the primer of claim 4 or the reagent or kit of claim 5 for any one of the following:
(1) Application in identifying size phenotype of oil tea fruits;
(2) The method is applied to early prediction of the quality of the oil tea fruits;
(3) The method is applied to the quality improvement of the oil tea fruits or the auxiliary breeding of the oil tea fruits by molecular markers of the quality and the size of the oil tea fruits;
(4) The method is applied to screening of large-fruit oil tea.
7. A method for identifying the quality of camellia oleifera fruits or screening camellia oleifera with high single fruit quality, which is characterized by comprising the following steps:
(1) Extracting genomic DNA of the oil tea to be identified;
(2) Using genome DNA as a template, and performing PCR amplification by using primers with sequences shown as SEQ ID NO. 2-3;
(3) Analyzing the genotype of the SNP molecular marker of any one of claims 1 to 3 in PCR amplification products, and judging the phenotype of the quality of the single fruit of the camellia oleifera to be identified according to the genotype.
8. The method of claim 7, wherein in step (2), the reaction procedure for PCR amplification is: 94-95 ℃ for 3-5min;94-95 ℃,15-30s,65-69 ℃,40-60s,38-45 cycles; 67-70 deg.C for 3-6min.
9. The method according to claim 8, wherein in the step (3), the method for judging the quality size phenotype of the single fruit of the camellia oleifera to be identified is as follows:
if the SNP molecular marker Chr10-85853737 has the genotype of the polymorphic locus of C/T, the camellia oleifera to be identified has high single fruit quality; and if the genotype is C/C, the camellia oleifera to be identified is low in single fruit quality.
CN202110844658.0A 2021-07-26 2021-07-26 DNA fragment related to quality of single oil tea fruit and application thereof Active CN113637787B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110844658.0A CN113637787B (en) 2021-07-26 2021-07-26 DNA fragment related to quality of single oil tea fruit and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110844658.0A CN113637787B (en) 2021-07-26 2021-07-26 DNA fragment related to quality of single oil tea fruit and application thereof

Publications (2)

Publication Number Publication Date
CN113637787A CN113637787A (en) 2021-11-12
CN113637787B true CN113637787B (en) 2023-10-31

Family

ID=78418320

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110844658.0A Active CN113637787B (en) 2021-07-26 2021-07-26 DNA fragment related to quality of single oil tea fruit and application thereof

Country Status (1)

Country Link
CN (1) CN113637787B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114214453A (en) * 2022-01-06 2022-03-22 广西壮族自治区林业科学研究院 Method for accurately identifying camellia oleifera based on DNA bar code
CN114410668A (en) * 2022-01-29 2022-04-29 中南林业科技大学 Camellia oleifera self-incompatible gene S-RNase, SNP locus and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111705152A (en) * 2020-05-26 2020-09-25 中国林业科学研究院亚热带林业研究所 SNP molecular marker related to stearic acid content in camellia seed oil and application thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008153804A2 (en) * 2007-05-31 2008-12-18 Monsanto Technology Llc Soybean polymorphisms and methods of genotyping
CN109554493B (en) * 2018-12-10 2021-09-17 北京林业大学 SNP molecular marker closely linked with plum blossom pendulous branch character and detection method and application thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111705152A (en) * 2020-05-26 2020-09-25 中国林业科学研究院亚热带林业研究所 SNP molecular marker related to stearic acid content in camellia seed oil and application thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
12个油茶品种的SSR特征指纹鉴别;李海波;丁红梅;陈友吾;徐梁;李楠;胡传久;;中国粮油学报(10);179-186 *
Association Genetics Identifies Single Nucleotide Polymorphisms Related to Kernel Oil Content and Quality in Camellia oleifera;Ping Lin等;J. Agric. Food Chem;2547-2562 *
The genome of oil-Camellia and population genomics analysis provide insights into seed oil domestication;Lin et al;Genome Biology;1-21 *
普通油茶转录组EST-SSR分子标记开发;李海波;王珊;丁红梅;陈友吾;胡传久;李楠;魏海龙;;植物生理学报(07);153-164 *
油茶的驯化及面临的问题;赵松子;赵攀;;南方林业科学(06);58-62 *
油茶重要经济性状全基因组关联分析;彭邵锋;中国优秀博士毕业论文全文数据库;D049-34 *

Also Published As

Publication number Publication date
CN113637787A (en) 2021-11-12

Similar Documents

Publication Publication Date Title
US10301687B2 (en) Sidt 1 gene controlling determinate growth habit in sesame and SNP molecular marker thereof
CN113637787B (en) DNA fragment related to quality of single oil tea fruit and application thereof
CN111705152B (en) SNP molecular marker related to stearic acid content in camellia seed oil and application thereof
CN113637786B (en) DNA fragment and SNP molecular marker related to linoleic acid content in oil tea seed oil and application thereof
CN111500763A (en) SNP molecular marker related to palmitoleic acid content in oil tea seed oil and application thereof
CN107858447B (en) Single nucleotide polymorphism marker site, primer pair, kit and application for identifying peach blossom single-petal/double-petal character
CN110747288A (en) Rice large grain gene function marker and application
CN112126705A (en) MdMYB44 gene promoter SNP (Single nucleotide polymorphism) variation site in apple and application thereof in prediction of apple fruit acidity
CN109486987A (en) A kind of fast construction method of high density genetic linkage maps
CN111500764A (en) SNP molecular marker related to oleic acid and linoleic acid content in oil tea seed oil and application thereof
CN110894542A (en) Primer for identifying types of GS5 gene and GLW7 gene of rice and application of primer
CN113584203B (en) DNA fragment related to single fruit quality of camellia oleifera, SNP molecular marker closely linked with DNA fragment and application of DNA fragment
CN113584204B (en) DNA fragment related to kernel yield of camellia seeds, SNP molecular marker closely linked with DNA fragment and application of DNA fragment
CN111534631B (en) 2 SNP molecular markers related to oil content of oil-tea camellia kernel and application thereof
CN113430298B (en) DNA fragment related to content of linolenic acid in camellia seed oil, SNP molecular marker closely linked with DNA fragment and application of SNP molecular marker
CN106755413B (en) Rice nitrogen absorption and utilization site qNUE6 and molecular marking method thereof
CN111378781A (en) Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application
CN113736866B (en) SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof
CN106399538B (en) Application of SNP (single nucleotide polymorphism) marker closely linked with peach tree dwarfing gene
CN113637785B (en) DNA fragment and SNP molecular marker related to kernel yield of camellia seeds and application thereof
CN113604593B (en) DNA fragment related to linoleic acid content in oil tea seed oil and application thereof
CN104593510A (en) Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes
CN111534630B (en) SNP molecular marker related to oil content of camellia seed kernels and application thereof
CN113430297B (en) DNA fragment related to content of palmitic acid in oil-tea camellia seed oil, SNP molecular marker closely linked with DNA fragment and application of SNP molecular marker
CN107893125B (en) Single nucleotide polymorphism marker locus, primer pair, kit and application for identifying peach blossom bell/rose type trait

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant