CN116083592A - Molecular marker related to sheep growth traits and application thereof - Google Patents
Molecular marker related to sheep growth traits and application thereof Download PDFInfo
- Publication number
- CN116083592A CN116083592A CN202211104624.9A CN202211104624A CN116083592A CN 116083592 A CN116083592 A CN 116083592A CN 202211104624 A CN202211104624 A CN 202211104624A CN 116083592 A CN116083592 A CN 116083592A
- Authority
- CN
- China
- Prior art keywords
- sheep
- molecular marker
- seq
- primer
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker related to sheep growth traits and application thereof. The nucleotide sequence of the molecular marker related to sheep growth is shown as SEQ ID NO.1, wherein Y at 262bp represents C or T, and the mutation leads to the C/T polymorphism of the molecular marker. The invention detects 1132 gene of Hu sheep and establishes least square model by PCR augmentation and sequence analysis of sheep PHYHIPL gene, and carries out association analysis of genotype and growth character, and finds that a C/T polymorphism site exists at 262 th position of the augmentation segment sequence shown as SEQ ID NO.1, finally determines that the augmentation PHYHIPL gene segment can be used as a molecular marker related to sheep growth. The invention can be used for selecting the CC homozygous sheep entering the core group as the sheep by detecting the molecular marker, and is beneficial to improving the economic efficiency of the production and breeding industry by using the growth characters of sheep.
Description
Technical Field
The invention belongs to the technical field of molecular markers, and particularly relates to a PHYHIPL gene fragment serving as a molecular marker related to influencing sheep growth traits and application thereof.
Background
The improvement of the living standard of people at present promotes the development of various breeding industries due to the rich requirements for meat product varieties, the development situation of the existing sheep raising industry is good, and the breeding and cultivation of sheep varieties are accelerated while continuously enriching sheep and goat varieties so as to ensure the excellent high yield of the sheep varieties (Dai Pengcheng. The basic current situation and development prospect of the sheep raising industry in China [ J ]. The farmer science and technology journal, 2014, 000 (005): 48-48.). Sheep are an important source of meat, milk products and wool, playing a vital role in the global agricultural economy. Body weight and size are key features of the sheep industry (Tao L, XY He, pan L X, et al genome-wide association study of body weight and conformation traits in neonata L sheep [ J ]. Animal Genetics, 2020.). In the production practice of sheep, it is crucial to select sheep with good growth characteristics, and the sheep has good growth vigor and fast weight gain, so that the production cost can be greatly saved. However, in the past studies, the potential genetic mechanism of sheep is poorly understood in terms of body weight and body type, etc.
PHYHIPL (phytase-CoA 2-hydroxylase interacting protein gene) is a protein-encoding gene. The gene may play a role in the development of the central system. The PHYHIPL genotype, which is significantly altered in its overall form, is produced by proteins found to be significantly regulated by global ischemia, proteins involved in regulating energy production and oxidative stress (James R, searche J L, bihan T L, et al Proteuic analysis of mitochondria in APOE transgenic mice and in response to an ischemic challenge [ J ]. Journal of Cerebral Blood Flow & Metabolism,2012, 32 (1): 164-176.). PHYHIPL may be a target gene for GBM treatment and prognosis. Protein-protein interactions suggest that PHYHIPL may play a critical role in cellular metabolism (Fu H D, ge B, chen D K, et al, phytanoyl-CoA2-Hydroxylase-Interacting Protein-Like Gene Is a Therapeutic Target Gene for Glioblastom a Multiforme [ J ]. Medical science monitor: international medical journal of e xperimental and clinical research,2019, 25:2583-2590.). However, it is not clear whether or not PHYHIPL is related to sheep growth traits.
The invention discusses the relevance of different genotypes and sheep growth traits by sequencing and analyzing the PHYHIPL gene, and aims to provide gene materials for improving the genetic improvement aspect of sheep growth traits and accelerate the cultivation process of high-quality mutton sheep with independent intellectual property rights.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a molecular marker related to sheep growth and application thereof. The molecular marker is amplified from sheep PHYHIPL gene, and its nucleotide sequence is shown in SEQ ID NO. 1. The method comprises the steps of amplifying sheep PHYHIPL gene sequences through a large number of experiments, sequencing, searching polymorphic sites of the PHYHIPL genes, analyzing the correlation between different genotypes and sheep growth, establishing a detection method of the polymorphic sites, and applying the molecular marker to the cultivation of novel high-quality mutton sheep new varieties.
In order to achieve the above purpose, the invention adopts the following technical scheme:
a molecular marker related to sheep growth characteristics has a nucleotide sequence shown in SEQ ID NO.1, wherein Y at 262bp represents C or T, and the C/T polymorphism of sheep PHYHIPL gene at the position is caused by a C/T mutation at 262 base of the sequence.
A group of primer group for detecting the molecular marker comprises an upstream primer and a downstream primer with nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO. 3.
A set of KASPar primer set for detecting the molecular marker related to sheep growth characters comprises a forward primer 1 for detecting alleC, a forward primer 2 for detecting alleT and a universal reverse primer C, wherein the forward primer 1 is shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.
A kit for detecting the molecular marker related to sheep growth traits, wherein the detection kit comprises the primer set or the KASPar primer set.
The detection method of the molecular marker related to sheep growth traits comprises the following steps of:
1) Amplifying the genomic DNA of sheep by using the primer group, the KASPar primer group or the kit for detecting the molecular marker related to sheep growth traits;
2) And (3) identifying the polymorphic site of the amplification product obtained in the step (1).
Wherein, in the step 2), the method of typing identification is a direct sequencing method, a probe method, a gene chip method, a fluorescent probe method or a high resolution dissolution curve method.
A KASPar method for detecting a molecular marker of a sheep growth-related trait comprising the steps of:
a) Extracting genome DNA from sheep blood as a sample, and performing high-throughput water bath PCR amplification by using the genome DNA extracted from KASPar primer groups with nucleotide sequences shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6;
b) After amplification, fluorescence signals are detected by using a BMG PHERAstar instrument and the typing result is checked.
The molecular marker provided by the invention is detected in the genome DNA of the sheep to be detected, and the type of the polymorphic site is analyzed, so that the growth height character of the sheep can be determined, and further the sheep with rapid increase can be screened out.
The application of the molecular marker, the primer group for detecting the molecular marker or the detection method of the kit in sheep breeding can determine the genotype of the PHYHIPL gene of a sample to be detected by amplifying and detecting the genomic DNA of sheep by using the primer group or the kit, so that a rapidly amplified sheep variety can be bred from the genotype.
Finding mutation sites of genes, finding the relationship between genes and traits through association analysis between the genes and the traits is an important means for researching gene functions and is also a basis for marker-assisted selection.
The invention discovers that a C/T polymorphism site exists at the 262 th position of an amplified fragment by carrying out PCR amplification and sequencing on the PHYHIPL gene of sheep, and determines a molecular marker related to sheep growth by detecting and detecting 1132 polymorphism of Hu sheep and a built least square model, and the molecular marker can be used for breeding high-yield sheep and breeding new high-quality mutton sheep varieties, provides an effective genetic engineering means for genetic improvement of sheep growth, and has great practical application value.
According to the invention, the detection is carried out by designing the KASPar primer group required by competitive allele specific PCR (KASP), the detection method does not need to synthesize a specific fluorescent probe aiming at each SNP locus, and all loci are finally amplified by using a universal fluorescent primer based on the unique ARM PCR principle, so that the cost of reagents is greatly reduced, the accuracy is higher, and a simple, convenient, accurate and low-cost operation method is provided for detecting the molecular markers.
The invention has the beneficial effects that:
the invention provides a molecular marker related to sheep growth traits, in particular a C/T polymorphic site at position 262 of SEQ ID NO.1 fragment, and provides an effective detection means for breeding of fast-gaining sheep. The invention can be used for selecting sheep with CC homozygous gene as breeding sheep by detecting the molecular marker related to sheep growth characters and the polymorphic site, so as to shorten breeding period, improve sheep growth characters and be beneficial to improving economic benefit of sheep breeding industry.
Drawings
FIG. 1 is a gel electrophoresis diagram of a sheep PHYHIPL gene fragment as a molecular marker.
FIG. 2 shows the sequencing result of mutation sites of sheep PHYHIPL gene in the present invention.
FIG. 3 shows the result of KASPar SNP typing of a mutation site of g.262C > T of a sheep PHYHIPL gene according to the present invention.
Detailed Description
The following examples serve to further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions made to the invention without departing from the spirit and nature of the invention are intended to be within the scope of the invention.
Unless otherwise indicated, all technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the methods are of analytical purity or above.
EXAMPLE 1 amplification of the PHYHIPL Gene
A pair of primers was designed using oligo7.0 software using sheep PHYHIPL gene DNA (GenBank accession number: NC-040260.1) as a template: the sequence of the upstream primer and the downstream primer is as follows:
upstream primer (SEQ ID NO. 2): 5' -GTCATTGTACCATGCCGCCAG-3
Downstream primer (SEQ ID NO. 3): 5' -CAAGCCTGAAGTACAACCCT-3
(2) Amplification and sequencing of the PHYHIPL Gene
PCR amplification was performed on genomic DNA extracted from sheep whole blood cells as a DNA template in a total volume of 25. Mu.L, wherein 1. Mu.L of the DNA template, 12.4. Mu.L of 2 XPCR Master Mix, 0.8. Mu.L of the upstream primer (concentration: 10. Mu. Mol/L), 0.8. Mu.L of the downstream primer (concentration: 10. Mu. Mol/L), and ddH 2 O10. Mu.L. PCR amplification reaction conditions: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 54.5℃for 30s, extension at 72℃for 30s, cycling for 35 times, and extension at 72℃for 10min.
The PCR reaction products were detected by 1.5% agarose gel electrophoresis, and the result shows that 351bp specific amplified fragment is shown in FIG. 1, wherein M lanes: DL 2000marker, lanes 1-10: results of the amplification of the PHYHIPL gene. Sequencing the PCR fragment obtained by amplification, wherein the specific nucleotide sequence of the amplified fragment is shown as SEQ ID NO.1, a polymorphic site exists in the fragment, specifically Y at the 262bp site is C or T, namely the amplified PHYHIPL gene fragment (SEQ ID NO. 1) has C/T polymorphism at the 262bp site. The peak diagram obtained by sequencing is subjected to bimodal detection, mutation sites are identified, and the result is shown in figure 2.
Wherein SEQ ID NO.1 is as follows: GTCATTGTACCATGCCGCCAGGGCCAGCATTCCCTCCTTTCATTTTTGTCCCACGTTTACTGATGTCATCTTCTACTCTGGTTGTGCAGTAATTCATTGTCTTTTGCTTAAGGTTTTACTTCCTCCTTCTGTGGGATTGTACATGTTGGATCTCCCAGTAATTCTAGAGATTGCTTTCCTTTGAATTCAATCACAGTTATCCTCTCTTTTAATGATTGTTTATTCTATTTCAGAATTATTTTGTGCTCCTCTTGCATGTTAYTTATATTCATTACTTTTTATCTTACATCAAATACAGTTGCATTTATGTGCTTTTTGTTGCTAAGTACTCAGGGTTGTACTTCAGGCTTG.
Sequence homology search identification:
the DNA sequence obtained after sequencing was compared for sequence homology with known physiological functional genes published in the GenBank database by means of the BLAST (Basic Local Alignment Search Tool) software of the national center for Biotechnology information (NCBI, national Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) website to identify and obtain functional information of the DNA sequence. The search result shows that the homology of the sequence to the partial sequence of sheep PHYHIPL gene DNA (GenBank accession number: NC_ 040260.1) reaches 99%.
Example 2 establishment of genotyping assay
1. Primer sequence design
A KASPar primer pair was designed for the C/T polymorphic site shown in the amplified fragment SEQ ID NO.1 of example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the designed KASPar primer pair was:
universal reverse primer C as set forth in SEQ ID No.6:5 '-GCAACTGTATTTGATGTAAGATAAAAAGTAATGAAT-3'.
The primers are entrusted to be synthesized by Beijing Biotechnology, inc. Each set of primers in the KASPar primer pair was diluted to 10. Mu. Mol/L and was used as forward primer 1: forward primer 2: the reverse primer C is uniformly mixed for standby according to the volume ratio of 12:12:30.
2. DNA quality control
The extraction of genomic DNA from sheep whole blood can be performed using a DNA extraction kit. The quality detection of the extracted genome DNA is carried out, 1% agarose electrophoresis and Nanodro 2100 are adopted for detection respectively, and the qualified DNA is required to reach: agarose electrophoresis showed single DNA bands without significant dispersion; the Nanodrop2100 detection A260/280 is between 1.8 and 2.0, which indicates that the DNA sample has no protein pollution; a260/230 is between 1.8 and 2.0, and the concentration of salt ions in the DNA sample of the instruction book is low; the A270nm has no obvious light absorption, which indicates that the DNA sample has no phenol contamination. The DNA amount was calculated to be 10-20 ng/sample based on KASP detection technique and genome size from LGC, UK, and the concentration of diluted DNA template was diluted to 10-20 ng/. Mu.L for use.
3. Genotyping assays
Firstly, a K-pette liquid-separating workstation is used for respectively adding 1.5 mu L of diluted DNA template to be detected (10-20 ng/muL) and blank control (No template control, NTC, sterilized water) into 384-hole reaction plates, and drying at 60 ℃ for 30min (drying oven, LGC company), so that the DNA is changed into dry powder for standby.
And then adding a mixed solution of 1 XMaster Mix (1536 microwell plates, product number: part No. KBS-1016-011) and a primer into each reaction well by using a Meridian sample adding workstation under a Krake operating system, putting the microwell plates on a Kube heat sealing instrument and a Fusion laser membrane sealing instrument in sequence for membrane sealing after Mix packaging is finished, and carrying out high-throughput water bath PCR amplification by using a hydroxyler.
The PCR reaction is carried out in a high-flux water bath system, and the specific procedures are as follows:
pre-denaturation at 94 ℃ for 15 min;
94 ℃,20 seconds (denaturation) -61 ℃ -55 ℃,1 minute (renaturation & extension), 10 cycles of amplification in the touchdown order, 0.6 ℃ decrease per cycle;
amplification was continued for 26 cycles at 94℃for 20 seconds (denaturation) -55℃for 60 seconds.
After amplification, the fluorescence signal was detected by using a BMG PHERAstar instrument and the typing was checked, and the specific results are shown in FIG. 3. Each dot in the figure represents a piece of material to be tested, wherein the red dot near the left side indicates that the locus is homozygous for genotype "TT"; blue dots near the right indicate that the locus is homozygous genotype "CC"; the green dots near the middle indicate that the locus is heterozygous genotype "TC" or "CT"; the black dots represent NTC (i.e., as a sterilized water control, not shown in fig. 3).
4. Application of molecular marker in sheep growth trait correlation analysis
The polymorphism of 1132 Hu sheep is detected in the test, the genotype of the Hu sheep is determined, a least squares model is established as described below, and the correlation analysis of the genotype and the growth character is carried out.
Y ijkl ＝μ+Genotype i +Batch j +Father k +Mother l +ε ijkl
Wherein Y is ijkl Is the observed value of growth characteristics, mu is the overall average, genotype i For genotypic effect, batch j For batch effect, father k Mother as father effect l Epsilon as the maternal effect ijkl Is a random error, when the P value is (P<0.05 Is considered statistically significant.
Genotype test results showed 965 of 1132 individuals had TT genotypes, 132 individuals had TC genotypes, and 35 individuals had CC genotypes. The results of genotype-trait association analysis are shown in Table 1.
Wherein BW in the table represents the stage weight in kg. BW80 represents the weight of sheep at day 80; BW100 represents the weight of sheep at 100 days of age, and so on, the values in the table represent the average weight of the same genotype.
TABLE 1 sheep PHYHIPL g.262C > T Gene polymorphism and growth correlation analysis
Note that: the different letters of the subscript between the same row of data indicate significant differences (P < 0.05), and the same letter indicates insignificant differences (P > 0.05).
The results show that the C/T polymorphism site at 262bp of the nucleotide sequence shown as SEQ ID NO.1 is obviously related to sheep body weight along with the extension of the measurement period. Wherein individuals of the CC genotype have a significantly higher body weight than individuals of the TT and TC types (P < 0.05). From this, the CC genotype is the dominant genotype and the C allele is the dominant allele, indicating that the mutation site of PHYHIPL g.262C > T can be used as a potential molecular marker (P < 0.05) for influencing sheep weight. The CC genotype is selected for seed conservation during breeding, and is used as a breeding sheep to hybridize with other sheep during breeding, so that the production efficiency of offspring sheep can be effectively improved.
Claims (10)
1. A molecular marker related to sheep growth traits, which is characterized in that the nucleotide sequence is shown as SEQ ID NO.1, wherein Y at 262bp represents C or T, and the mutation leads to a C/T polymorphism of the molecular marker.
2. A set of primers for detecting the molecular marker according to claim 1, which comprises an upstream primer and a downstream primer having nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.
3. A set of KASPar primers for detecting molecular markers according to claim 1, comprising forward primer 1 for detecting AlleC, forward primer 2 for detecting AlleT and universal reverse primer C as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6.
4. A kit for detecting a molecular marker related to sheep growth traits according to claim 1, characterized in that it comprises a primer set according to claim 2 or a KASPar primer set according to claim 3.
5. A method for detecting a molecular marker associated with sheep growth traits comprising the steps of:
1) Amplifying sheep genomic DNA using the PCR primer set of claim 2 or the KASPar primer set of claim 3, or using the kit of claim 4;
2) And (3) carrying out typing identification on the polymorphic sites of the amplification products obtained in the step (1).
6. The method according to claim 5, wherein the typing method in step 2) is a direct sequencing method, a gene chip method, a fluorescent probe method or a high resolution dissolution profile method.
7. The detection method according to claim 5, wherein the KASPar primer set according to claim 3 is used for amplification, and the typing result is determined by detecting a fluorescent signal after the amplification is completed.
8. Use of the molecular marker of claim 1 or the primer set of claim 2 or 3, or the kit of claim 4, or the detection method of any one of claims 5-7 in sheep growth trait-related detection.
9. Use of the molecular marker of claim 1 or the primer pair of claim 2 or 3, or the kit of claim 4, or the detection method of any one of claims 5-7 in sheep breeding.
10. The use according to claim 9, wherein the purpose of breeding is a fast-weight sheep.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211104624.9A CN116083592A (en) | 2022-09-09 | 2022-09-09 | Molecular marker related to sheep growth traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211104624.9A CN116083592A (en) | 2022-09-09 | 2022-09-09 | Molecular marker related to sheep growth traits and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN116083592A true CN116083592A (en) | 2023-05-09 |
Family
ID=86203157
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211104624.9A Pending CN116083592A (en) | 2022-09-09 | 2022-09-09 | Molecular marker related to sheep growth traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116083592A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385060A (en) * | 2023-12-08 | 2024-01-12 | 中国科学院遗传与发育生物学研究所 | SNP marker related to sheep growth performance and application thereof |
-
2022
- 2022-09-09 CN CN202211104624.9A patent/CN116083592A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385060A (en) * | 2023-12-08 | 2024-01-12 | 中国科学院遗传与发育生物学研究所 | SNP marker related to sheep growth performance and application thereof |
| CN117385060B (en) * | 2023-12-08 | 2024-03-26 | 中国科学院遗传与发育生物学研究所 | SNP marker related to sheep growth performance and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN110791574B (en) | Molecular marker associated with goat lambing number and growth traits and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN110643716B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| AU2020104123A4 (en) | An SNP Molecular Marker for Screening and/or Detecting Bovine Cell Viability | |
| US11542562B2 (en) | Single nucleotide polymorphism marker related to Chinese horse short stature trait and use thereof | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107287283B (en) | High-throughput detection kit for multiple SNP sites related to children susceptibility diseases and use method thereof | |
| CN115044682B (en) | Molecular marker related to Hu sheep growth traits, detection method and application thereof | |
| CN114959051B (en) | Molecular marker related to Hu sheep weight and application thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN113355449B (en) | Elytrigia elongata 3E chromosome specific codominant KASP molecular marker and application thereof | |
| CN114959052A (en) | Molecular marker related to Hu sheep physique and application thereof | |
| CN115181804B (en) | Molecular marker related to sheep growth traits, detection method and application thereof | |
| CN114941035B (en) | Molecular marker related to sheep stage weight character and application thereof | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN116083604B (en) | SNP molecular marker affecting sheep weaning weight and application thereof | |
| CN116254348A (en) | Molecular marker related to sheep growth traits, detection method and application thereof | |
| CN115074449B (en) | Molecular marker related to sheep tail fat deposition and application thereof | |
| CN117625803A (en) | SNP molecular marker affecting sheep stage weight and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |