CN108165635B - KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese - Google Patents
KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese Download PDFInfo
- Publication number
- CN108165635B CN108165635B CN201611113063.3A CN201611113063A CN108165635B CN 108165635 B CN108165635 B CN 108165635B CN 201611113063 A CN201611113063 A CN 201611113063A CN 108165635 B CN108165635 B CN 108165635B
- Authority
- CN
- China
- Prior art keywords
- goose
- kiaa1462
- dna
- genotype
- egg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the field of molecular biology, and provides a KIAA1462 gene promoter region mutation site and application thereof in egg laying trait breeding of Yangzhou geese. The mutation site is located at the upstream 696bp of the transcription initiation site of the KIAA1462 gene promoter region, and has polymorphic SNP sites which are guanine G or cytosine C respectively, so that functional genes and molecular genetic markers related to the egg-laying traits of Yangzhou geese are obtained, and theoretical basis is provided for the breeding work of the egg-laying traits of geese.
Description
Technical Field
The invention belongs to the field of molecular biology, and relates to a KIAA1462 gene promoter region mutation site and application thereof in improving egg laying performance of geese.
Background
KIAA1462 is an unknown gene, and is a functional gene which is found to be related to the egg laying performance of geese by screening egg laying performance candidate SNP through simplified genome sequencing technology (RAD-sequencing). In human studies, KIAA1462 plays an important role in female meiosis gene recombination, and mutations during meiosis cause abortion. The KIAA1462 gene is expressed in very high levels in the first meiotic oocyte of mice and in the ovary of newborn mice. Also studies have shown that KIAA1462 is an important component of vascular endothelial cell junctions as a gene product associated with coronary artery disease.
The egg laying mechanism of the goose is complex, is influenced by various factors such as hormone, environment and the like, and is closely related to the reproductive performance of the goose. The egg laying performance is used as a large standard for breeding geese, the basic research is weak, the breeding work of goose egg laying traits is difficult, and the scientific large-scale development of goose breeding industry is severely restricted.
Disclosure of Invention
The inventor creatively discovers a mutation site related to the egg laying performance of the goose and provides a theoretical basis for the breeding of the egg laying traits of the goose.
The purpose of the invention is realized by the following technical scheme:
one of the technical schemes provided by the invention is as follows: providing a KIAA1462 Gene promoter region mutation site, wherein the mutation site is positioned at 696bp upstream of a transcription initiation site of the KIAA1462 Gene promoter region, the mutation site has polymorphic SNP sites which are guanine G or cytosine C respectively, and the KIAA1462 Gene sequence information is the sequence information of a goose reference genome (NM-013185782.1) disclosed on an NCBI website, and Gene ID is 106042667.
The SNP locus is related to goose egg laying performance and is a novel molecular marker.
The second technical scheme provided by the invention is as follows: the SNP mutation site is applied to poultry genetic breeding, and the application is preferably to early selection of goose egg laying performance according to the genotype of the SNP site.
Wherein the typing judgment basis of the early selection is as follows: the egg laying performance of GG genotype goose is superior to that of GC genotype and CC genotype individuals, and the egg laying performance of GC genotype goose is superior to that of CC genotype individuals. The GG genotype goose is a homozygous goose with an SNP locus G and is a high-yield genotype; the CC genotype goose is a homozygous goose with an SNP locus C and is a low-yield genotype; the GC genotype goose is a heterozygote goose with SNP loci of G and C.
The application of the mutant site of the promoter region of the KIAA1462 gene as a molecular marker for breeding geese comprises the following steps: detecting deoxynucleotides at the upstream 696bp of the transcription initiation site of the KIAA1462 gene promoter region of the goose, and breeding by using the fact that the egg laying performance of GG genotype goose is superior to that of GC genotype and CC genotype individuals, and the egg laying performance of GC genotype goose is superior to that of CC genotype individuals.
Further, the application of the mutant site of the promoter region of the KIAA1462 gene as a molecular marker for breeding geese comprises the following specific steps:
1) extracting goose blood DNA;
2) amplifying DNA by using primers KIAA1462-S1, KIAA1462-S2 and KIAA1462-AS through an AS-PCR method and carrying out agarose electrophoresis detection;
the nucleotide sequence of the primer is as follows:
the KIAA1462-S1 sequence is as follows: TCCCAGAATACAGAGCACTCC (shown in SEQ ID NO. 1),
the KIAA1462-S2 sequence is as follows: TCCCAGAATACAGAGCACTCG (shown in SEQ ID NO. 2);
the KIAA1462-AS sequence comprises: CCACCCTTACAATAAAGCACATC (shown in SEQ ID NO. 3).
3) And determining the male goose and the female goose with high-yield genotypes according to the typing judgment basis, and mating.
Preferably, the PCR reaction system in the step 2) is 20 ul: 10ul of 2 xrTaq mixture, 1ul of each primer, and DNA to be detected 1ul, dd H2O 7ul。
Preferably, the application, the PCR reaction procedure in step 2): 5min at 94 ℃; 30s at 94 ℃; annealing at 58 ℃ for 30 s; 30s at 72 ℃; 32 cycles; 7min at 72 ℃.
Preferably, the goose blood DNA extraction method in the step (1) comprises the following steps: collecting fresh blood from the inferior vein of adult goose wing, placing the blood into a centrifuge tube filled with anticoagulant, digesting the blood with goose blood DNA lysate, and finally obtaining pure DNA sample through the steps of breaking red blood cells, degrading protein, denaturing protein, precipitating DNA, washing and removing impurities and the like.
The goose mainly refers to a Chinese white goose.
The invention improves the egg laying performance of the goose breeding population according to the mutation site at the upstream 696bp of the transcription initiation site of the KIAA1462 gene promoter region, and has the following beneficial effects: the functional gene and the molecular genetic marker related to the goose egg-laying traits, which are obtained by the invention, are verified in a large population, have the advantages of rapidness, simplicity, convenience, reliability, high flux and low cost, and provide theoretical and practical basis for the breeding work of the goose egg-laying traits.
Drawings
FIG. 1 shows SNP mutation site pattern at 696bp upstream of transcription initiation site of KIAA1462 gene;
FIG. 2 shows the distribution of three genotypes of the mutation site of the promoter region of the KIAA1462 gene;
FIG. 3 expression level of KIAA1462 in two genotypes of the mutation site;
FIG. 4 is a diagram showing the statistics of the egg production of three genotypes of the mutant site of the KIAA1462 gene promoter region.
Detailed Description
The present invention is further illustrated by the following examples, which are not intended to describe specific conditions of the experimental procedure, generally in accordance with procedures well known in the art.
Example 1
1. Experimental Material
1.1 Experimental animals
The research adopts a Yangzhou goose blood DNA sample.
1.2 Main reagents and preparation
PCR type: taq DNA polymerase (TaKaRa Taq, TaKaRa Premix LA Taq) Dalianbao Bio;
DNA Marker (DL1000, DL2000, DL 500): dalibao bio corporation. A Goldview nucleic acid stain;
DNA extraction reagent: Tris-HCl, NaCl, EDTA-2Na, Sodium Dodecyl Sulfate (SDS), beta-mercaptoethanol, polyvinylpyrrolidone, sodium acetate (NaAC), chloroform, isoamylol, isopropanol, solid NaOH and ethanol;
agarose gel: agarose, TBE, gel recovery kit (Omega);
preparation of DNA extraction: 0.1M Tris-HCl, 0.5M NaCl, 0.05M EDTA-2Na, 2% SDS, 0.1% beta-mercaptoethanol, 0.5% polyvinylpyrrolidone;
preparation of 10 × TBE electrophoresis buffer: tris Base 108 g, boric acid 55 g, EDTA-2 Na2Hl2O7.44 g, and deionized water is added to dissolve the mixture until the volume is 1000 ml.
1.3 instruments and apparatus
Standard PCR instrument, gradient PCR instrument: BIO-RAD, USA;
low temperature high speed Centrifuge (Centrifuge 5810R): eppendorf, Germany;
one-ten-thousandth electronic analytical balance: sartorius, germany;
micro-spectrophotometer: thermo fisher corporation, usa;
a high-pressure sterilizing pan: shanghai Shenan medical instruments factory;
a constant-temperature water bath kettle: beijing medical Equipment factory;
adjustable micropipette: eppendorf, Germany;
DYY-III 2 electrophoresis apparatus: six instrument factories in Beijing;
electrophoresis gel imager: Bio-Rad, USA;
superclean bench: shanghai Bocheng industries, Inc.;
-70 ℃ ultra low temperature refrigerator: thermo corporation, usa.
2. Test method
2.1 avian blood DNA extraction step
1) Putting 20ul of anticoagulated whole blood into a 1.5ml centrifuge tube, adding 500ul of DNA extracting solution, fully and uniformly mixing, carrying out water bath at 65 ℃ for 30min, and oscillating and whirling for a plurality of times during the period;
2) centrifuging at 12000r/min for 10min, carefully taking out the supernatant, transferring the supernatant to a new 1.5ml centrifuge tube, adding 1/10 volume of 3M NaAC (pH 5.2) into the supernatant, standing at 4 ℃ for 20min, adding 300ul of chloroform-isoamyl alcohol (24:1), shaking vigorously, standing at 4 ℃ for 20min, and centrifuging at 12000r/min for 10 min;
3) transferring the supernatant to a new 1.5ml centrifuge tube, adding isopropanol with the same volume (precooling at minus 20 ℃), slightly reversing and uniformly mixing, standing at room temperature for 30min, centrifuging at 12000r/min for 5min, and removing the supernatant;
4) adding 500ul of 75% alcohol to wash the precipitate, centrifuging at 12000r/min for 5min, and removing the supernatant;
5) repeating the step 4, sucking out the excessive 75% alcohol in the centrifugal tube, adding 100-2Dissolving and diluting O, and storing at-20 ℃.
2.2KIAA1462 Gene promoter region mutation site screening
Obtaining 3000bp upstream of a transcription initiation site of a KIAA1462 gene from NCBI, and carrying out PCR amplification by using 10 DNAs of high-yield group geese (the average value +/-standard error is 87.42 +/-4.18) with higher egg production and 10 DNAs of low-yield group geese (the average value +/-standard error is 58.87 +/-3.97) as templates to screen the promoter region variation site. The promoter region amplification primers are shown in Table 1.
TABLE 1KIAA1462 Gene promoter region amplification primers
2.3AS-PCR genotyping
An AS-PCR typing primer is designed according to a sequence at the position of the KIAA1462 gene promoter region SNP, namely the upstream 696bp of a transcription initiation site, and the primer sequence is shown in Table 2. Completing goose DNA sample genotyping. The PCR reaction is detailed in Table 3.
TABLE 2AS-PCR typing primers
TABLE 3AS-PCR reaction System
And (3) PCR reaction conditions: and (3) uniformly mixing the mixed solution in a vortex mode, centrifuging, immediately placing the mixture in a PCR instrument, and carrying out amplification. Pre-denaturation at 94 ℃ for 5min, cyclic amplification phase: denaturation at 94 ℃ for 30s → annealing at 58 ℃ for 30s → extension at 72 ℃ for 30s, cycling for 32 times, and final extension at 72 ℃ for 7 min. After the amplification reaction is finished, the PCR product is placed at 4 ℃ for electrophoresis detection or stored for a long time at-20 ℃.
2.4 agarose electrophoresis detection
And (3) carrying out electrophoresis on the amplification product by using 2.5% agarose gel at about 130V for 25min, and observing the AS-PCR typing result by using a gel imaging system.
2.5 tissue RNA extraction
1) Taking about 100ug of the tissue, putting the tissue into a 2ml centrifuge tube, adding 1ml of Triol for homogenate, and standing for 5 min;
2) adding 200ul chloroform, vortex mixing for 15s to milk white, standing for 2-3min, centrifuging at 4 deg.C and 12000g for 15 min;
3) taking the supernatant water phase, putting the supernatant water phase into a new 1.5ml centrifuge tube, adding 0.5ml-20 ℃ pre-cooled isopropanol, uniformly mixing by vortex, standing for 10min, and centrifuging for 10min at 12000g at 4 ℃;
4) removing the supernatant, adding 1ml of 75% ethanol into 1ml of Triol for vortex cleaning and precipitation, centrifuging 7500g for 5min, and removing the supernatant;
5) repeating the step 4;
6) at 4 ℃, 7500g of air separation is carried out for 3min, and the ethanol in the centrifuge tube is sucked out;
7) putting the mixture into a super clean workbench for air drying, and adding a proper amount of DEPC water to dissolve RNA;
8) determination of RNA concentration: performing an ultramicro spectrophotometer to detect that the ratio of the sample RNA A260/280 to the ratio of the sample RNA A260/230 is between 1.8 and 2.0, and between 2.0 and 2.3 respectively;
9) and total RNA integrity detection: 2ul of total RNA extract was electrophoresed on 1.5% agarose gel, and 28S, 18S, and 5S bands were observed for the intact RNA.
2.6 Synthesis of cDNA
1) The sterilized RNase-free EP tube was added with 1ug of RNA template and 2ul of DNA (T)23VN (50uM) primer, adding appropriate amount of DEPC water to 8 ul;
2) centrifuging, cooling at 65 deg.C for 5min, and rapidly cooling on ice;
3) adding 10ul of 2 × Reaction buffer and 2ul of 10 × Enzyme mixed solution, and centrifuging;
4) incubating at 42 deg.C for 1h, and incubating at 25 deg.C for 5min and then at 42 deg.C for 1h if random primer is added;
5) and incubating at 80 deg.C for 5min, and storing the cDNA product at-20 deg.C, or diluting with 30ml DEPC water to 50ul for PCR.
2.7 quantitative primer design
2.8 real-time fluorescent quantitative PCR
The test is completed on a fluorescence quantitative analyzer, and the reaction conditions are as follows: first 94 ℃ for 4min, followed by 40 cycles, with main steps of 94 ℃ for 30sec, 62 ℃ for 30sec, 72 ℃ for 30 sec. In this experiment, GAPDH was used as an internal reference gene, and 2 was used-△△ctThe method carries out statistics on the validity data. The fluorescent quantitative PCR reaction system is 20 ul:
3. results of the experiment
3.1KIAA1462 promoter region Association site Screen
10 high-yield group geese (mean plus or minus standard error is 87.42 plus or minus 4.18) and 10 low-yield group geese (mean plus or minus standard error is 58.87 plus or minus 3.97) are selected, and the difference of the two groups of the geese is obvious (P is less than 0.05). The two groups of DNA mixed pools are used as templates for PCR amplification, the amplified product is subjected to sequencing by Suzhou Jinweizhi company, and a single nucleotide base mutation is found in the upstream 696bp of the transcription initiation site in the detected sequence, as shown in figure 1.
3.2AS-PCR genotyping results
As a result of AS-PCR typing, the GG genotype individuals were predominant in the gene frequency in goose population, the gene frequency of allele G was 0.64, and the gene frequency of allele C was 0.36, AS shown in FIG. 2.
3.3 KIAA1462 Gene expression results in different genotypes
By taking the GAPDH gene as an internal reference and adopting Real-time PCR to detect the GG type and GC type mRNA expression levels of mutation sites in the KIAA1462 gene in the ovarian tissues of the goose (figure 3), the result shows that the mRNA expression level of the KIAA1462 gene in the GG type ovarian tissues is obviously higher than that of the GC type (P < 0.05).
3.4 correlation analysis of mutation sites with egg laying Performance
The egg production of individuals with different genotypes is subjected to statistical analysis, and the result shows that the egg production of individuals with the GG type is higher than that of individuals with the GC type and the CC type, the egg production of individuals with the GG type is higher than that of individuals with the CC type by 4.9, and the difference is obvious, as shown in figure 4.
Sequence listing
<110> Nanjing university of agriculture
<120> KIAA1462 gene promoter region mutation site and application thereof in improving egg laying performance of geese
<130> 2016
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence
<400> 1
tcccagaata cagagcactc c 21
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence
<400> 2
tcccagaata cagagcactc g 21
<210> 3
<211> 23
<212> DNA
<213> Artificial sequence
<400> 3
ccacccttac aataaagcac atc 23
Claims (5)
1. A method for predicting egg laying performance of geese is characterized by comprising the following specific steps:
1) extracting goose blood DNA;
2) performing PCR amplification and agarose electrophoresis detection on DNA by using primers KIAA1462-S1, KIAA1462-S2 and KIAA1462-AS through an AS-PCR method;
the nucleotide sequence of the primer is as follows:
the KIAA1462-S1 sequence is as follows: TCCCAGAATACAGAGCACTCC (shown in SEQ ID NO. 1);
the KIAA1462-S2 sequence is as follows: TCCCAGAATACAGAGCACTCG (shown in SEQ ID NO. 2);
the KIAA1462-AS sequence comprises: CCACCCTTACAATAAAGCACATC (shown in SEQ ID NO. 3);
3) and (3) judging the genotype of the high egg-producing performance of the goose according to the typing, wherein the GG genotype represents that the egg-producing performance of the goose is superior to that of a GC genotype individual and that of a CC genotype individual, and the GC genotype represents that the egg-producing performance of the goose is superior to that of the CC genotype individual.
2. The method according to claim 1, wherein the PCR reaction system in step 2) is 20 μ l: 10 mul of 2x rTaq mixture, 1 mul of each primer and 1 mul and dd H of DNA to be detected2O 7µl。
3. The method according to claim 1, wherein in step 2) the PCR reaction program: 5min at 94 ℃; 30s at 94 ℃; annealing at 56 ℃ for 30 s; 30s at 72 ℃; 32 cycles; 7min at 72 ℃.
4. The method as claimed in claim 1, wherein the extraction method of goose blood DNA in step 1) is as follows: collecting fresh blood from the inferior vein of adult goose wing, placing the fresh blood into a centrifuge tube filled with anticoagulant, digesting the blood with goose blood DNA lysate, and finally obtaining pure DNA sample through the steps of breaking red blood cells, degrading protein, denaturing protein, precipitating DNA, washing and removing impurities.
5. The method according to claim 1, wherein the goose is a white goose in China.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611113063.3A CN108165635B (en) | 2016-12-07 | 2016-12-07 | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611113063.3A CN108165635B (en) | 2016-12-07 | 2016-12-07 | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108165635A CN108165635A (en) | 2018-06-15 |
| CN108165635B true CN108165635B (en) | 2021-07-13 |
Family
ID=62526088
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611113063.3A Expired - Fee Related CN108165635B (en) | 2016-12-07 | 2016-12-07 | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108165635B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609618B (en) * | 2019-01-08 | 2021-11-26 | 青岛大学 | Kit for detecting pathological myopia and use method and application thereof |
| CN112592983B (en) * | 2020-12-23 | 2023-08-11 | 重庆市畜牧科学院 | SNP molecular marker primer for screening goose egg quality |
| CN112430674B (en) * | 2020-12-23 | 2023-08-11 | 重庆市畜牧科学院 | Primer for detecting 7 SNP molecular markers of goose egg qualification rate |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102524167A (en) * | 2011-12-15 | 2012-07-04 | 浙江省农业科学院 | Method for indirect breeding of goose egg yield |
| CN102719549A (en) * | 2012-07-10 | 2012-10-10 | 浙江省农业科学院 | Method for selecting goose carcass trait microsatellite molecular marker |
| WO2013022995A2 (en) * | 2011-08-08 | 2013-02-14 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| CN105087582A (en) * | 2015-07-28 | 2015-11-25 | 南京农业大学 | Mutation site of UBXN1 [UBX (ultrabithorax) domain-containing protein 1] gene promoter region and application of mutation site to detecting water-holding capacity of pork |
-
2016
- 2016-12-07 CN CN201611113063.3A patent/CN108165635B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013022995A2 (en) * | 2011-08-08 | 2013-02-14 | Caris Life Sciences Luxembourg Holdings, S.A.R.L. | Biomarker compositions and methods |
| CN102524167A (en) * | 2011-12-15 | 2012-07-04 | 浙江省农业科学院 | Method for indirect breeding of goose egg yield |
| CN102719549A (en) * | 2012-07-10 | 2012-10-10 | 浙江省农业科学院 | Method for selecting goose carcass trait microsatellite molecular marker |
| CN105087582A (en) * | 2015-07-28 | 2015-11-25 | 南京农业大学 | Mutation site of UBXN1 [UBX (ultrabithorax) domain-containing protein 1] gene promoter region and application of mutation site to detecting water-holding capacity of pork |
Non-Patent Citations (3)
| Title |
|---|
| A Functional Mutation in KIAA1462 Promoter Decreases Glucocorticoid Receptor Affinity and Affects Egg-Laying Performance in Yangzhou Geese;Mengyuan Xia等;《International Journal of Molecular Sciences》;20180521;第19卷;1531 * |
| Identification of Laying-Related SNP Markers in Geese Using RAD Sequencing;ShiGang Yu等;《Plos One》;20150716;第10卷(第7期);1-19 * |
| KIAA1462基因启动子区功能突变鉴定及其与扬州鹅产蛋性能相关性研究;夏梦圆;《中国优秀硕士学位论文全文数据库 农业科技辑》;20190715(第07期);D050-137 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108165635A (en) | 2018-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112322753B (en) | SNP molecular marker related to intramuscular fat of pork and application thereof | |
| CN107619870B (en) | Molecular marker capable of indicating and identifying length of sheep wool and specific primer pair and application thereof | |
| CN108165635B (en) | KIAA1462 gene promoter region variant site and application thereof in improving egg laying performance of geese | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| CN107746896B (en) | SNP (Single nucleotide polymorphism) marker related to peach fruit skin and villus character and application thereof | |
| CN107090450B (en) | Molecular marker related to millet ear length character and detection primer and application thereof | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN107586857B (en) | Nucleic acid, kit and method for rapidly identifying red and black hair color genes of pigs | |
| CN108913787A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN108796107B (en) | SNP molecular marker coseparated with cucumber spur hardness gene Hard and application thereof | |
| CN108866206A (en) | SNP marker relevant to the more lambs of sheep and its application | |
| CN110564867B (en) | SNP molecular marker of Qinchuan cattle CFL1 gene and detection method thereof | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN109295240A (en) | One kind SNP marker relevant to the more lamb characters of sheep list tire and SMAD1 gene parting detecting reagent and application | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN109161609B (en) | SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application | |
| CN112210607B (en) | Molecular marker related to buffalo white hair phenotype and application thereof | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda | |
| CN106947826A (en) | A kind of method for detecting ox SERPINA3 gene mononucleotide polymorphisms and its application | |
| CN108913784B (en) | Detection method of EC12 SNP marker of exopalaemon carinicauda | |
| CN102443583A (en) | Exon conserved sequence amplified polymophic molecular marker and its analysis method | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN116855613B (en) | Molecular marker, primer, kit, method and application of pig carcass traits | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210713 Termination date: 20211207 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |