CN114214448B - SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof - Google Patents
SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof Download PDFInfo
- Publication number
- CN114214448B CN114214448B CN202111275901.8A CN202111275901A CN114214448B CN 114214448 B CN114214448 B CN 114214448B CN 202111275901 A CN202111275901 A CN 202111275901A CN 114214448 B CN114214448 B CN 114214448B
- Authority
- CN
- China
- Prior art keywords
- rice
- bph30
- brown planthopper
- planthopper resistant
- snp marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof. The SNP marker is positioned at 946632bp of chromosome 4 of rice, and the polymorphism is A/G. The invention designs a corresponding KASP detection primer aiming at the SNP locus, and judges whether a detected plant contains a rice brown planthopper resistant gene Bph30 by detecting polymorphism of the SNP locus. The SNP marker provided by the invention can effectively identify the genotype of the brown planthopper resistant gene Bph30 in plants. The SNP marker and the KASP primer thereof provided by the invention have the advantages of simple operation, low cost, short period and the like, and the marker is positioned in the Bph30 gene, has good stability, is not influenced by other gene effects or environmental factors, can be applied to molecular auxiliary selection, can accelerate the application of the Bph30 gene in the breeding of brown planthopper resistant rice varieties, obviously shortens the breeding period of the brown planthopper resistant rice varieties, and reduces the breeding cost.
Description
Technical Field
The invention relates to the fields of molecular biology and plant molecular breeding, in particular to an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof.
Background
Rice is one of the most important food crops in China and the world. Brown planthoppers are monophagic pests which only damage rice, and needle-shaped mouthparts are used for penetrating phloem of the rice to absorb juice, so that leaves turn yellow or die, and yield reduction and even harvest of the rice are caused. Brown planthoppers can also transmit rice virus diseases. Brown planthoppers are migratory pests and have strong explosive power. The restraint of the development and the harm of brown planthoppers is an important requirement for guaranteeing the high and stable rice yield in China. The main reasons for the occurrence of brown planthoppers in successive years are the general poor insect resistance of rice varieties and the remarkable enhancement of the drug resistance of pests. Therefore, the development and identification of brown planthopper resistant genes from rice seed resources and cultivation of brown planthopper resistant rice varieties are key technical approaches for effectively preventing and controlling brown planthoppers which are important agricultural pests. The brown planthoppers are controlled by using the resistance of rice varieties, so that chemical pesticides can be obviously reduced or even not used, the rice production cost is reduced, the ecological environment is protected, and the green production and sustainable development of grains are realized.
The traditional rice insect-resistant breeding is to perform phenotype selection on plants through insect-resistant character identification, so that time and labor are wasted, the plants are easily influenced and limited by environmental conditions, errors are easily caused in identification results, and the selection efficiency is low. Molecular marker assisted selection is a modern breeding technique that utilizes functional markers closely linked to resistance genes or within genes to screen for a trait of interest in offspring in combination with genotype and phenotype selection. The method can not only greatly improve the breeding efficiency and shorten the breeding period, but also save a great deal of manpower and material resource costs. The brown planthopper resistance gene Bph30 is cloned in a rice chromosome 4 (GenBank accession number: MW 176108.1), codes a protein containing two leucone-rich domains (LRDs), belongs to a novel planthopper resistance gene family, is a completely dominant insect resistance gene, and is broad-spectrum brown planthopper resistant and sogatella furcifera resistant. The development of a high-efficiency molecular marker identification system aiming at the Bph30 gene has important significance for the application of the gene in breeding and the accurate identification of insect resistance and further improvement of brown planthopper resistance of rice.
Disclosure of Invention
The invention aims to provide an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice and application thereof.
In order to achieve the purpose of the invention, the inventor has developed a plurality of Bph30 genes in advance or co-segregating markers with the genes, and has verified through a large number of experiments that the detection accuracy in the population is basically unchanged, and the marker K_946632 which is positioned in the genes and has relatively good typing effect is selected.
In a first aspect, the invention provides a SNP marker (marked as K_ 946632) for identifying the brown planthopper resistant gene Bph30 of rice, wherein the SNP marker is positioned at 946632bp of chromosome 4 of the rice, the polymorphism is A/G, and the SNP marker is positioned at 2903bp of the gene sequence (GenBank accession number: MW 176108.1) of the Bph30.
Alternatively, the SNP marker contains a nucleotide sequence with A/G polymorphism at 946632bp of rice chromosome 4.
The above physical location is based on rice Japanese reference genome version number IRGSP1.0.
Further, the nucleotide sequence of the SNP marker is shown as SEQ ID NO. 4, wherein the 101 st base n is a or g.
The rice material with the polymorphic site A contains the rice brown planthopper resistant gene Bph30, the rice material with the polymorphic site G does not contain the rice brown planthopper resistant gene Bph30, and the rice material with the polymorphic site A/G contains the brown planthopper resistant gene Bph30 which is heterozygous and shows brown planthopper resistance.
In a second aspect, the present invention provides a KASP primer combination for amplifying the SNP marker comprising two specific primers as set forth in SEQ ID NO. 1 and 2 and one universal primer as set forth in SEQ ID NO. 3.
Wherein, the two specific primers respectively contain different fluorescent groups, the primer shown in SEQ ID NO. 1 contains a fluorescent group FAM, and the primer shown in SEQ ID NO. 2 contains a fluorescent group HEX.
In a third aspect, the invention provides a detection reagent or kit comprising said KASP primer combination.
In a fourth aspect, the present invention provides a method for identifying brown planthopper resistant gene Bph30 of rice, comprising:
1) Extracting genome DNA of rice to be detected;
2) Performing PCR detection by using rice genome DNA as a template and using the KASP primer combination of claim 4;
3) Analysis of PCR products: if the PCR product contains a base with polymorphism A in the SNP marker, judging that the rice to be detected contains a rice brown planthopper resistant gene Bph30; if the PCR product contains the base with the polymorphism G in the SNP marker, judging that the rice to be detected does not contain the rice brown planthopper resistant gene Bph30.
Preferably, the PCR reaction system in step 2) comprises, in a total volume of 2. Mu.L: 1. Mu.L of template DNA, 100. Mu.M of each of the two specific primers, 0.007. Mu.L of 100. Mu.M of the universal primer, 0.015. Mu.L, the balance being 2 XKASP Master Mix.
Preferably, the PCR reaction procedure is as follows:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94℃for 20 sec; annealing at 65-57 ℃ and extending for 60 seconds, 10 cycles, wherein the annealing and extending temperature is reduced by 0.8 ℃ in each cycle;
denaturation at 94℃for 20 sec, annealing at 57℃and extension for 60 sec, 26 cycles.
Further, the step (3) specifically comprises:
if the PCR product detects a Fam fluorescent signal, the SNP marker is G base, and the rice sample to be detected does not contain the brown planthopper resistance gene Bph30; if the Hex fluorescent signal is detected, the SNP marker is an A base, the rice sample to be detected contains the brown planthopper resistant gene Bph30, and if the Fam and Hex fluorescent signals are detected simultaneously, the SNP marker is a heterozygous A/G, and the Bph30 in the rice sample to be detected is a heterozygous type.
In a fifth aspect, the invention provides any of the following uses of the SNP marker, the KASP primer combination, or a detection reagent or kit containing the primer combination:
(1) Used for breeding brown planthopper resistant rice materials;
(2) The method is used for identifying the brown planthopper resistant gene Bph30 of the rice;
(3) Is used for rice molecular marker assisted breeding.
By means of the technical scheme, the invention has at least the following advantages and beneficial effects:
the SNP marker provided by the invention is a Bph30 gene internal marker, can specifically distinguish Bph30 gene donor parents from other rice varieties/resources, and has better accuracy compared with other reported markers without risk of recombination exchange.
The SNP marker and the detection method thereof provided by the invention can be used for carrying out gene identification on plants in early stage of rice to screen brown planthopper resistant plants, thereby avoiding brown planthopper resistant phenotype identification and saving a large amount of manpower and physical cost.
The detection method provided by the invention is accurate and reliable, is simple and convenient to operate, is suitable for high-throughput genotype detection equipment, and can be efficiently applied to breeding of brown planthopper resistant varieties in commercial rice breeding.
Drawings
FIG. 1 shows the typing results of SNP molecular marker K_946632 of gene Bph30 in the natural population according to the preferred embodiment of the invention.
FIG. 2 shows the typing results of SNP molecular marker K_946632 of gene Bph30 in the segregating population according to the preferred embodiment of the invention.
Detailed Description
The invention provides an SNP marker identified by brown planthopper resistant gene Bph30 and application thereof.
The invention adopts the following technical scheme:
the invention provides an SNP marker for identifying a brown planthopper resistant gene Bph30 of rice, wherein the SNP locus is positioned at 946632bp of chromosome 4 of the rice, and the polymorphism is A/G.
Further, the SNP site is located at the 101 st base of the nucleotide sequence as shown below:
CCAACGTTGTTCAGCCCTGCTAACGGCAATGGGCCTTCTCTTGCTTATTGTT CCGCCTAATTCAGAACCATCAGTAGTAGCAGTAGCAACACTAGCAGGA[A/G]GG GATGAGATCTCGATGCATGGTGCATCCAAGGGATATTCTGTATCATTTAGCGAGC GAAGGAGCCTTCTGTCCCTCACTGAAATATACCATTTAAATTC
further, the rice sample with the SNP locus A contains the brown planthopper resistant gene Bph30, and the rice sample with the SNP locus G does not contain the brown planthopper resistant gene Bph30.
The present invention also provides a KASP primer combination for identifying the SNP site, comprising the following primer sequences (SEQ ID NOS: 1-3):
K_946632_FAM：5’-gaaggtgaccaagttcatgctCAGTAGCAACACTAGCAGGAG-3’；
K_946632_HEX：5’-gaaggtcggagtcaacggattGCAGTAGCAACACTAGCAGGAA-3’；
K_946632_COM：5’-TGAGGGACAGAAGGCTCCTT-3’。
the invention further provides a kit comprising the KASP primer combination.
The invention also provides a method for detecting the brown planthopper resistant gene Bph30 in the rice sample, which comprises the following steps:
(1) Obtaining genome DNA of a plant to be detected;
(2) Performing a PCR assay using the KASP primer combination;
(3) If the polymorphism of the SNP locus is detected to be A, judging that the rice sample contains the brown planthopper resistant gene Bph30, and if the polymorphism of the SNP locus is detected to be G, judging that the rice sample does not contain the brown planthopper resistant gene Bph30.
Further, the reaction system for PCR detection in the step (2) comprises, in a total volume of 2. Mu.L:
1. Mu.L of template DNA, 100. Mu.M of Fam and Hex primers each 0.007. Mu.L, 100. Mu.M of Com primer 0.015. Mu.L, the balance 2 XSP Master Mix.
The reaction procedure for PCR detection in step (2) comprises:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94℃for 20 sec; annealing at 65-57 ℃ and extending for 60 seconds, 10 cycles, wherein the annealing and extending temperature is reduced by 0.8 ℃ in each cycle;
denaturation at 94℃for 20 sec, annealing at 57℃and extension for 60 sec, 26 cycles.
Further, the step (3) specifically comprises:
if the PCR product detects a Fam fluorescent signal, the SNP marker is G base, and the rice sample to be detected does not contain the brown planthopper resistance gene Bph30; if a Hex fluorescent signal is detected, the SNP marker is an A base, and the rice sample to be detected contains a brown planthopper resistance gene Bph30; if Fam and Hex fluorescence are detected at the same time, the SNP marker is heterozygous A/G, and Bph30 in the rice sample to be detected is heterozygous.
The invention further provides the SNP locus, the KASP primer combination, the kit and the application of the method in identifying brown planthopper resistant rice varieties.
The invention further provides the SNP locus, the KASP primer combination, the kit and the application of the method in brown planthopper resistant rice breeding.
The following examples are illustrative of the invention and are not intended to limit the scope of the invention. Unless otherwise indicated, the examples are in accordance with conventional experimental conditions, such as the molecular cloning laboratory Manual of Sambrook et al (Sambrook J & Russell DW, molecular Cloning: a Laboratory Manual, 2001), or in accordance with the manufacturer's instructions.
Example 1 Bph30 Gene SNP marker site screening and KASP primer development
Obtaining Bph30 genome sequence (GenBank accession number: MW 176108.1) through NCBI database, performing Blast analysis on the sequence to obtain SNP variation sites in Bph30 gene intervals, selecting SNP sites with relative conservation at the upstream and downstream, further analyzing distribution frequency of the SNP sites by using 3000 rice sequencing public database resources, screening rare or special SNP sites of Bph30 genes, taking the obtained SNP sites as targets, respectively obtaining sequences of 200bp respectively at the upstream and downstream of a Nippon reference genome, performing KASP primer design, performing typing effect of PCR amplification test primers on the designed KASP primers, finally selecting KASP marker K_946632 designed by taking the SNP site at the position 946632bp of a reference genome (IRGSP 1.0) Nippon 4 chromosome (at 2903bp of MW 176108.1) as a target, wherein Bph30 brown planthopper resistance genes are A alleles at the SNP sites, and the rest rice resources are G alleles at the positions. Primer K_946632 sequence is as follows (SEQ ID NOS: 1-3):
K_946632_FAM：5’-gaaggtgaccaagttcatgctCAGTAGCAACACTAGCAGGAG-3’；
K_946632_HEX：5’-gaaggtcggagtcaacggattGCAGTAGCAACACTAGCAGGAA-3’；
K_946632_COM：5’-TGAGGGACAGAAGGCTCCTT-3’。
and analyzing the rice sample by using the marker, if the Fam fluorescent signal is detected, the rice sample to be detected does not contain the brown planthopper resistant gene Bph30, and if the Hex fluorescent signal is detected, the rice sample to be detected contains the brown planthopper resistant gene Bph30.
Example 2 application of Bph30 Gene SNP marker in identification of genotype of Natural population of Rice
1. Biological material
The rice samples used in this example included Bph30 gene donor parent AC-1613 (donor material supplied by the university of Wuhan university, proc. He Guangcun, proc. Laboratory) (Shi S, wang H, nie L, et al Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths [ J ]. Molecular Plant,2021,14 (10): 1714-1732) and 40 other rice varieties that did not contain Bph30, package: crystal 4155S, long Ke 618S, IRTA129, huahui No. 4, shuhui 527, fengxiang No. R1308, zhongrou 143, lopa nationality 69, nipponbare, C101A51, huazhen, teqing, 9311, CO2, mf63, oryza sativa, huarun No. 2, chenghong bamboo, guangdong rice, huijing 602, jiangsu round 2, zhejing 75, ivory incense No. 75, liaoshen salt 287, mianhui No. 3728, rejing 35, yuzhenxiang, sal rice 1531, oryza longensis No. 9, feng Yuzhan, IR64, IR29, R1206, R1128, shanghai round 5, R6444, zhenDai No. 819, fukunsiki, and Nongxiang No. 18.
2. Genotyping
The rice genome DNA to be detected is extracted as a template, and KASP reaction detection is carried out by using the primer combination (SEQ ID NO: 1-3) of the invention.
The PCR amplification reaction system was 2. Mu.L: 1. Mu.L of template DNA, 100. Mu.M of Fam and Hex primers each 0.007. Mu.L, 100. Mu.M of Com primer 0.015. Mu.L, and 2 XSP Master Mix was made up to a total volume of 2. Mu.L.
The PCR amplification reaction conditions were: the reaction is completed in a water bath thermal cycler, and the TouchDown PCR reaction condition is 94 ℃ for 15 minutes;
the first step of amplification reaction, denaturation at 94 ℃ for 20 seconds, annealing at 65-57 ℃ and extension for 60 seconds, 10 cycles, wherein the annealing and extension temperature of each cycle is reduced by 0.8 ℃;
the second amplification step was performed by denaturation at 94℃for 20 seconds, annealing at 57℃and extension for 60 seconds, 26 cycles.
And after the reaction is finished, performing fluorescence scanning on the PCR reaction product by using an LGC IntelliQube genotyping platform and performing genotyping.
3. Analysis of results
As shown in FIG. 1, the genotype identification result shows that the AC-1613 sample detects a Hex fluorescent signal, the genotype is A type, the gene Bph30 for resisting brown planthopper is contained, the other 40 rice samples all detect a Fam fluorescent signal, the genotype is G type, and the gene Bph30 for resisting brown planthopper is not contained. The molecular marker and the primer group thereof provided by the invention are proved to have accurate detection results, and can effectively distinguish different genotypes.
Example 3 application of Bph30 Gene SNP marker in genotyping of isolated population
1. Biological material
BC from 5781-1019/AC-1613//5781-1019 1 F 2 500 individual plants in the population are selected for Bph30 genotyping.
2. Genotyping
The detection method is the same as in example 2.
3. Analysis of results
The genotypes of 500 individual plants were tested, and the results showed that the ratio of 3 different genotypes A: A, A: G and G: G was 114:263:123, and the Calf test gave a Mendelian single gene segregation ratio (χ 2 ＝1.676<χ 2 0.05 =5.99), due toThe marker is co-dominant, two different homozygotes and heterozygotes can be distinguished, the detection sites are simultaneously separated by single genes, and the genotyping result of part of samples is shown in figure 2.
The SSR markers developed to identify gene Bph30 have the following disadvantages: (1) SSR is a gene linkage marker, and the risk of exchange exists, so that the accuracy of the SSR is inferior to that of the intragenic molecular marker. (2) The SSR markers are based on traditional polyacrylamide gel electrophoresis, and harmful chemical reagents such as formaldehyde and the like are inevitably used, so that the safety of operators is not facilitated. (3) The SSR marker detection method has the advantages of complicated operation and limited electrophoresis detection flux, and is difficult to meet the genotype screening work of a large number of samples in a short time in commercial breeding. (4) The SNP marker is unique to Bph30, has better specificity compared with SSR markers, and is suitable for identifying the Bph30 genotype in different hybridization or natural populations.
The SNP molecular marker of the brown planthopper resistant gene Bph30 and the detection primer thereof provided by the invention can realize efficient and accurate identification of the genotype of the brown planthopper resistant gene Bph30, can be used for screening and identifying rice resources, and can also be used for molecular genetic breeding of the brown planthopper resistant gene Bph30.
While the invention has been described in detail in the foregoing general description and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that modifications and improvements can be made thereto. Accordingly, such modifications or improvements may be made without departing from the spirit of the invention and are intended to be within the scope of the invention as claimed.
Sequence listing
<110> Yuan Longping agricultural high technology stock Co., ltd, hunan Long Ping high-tech research institute of the science, inc., hunan Asia Hua-species research institute of the university of Wuhan
<120> SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof
<130> KHP211122975.0
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gaaggtgacc aagttcatgc tcagtagcaa cactagcagg ag 42
<210> 2
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gaaggtcgga gtcaacggat tgcagtagca acactagcag gaa 43
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
tgagggacag aaggctcctt 20
<210> 4
<211> 201
<212> DNA
<213> Rice (Oryza sativa)
<400> 4
ccaacgttgt tcagccctgc taacggcaat gggccttctc ttgcttattg ttccgcctaa 60
ttcagaacca tcagtagtag cagtagcaac actagcagga ngggatgaga tctcgatgca 120
tggtgcatcc aagggatatt ctgtatcatt tagcgagcga aggagccttc tgtccctcac 180
tgaaatatac catttaaatt c 201
Claims (5)
1. A method for identifying brown planthopper resistant gene Bph30 of rice, comprising:
1) Extracting genome DNA of rice to be detected;
2) Taking rice genome DNA as a template, and performing PCR detection by using KASP primer combination;
3) Analysis of PCR products: if the PCR product contains a base for identifying polymorphism A in SNP markers of the rice brown planthopper resistant gene Bph30, judging that the rice to be detected contains the rice brown planthopper resistant gene Bph30; if the PCR product contains a base with G polymorphism in the SNP marker, judging that the rice to be detected does not contain a rice brown planthopper resistance gene Bph30;
the nucleotide sequence of the SNP marker for identifying the brown planthopper resistant gene Bph30 of the rice is shown as SEQ ID NO. 4, wherein the 101 th base n is a or g;
the KASP primer combination comprises two specific primers shown as SEQ ID NO. 1 and 2 and one universal primer shown as SEQ ID NO. 3; wherein the two specific primers respectively contain different fluorophores.
2. The method of claim 1, wherein the primer set forth in SEQ ID NO. 1 contains a fluorescent group FAM and the primer set forth in SEQ ID NO. 2 contains a fluorescent group HEX.
3. The method according to claim 2, wherein the PCR reaction system in step 2) comprises, in a total volume of 2 μl: 1. Mu.L of template DNA, 0.007. Mu.L of each of 100. Mu.M of two specific primers, 0.015. Mu.L of 100. Mu.M of universal primer, the balance being 2 XKASP Master Mix;
the PCR reaction procedure was as follows:
pre-denaturation at 94 ℃ for 3 min;
denaturation at 94℃for 20 sec; annealing at 65-57 ℃ and extending for 60 seconds, 10 cycles, wherein the annealing and extending temperature is reduced by 0.8 ℃ in each cycle;
denaturation at 94℃for 20 sec, annealing at 57℃and extension for 60 sec, 26 cycles.
4. A method according to claim 2 or 3, characterized in that step 3) is specifically:
if the PCR product detects a Fam fluorescent signal, the SNP marker is G base, and the rice sample to be detected does not contain the brown planthopper resistance gene Bph30; if the Hex fluorescent signal is detected, the SNP marker is an A base, the rice sample to be detected contains the brown planthopper resistant gene Bph30, and if the Fam and Hex fluorescent signals are detected simultaneously, the SNP marker is a heterozygous A/G, and the Bph30 in the rice sample to be detected is a heterozygous type.
5. A SNP marker for identifying rice brown planthopper resistant gene Bph30, a KASP primer combination for amplifying the SNP marker, or any of the following applications of a detection reagent or kit containing the KASP primer combination:
(1) Used for breeding brown planthopper resistant rice materials;
(2) The method is used for identifying the brown planthopper resistant gene Bph30 of the rice;
(3) The method is used for rice molecular marker assisted breeding;
the nucleotide sequence of the SNP marker for identifying the brown planthopper resistant gene Bph30 of the rice is shown as SEQ ID NO. 4, wherein the 101 th base n is a or g;
the KASP primer combination comprises two specific primers shown as SEQ ID NO. 1 and 2 and one universal primer shown as SEQ ID NO. 3; wherein the two specific primers respectively contain different fluorophores.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111275901.8A CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111275901.8A CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114214448A CN114214448A (en) | 2022-03-22 |
| CN114214448B true CN114214448B (en) | 2023-10-13 |
Family
ID=80696276
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111275901.8A Active CN114214448B (en) | 2021-10-29 | 2021-10-29 | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114214448B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116814841B (en) * | 2023-08-16 | 2024-02-06 | 湖北省农业科学院粮食作物研究所 | Primer group for identifying rice black brown glume gene HK4, and method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868842A (en) * | 2017-12-04 | 2018-04-03 | 华智水稻生物技术有限公司 | For detecting SNP marker and the application of rice brown planthopper resistant Bph3 genes |
| CN112458198A (en) * | 2020-12-17 | 2021-03-09 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof |
| CN112592997A (en) * | 2020-12-17 | 2021-04-02 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof |
-
2021
- 2021-10-29 CN CN202111275901.8A patent/CN114214448B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107868842A (en) * | 2017-12-04 | 2018-04-03 | 华智水稻生物技术有限公司 | For detecting SNP marker and the application of rice brown planthopper resistant Bph3 genes |
| CN112458198A (en) * | 2020-12-17 | 2021-03-09 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof |
| CN112592997A (en) * | 2020-12-17 | 2021-04-02 | 华智生物技术有限公司 | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths;Guangcun He etal.;Molecular Plant;摘要部分及第1729页右栏第5段 * |
| Guangcun He etal..Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths.Molecular Plant.2021,摘要部分及第1729页右栏第5段. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114214448A (en) | 2022-03-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109628627B (en) | Development and application of SNP (single nucleotide polymorphism) marker of broad-spectrum rice blast resistance gene Pigm of rice | |
| CN107815507B (en) | SNP molecular marker for detecting brown planthopper resistant Bph14 gene of rice and application | |
| CN110205398B (en) | KASP marker primer for detecting wheat high molecular weight glutelin Dy10-m619SN subunit and application | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN112458198B (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph27 and application thereof | |
| CN114214448B (en) | SNP marker for identifying brown planthopper resistant gene Bph30 of rice and application thereof | |
| CN107400715A (en) | The exploitation and its application of the special chemoattractant molecule mark of Thinopyrum ponticum and probe | |
| CN109628629A (en) | The SNP marker development and application of rice bacterial leaf spot resistant gene xa5 | |
| CN112251535B (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN108165635B (en) | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN112592997A (en) | Auxiliary breeding molecular marker of brown planthopper resistant gene Bph9 and application thereof | |
| CN110373491B (en) | KASP molecular marker for detecting rice blast-resistant broad-spectrum gene Pi1 and application | |
| CN112442547A (en) | Development and application of SNP molecular marker of rice blast resistance gene Pita | |
| CN111961753A (en) | SNP (Single nucleotide polymorphism) marker related to resistance gene of pepper and tomato leaf blight virus, and specific primer and application thereof | |
| CN116875736A (en) | SNP molecular marker of rice blast resistance gene pizz, primer set and application | |
| CN113604603B (en) | SNP marker linked with rice anti-white leaf spot gene Xa7 and application thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN112609018B (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| CN114717352A (en) | Molecular marker of rice high temperature resistance regulation gene Hsp70 and application thereof | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |