CN115992251A - Molecular marker related to Hu sheep growth traits and application thereof - Google Patents
Molecular marker related to Hu sheep growth traits and application thereof Download PDFInfo
- Publication number
- CN115992251A CN115992251A CN202210879547.8A CN202210879547A CN115992251A CN 115992251 A CN115992251 A CN 115992251A CN 202210879547 A CN202210879547 A CN 202210879547A CN 115992251 A CN115992251 A CN 115992251A
- Authority
- CN
- China
- Prior art keywords
- sheep
- primer
- molecular marker
- detecting
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker related to Hu sheep growth traits and application thereof, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and M at 355bp represents A or C. According to the invention, through PCR amplification and sequence analysis of the GC gene of the Hu sheep, an A/C polymorphic site exists at 355 th site of the amplified fragment, further KASPar primer is used for detecting the polymorphic site of 1228 Hu sheep, a least square model is built, the correlation analysis of genotype and growth traits is carried out, and finally, the amplified GC gene fragment can be used as a molecular marker related to average daily gain and feed conversion rate of the Hu sheep. The method can be used for selecting the Hu sheep with the AA homozygous gene into the core group as the breeding sheep by detecting the molecular marker so as to improve the growth characteristics of the Hu sheep and facilitate the increase of economic benefit.
Description
Technical Field
The invention belongs to the technical field of molecular markers, and particularly relates to a GC gene fragment serving as a molecular marker affecting growth traits of Hu sheep and application thereof.
Background
The GC gene encodes a vitamin D binding protein. Liping Guo et al (Guo, wei, yi, yang, & Chen, 2021) determined by transcriptome analysis that GC was a key candidate gene for adult to aged duck subcutaneous fat. Vitamin D (VitD) is a fat-soluble vitamin that is transported to the liver for hydroxylation to produce 25-hydroxyvitamin D [25 (OH) D ] (Ab Bas, 2017). Whereas 25 (OH) D is predominantly distributed in the fat, liver and muscle of animals, the enzyme required for the production of active vitamin D (Wamberg et al, 2013), which is the major circulating form of vitamin D, is fat-soluble. For humans, a vitamin D deficiency is defined when the 25 (OH) D concentration in serum is below 50nmol/L (Holick et al, 1911). And the level of 25 (OH) D in serum of obese subjects was low, and its level was inversely related to body mass index and body fat index (Gonza lez-Molero et al, 2013; xiao-Mei Mai & Langhammer, 2012). Thus, GC genes may play an important role in altering animal body weight. However, the GC gene has little research on Hu sheep, and the specific effect on Hu sheep is not clear.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention provides a molecular marker related to the growth traits of Hu sheep and application thereof.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in one aspect, the invention provides a molecular marker related to the growth trait of Hu sheep, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein M at 355bp represents A or C, and the sequence has an A/C mutation at 355bp, so that the A/C polymorphism of the Hu sheep GC gene at the locus is caused.
The results of genotype and trait association analysis showed that GC g.19484a > C mutation sites were significantly correlated with hu sheep body weight, height and body length with prolonged assay cycles. The weight, the height and the body length of the Hu sheep carrying the AA genotype are better than those of the Hu sheep carrying the CC genotype (P < 0.05), so that the A allele is a dominant allele.
In a second aspect, the present invention provides a primer pair for detecting the above molecular marker, any primer capable of specifically amplifying the molecular marker of the present invention or a fragment comprising the above polymorphic site is suitable for detecting the molecular marker, and preferably comprises a primer M-F and a primer M-R, wherein the nucleotide sequence of the primer M-F is shown as SEQ ID NO.2, and the nucleotide sequence of the primer M-R is shown as SEQ ID NO. 3.
In addition, the invention also provides a primer pair for detecting the molecular marker, preferably KASPar primer pair, which comprises a forward primer 1 for detecting the AlleA, a forward primer 2 for detecting the AlleC and a universal reverse primer, wherein the nucleotide sequence of the forward primer 1 for detecting the AlleA is shown as SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting the AlleC is shown as SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO. 6.
In a third aspect, the present invention provides a detection kit for detecting the above molecular marker, wherein the kit comprises a primer pair or a KASPar primer pair for detecting the above molecular marker.
In a fourth aspect, the invention provides a method for detecting molecular markers related to growth traits of Hu sheep, wherein the nucleotide sequence of the molecular markers is shown as SEQ ID NO.1, M at 355bp position represents A or C, the method comprises the steps of detecting genomic DNA of Hu sheep by using the primer pair or the kit, and the specific detection method comprises the following steps:
s1, amplifying Hu sheep genome DNA by using the primer pair, the KASPar primer pair or a kit containing the primer pair;
s2, identifying polymorphic sites of the amplification product obtained in the step S1.
In step S2, the method of typing identification includes, but is not limited to, direct sequencing, probe method, gene chip method, and high resolution dissolution profile method.
More specifically, the method for detecting the molecular marker related to the growth trait of Hu sheep by using the primer pair comprises the following steps:
a) Extracting genome DNA from Hu sheep blood as a sample, and performing high-throughput water bath PCR amplification by using KASPar primer pairs with nucleotide sequences shown as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO. 6;
b) After amplification, fluorescence signals are detected by using a BMG PHERAstar instrument and the typing result is checked.
In a fifth aspect, the invention provides an application of the detection method of the molecular marker, the primer pair or the kit in the detection of the growth traits of the Hu sheep, and the molecular marker is detected in the genome DNA of the Hu sheep to be detected, and the type of polymorphic sites is analyzed, so that the growth traits of the Hu sheep can be determined, and then the Hu sheep with rapid growth can be screened out.
In a fifth aspect, the invention provides application of the detection method of the molecular marker, the primer pair or the kit in breeding Hu sheep, and the genotype of the GC gene of a sample to be detected is determined by amplifying and detecting the genomic DNA of the Hu sheep by using the primer pair or the kit, so that a Hu sheep variety with rapid growth can be bred from the sample.
Finding mutation sites of genes, finding the relationship between genes and traits through association analysis between the genes and the traits is an important means for researching gene functions and is also a basis for marker-assisted selection. According to the invention, through carrying out PCR amplification and sequencing on GC genes of Hu sheep representing hu sheep, an A/C polymorphism site exists at 355 th site of an amplified fragment, and through detecting 1288 hu sheep polymorphisms and establishing a least square model, a molecular marker related to hu sheep growth traits is determined, and the molecular marker can be used for cultivating high-quality new mutton sheep varieties, provides an effective genetic engineering means for genetic improvement of hu sheep growth traits, and has great practical application value.
According to the invention, the detection is carried out on the molecular marker by designing the KASPar primer required by competitive allele specific PCR (KASP), the detection method does not need to synthesize a specific fluorescent probe aiming at each SNP locus, and all locus detection is finally carried out by using a universal fluorescent primer based on the unique ARM PCR principle, so that the cost of reagents is greatly reduced, the accuracy is higher, and a simple, convenient, accurate and low-cost operation method is provided for the detection of the molecular marker.
The invention has the beneficial effects that:
the invention provides a molecular marker related to the growth traits of Hu sheep, in particular to a 355 th site A/C polymorphic site of SEQ ID NO.1 fragment, which can effectively identify whether the Hu sheep is fast-growing type by determining the genotype of the polymorphism, thereby providing an effective detection means for breeding the fast-growing type Hu sheep. The molecular marker and the detection of the polymorphic locus can be used for selecting the Hu sheep with the AA homozygous type as the breeding sheep, so as to improve the growth characteristics of the Hu sheep and contribute to the improvement of the economic benefit of the Hu sheep breeding industry.
Drawings
FIG. 1 is a gel electrophoresis diagram of a fragment of a Hu sheep GC gene for molecular markers in the present invention.
FIG. 2 shows the sequencing result of GC gene mutation sites of Hu sheep in the invention.
FIG. 3 shows the KASPar SNP typing results of the A/C polymorphic site shown at position 355 in the Hu sheep amplified fragment SEQ ID NO.1 according to the present invention.
Detailed Description
The molecular marker is amplified from a Hu sheep GC gene, and the specific nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1. Through amplifying DNA sequence of the Hu sheep GC gene and sequencing, searching polymorphic sites of the GC gene, analyzing correlation between different genotypes and growth traits of the Hu sheep, establishing a detection method of a molecular marker containing the polymorphic sites, and applying the molecular marker to cultivation of novel high-quality mutton sheep new varieties.
The following examples serve to further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions made to the invention without departing from the spirit and nature of the invention are intended to be within the scope of the invention.
Unless otherwise indicated, all technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the present invention are of analytical purity or above.
Example 1 amplification of GC Gene
A pair of primers was designed using oligo7.0 software using Hu sheep GC gene DNA (GenBank accession number: NC-040257.1) as a template: M-F and M-R, the primer sequences are as follows:
M-F(SEQ ID NO.2)：5’-ACATTATTTAAAAGGAATGGC-3’
M-R(SEQ ID NO.3)：5’-AGTATTATAACCTCTGCTCT-3’
(2) Amplification and sequencing of GC genes
The total volume of the PCR amplification reaction was 25. Mu.L, including 2 XPCR Master Mix 12.4. Mu.L, M-F0.8. Mu.L (concentration 10. Mu. Mol/L), M-R0.8. Mu.L (concentration 10. Mu. Mol/L), DNA template 1. Mu.L and ddH 2 O10. Mu.L. Wherein, the DNA template is the genome DNA extracted from the whole blood cells of Hu sheep as the DNA template.
PCR amplification reaction conditions: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 53.2℃for 30s, extension at 72℃for 30s, cycling for 35 times, and extension at 72℃for 10min.
The PCR amplification reaction products were electrophoretically detected on a 1.5% agarose gel, and the electrophoresis results are shown in FIG. 1, in which lanes M: DL 2000marker, lanes 1-10: results of GC gene amplification. The amplified PCR fragment was sequenced, and the sequencing result showed that 387bp specific amplified fragment was obtained (FIG. 2). The specific nucleotide sequence of the amplified fragment is shown as SEQ ID NO.1, wherein a polymorphic site exists in the fragment, and M at the 355bp site is specifically A or C, namely, the amplified GC gene fragment (SEQ ID NO. 1) has an A/C polymorphism at the 355bp site (see FIG. 2).
Wherein, SEQ ID NO.1:
GATAAATGTTTAAGCTGAAGTCTCTAGAAAATAAATGAGAAATATTTCATTAGACAGTCAGGATACATTGAAAGCAGTGTGCAGAAATAGCAGAAAAAAGGGACATTCTGACTCCTTTTAATGACTAGAAAATGGAATTCTGATCAAAGGAACATTTCCCCCAGAGTTGCTTATGTGTGTTTTTCCAATTAACAAAATAAAAAAGAGGCATTTAAAAAATATTTTCAGATTCCAGAATCTGAATCTTTCTAACATTATTTAAAAGGAATGGCATTAATAGAAGAAAAAAGTACATTAGCTATGTGATAAAATGATACCTACCTCTTTCAAAAAGCATGCTGTTGGGTTTGGTGAMGTACAGCAGGACCCTACCATAGAGAGATAACT。
DNA sequence homology search identification:
the DNA sequence obtained after sequencing (SEQ ID NO. 1) was compared for sequence homology with known physiological functional genes published in the GenBank database by the BLAST (Basic Local Alignment Search Tool) software of the national center for Biotechnology information (NCBI, national Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) website to identify and obtain functional information of the DNA sequence. The search result shows that the homology of the sequenced sequence and partial sequence of the Hu sheep GC gene DNA (GenBank accession number: NC_ 040257.1) reaches 99 percent.
Example 2 establishment of genotyping assay
(1) Primer sequence design
A KASPar primer pair was designed for the A/C polymorphic site shown in the amplified fragment SEQ ID NO.1 of example 1, so as to be used for the specific detection of the polymorphic site, and the nucleotide sequence of the designed KASPar primer pair was:
the forward primer A1 for detecting AlleA is shown in SEQ ID NO. 4:
5’-GAAGGTGACCAAGTTCATGCTAGCATGCTGTTGGGTTTGGTGAA-3’；
the forward primer A2 for detecting AlleC is shown in SEQ ID NO. 5:
5’-GAAGGTCGGAGTCAACGGATTGCATGCTGTTGGGTTTGGTGAC-3’；
the general reverse primer C is shown in SEQ ID NO. 6:
5’-GAGTTATCTCTCTATGGTAGGGTCC-3’。
the primers are entrusted to be synthesized by Beijing Biotechnology, inc. Each set of primers in the KASPar primer pair was diluted to 10. Mu. Mol/L and was used as forward primer A1 at a volume ratio of 12:12:30: forward primer A2: the proportion of the universal reverse primer C is mixed uniformly for standby.
(2) DNA quality control
The whole blood of Hu sheep is extracted with genome DNA and may be extracted with DNA extracting kit. The quality detection of the extracted genome DNA is carried out, 1% agarose electrophoresis and Nanodrop2100 are adopted for respectively detecting, and the qualified DNA is required to reach: (1) Agarose electrophoresis showed a single DNA band without significant diffusion. (2) Nanodrop2100 detection a260/280 is between 1.8-2.0; a260/230 is between 1.8 and 2.0; there is no significant light absorption at 270 nm. And according to KASPar detection technology and genome size of LGC company in UK, the dosage of DNA is 10-20 ng/sample, and the diluted concentration of extracted genome DNA is 10-20 ng/mu L as DNA template for standby.
(3) Genotyping assays
Firstly, a K-pette liquid-separating workstation is used for respectively adding 1.5 mu L of diluted DNA template to be detected (10-20 ng/muL) and blank control (No template control, NTC, sterilized water) into 384-hole reaction plates, and drying at 60 ℃ for 30min (drying oven, LGC company), so that the DNA is changed into dry powder for standby.
Each primer in the KASPar primer pair is diluted to 10 mu mol/L, and the forward primer A1 is prepared according to the volume ratio of 12:12:30: forward primer A2: the proportion of the universal reverse primer C is evenly mixed to be used as primer mixture liquid for standby.
And then adding a mixed solution of 1 XMaster Mix (1536 microwell plates, product number: part No. KBS-1016-011) and a primer into each reaction well by using a Meridian sample adding workstation under a Krake operating system, putting the microwell plates on a Kube heat sealing instrument and a Fusion laser membrane sealing instrument in sequence for membrane sealing after Mix packaging is finished, and carrying out high-throughput water bath PCR amplification by using a hydroxyler. The PCR reaction is carried out in a high-flux water bath system, and the specific procedures are as follows:
pre-denaturation at 94 ℃ for 15 min;
94 ℃,20 seconds (denaturation) -61 ℃ -55 ℃,1 minute (renaturation & extension), 10 cycles of amplification in the touchdown order, 0.6 ℃ decrease per cycle;
amplification was continued for 26 cycles at 94℃for 20 seconds (denaturation) -55℃for 60 seconds.
After amplification, the fluorescence signal was detected by using a BMG PHERAstar instrument and the typing was checked, and the specific results are shown in FIG. 3. Each dot in the figure represents a piece of material to be tested, wherein the red dot near the left side indicates that the locus is homozygous for genotype "CC"; blue dots near the right indicate that the locus is homozygous genotype "AA"; the green dots near the middle indicate that the locus is heterozygous genotype "CA" or "AC".
(4) Application of Hu sheep growth trait correlation analysis
The polymorphism of 1228 Hu sheep is detected in total, the genotype of the Hu sheep is determined, a least squares model is established as described below, and the correlation analysis of the genotype and the growth character is carried out.
Y ijkl ＝μ+Genotype i +P j +F k +M l +ε ijkl
Wherein Y is ijkl Is the observed value of growth characteristics, mu is the overall average, genotype i For genotypic effect, P j For batch effect, F k For the father effect, M l Epsilon as the maternal effect ijkl For random error, assume ε ijkl Independent of each other, obeys the N (0, σ2) distribution.
Genotype test results indicated 53 out of 1228 individuals with CC genotype, 266 individuals with CA genotype, and 909 individuals with AA genotype. The results of genotype and trait association analysis are shown in Table 1, wherein BW represents body weight in kg and BW80-BW180 represents body weight of Hu sheep at each stage (80-180 days), respectively. BH indicates height in cm, and BH80-BH180 indicates the height of Hu sheep at each stage (80-180 days), respectively. BL represents the body length in cm, and BL80-BL160 respectively represent the body length of Hu sheep at each stage (80-160 days).
TABLE 1GC Gene polymorphism and growth trait association analysis of Hu sheep
Note that: BW represents body weight in kg; BH represents the height, BL represents the body length in cm. P <0.05 indicates significant differences.
The results show that the A/C polymorphic site shown at position 355 in the amplified fragment SEQ ID NO.1 is significantly correlated with Hu sheep body weight, height and length as the assay cycle is extended. The results show that the weight, the height and the body length of the Hu sheep carrying the AA genotype are better than those of the sheep carrying the CC genotype (P < 0.05). From this, the A allele was found to be the dominant allele. The AA genotype is selected for seed conservation during breeding, and is used as a breeding sheep for hybridization with other sheep during breeding. In particular, the AA genotype stud ram semen is adopted for artificial insemination, so that the breeding efficiency can be greatly improved, and the flock with the advantage of growth speed can be obtained.
Claims (10)
1. A molecular marker related to Hu sheep growth traits is characterized in that the nucleotide sequence is shown as SEQ ID NO.1, wherein M at 355bp represents A or C, and the mutation leads to A/C polymorphism of the molecular marker.
2. The primer pair for detecting the molecular marker as claimed in claim 1, which comprises a primer M-F and a primer M-R, wherein the nucleotide sequence of the primer M-F is shown as SEQ ID NO.2, and the nucleotide sequence of the primer M-R is shown as SEQ ID NO. 3.
3. A KASPar primer pair for detecting the molecular marker according to claim 1, which comprises a forward primer 1 for detecting AlleA, a forward primer 2 for detecting AlleC and a universal reverse primer, wherein the nucleotide sequence of the forward primer 1 for detecting AlleA is shown as SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting AlleC is shown as SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO. 6.
4. A detection kit for detecting the molecular marker according to claim 1, characterized in that it comprises the primer pair according to claim 2 or the KASPar primer pair according to claim 3.
5. A method for detecting the molecular marker of claim 1, comprising the steps of:
s1, amplifying the genomic DNA of Hu sheep by using the PCR primer pair of claim 2 or the KASPar primer pair of claim 3 or the kit of claim 4;
s2, carrying out typing identification on the polymorphic sites of the amplification product obtained in the step S1.
6. The method according to claim 5, wherein the typing method in step S2 is a sequencing method, a fluorescent probe method, a gene chip method or a high resolution dissolution profile method.
7. The method according to claim 5, wherein the KASPar primer set according to claim 3 is used for PCR amplification, and after the amplification, the typing result is determined by detecting a fluorescent signal.
8. Use of the molecular marker of claim 1 or the primer pair of claim 2 or the KASPar primer pair of claim 3 or the kit of claim 4 or the method of any one of claims 5-7 in the detection of a growth trait of a hu sheep.
9. Use of the molecular marker of claim 1 or the primer pair of claim 2 or the KASPar primer pair of claim 3 or the kit of claim 4 or the method of any one of claims 5-7 in a hu sheep breeding.
10. Use according to claim 9, characterized in that the breeding purpose is to pick out fast-growing Hu sheep.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210879547.8A CN115992251A (en) | 2022-07-25 | 2022-07-25 | Molecular marker related to Hu sheep growth traits and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210879547.8A CN115992251A (en) | 2022-07-25 | 2022-07-25 | Molecular marker related to Hu sheep growth traits and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115992251A true CN115992251A (en) | 2023-04-21 |
Family
ID=85993096
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210879547.8A Pending CN115992251A (en) | 2022-07-25 | 2022-07-25 | Molecular marker related to Hu sheep growth traits and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115992251A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385061A (en) * | 2023-12-13 | 2024-01-12 | 中国农业科学院北京畜牧兽医研究所 | Molecular marker related to Hu sheep growth traits and application thereof |
-
2022
- 2022-07-25 CN CN202210879547.8A patent/CN115992251A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117385061A (en) * | 2023-12-13 | 2024-01-12 | 中国农业科学院北京畜牧兽医研究所 | Molecular marker related to Hu sheep growth traits and application thereof |
| CN117385061B (en) * | 2023-12-13 | 2024-03-15 | 中国农业科学院北京畜牧兽医研究所 | Molecular marker related to Hu sheep growth traits and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN109694915B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN110643716B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN105969879B (en) | Primer group for high-throughput detection of AhFAD2A gene mutation site typing and detection method | |
| CN106755371B (en) | Method for detecting sheep PCNP gene single nucleotide polymorphism by PCR-RFLP and application thereof | |
| CN116287299A (en) | Molecular marker related to sheep immune traits and application thereof | |
| CN116287298A (en) | Molecular marker related to Hu sheep immune traits, detection method and application thereof | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN107287283B (en) | High-throughput detection kit for multiple SNP sites related to children susceptibility diseases and use method thereof | |
| CN106755498B (en) | Molecular marker related to milk yield traits of milk goats and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN109022594B (en) | Cattle AHSG gene SNP marker related to conversion efficiency of beef cattle feed | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN114182026B (en) | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN114959052A (en) | Molecular marker related to Hu sheep physique and application thereof | |
| Liu et al. | Multiplex PCR sets of novel microsatellite loci for iwagaki oyster Crassostrea nippona and their application in parentage assignment | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN116334233A (en) | Molecular marker related to sheep tail fat deposition, detection method and application thereof | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |