CN115181804B - Molecular marker related to sheep growth traits, detection method and application thereof - Google Patents

Abstract

The invention provides a molecular marker related to sheep growth traits, a detection method and application thereof. The invention discovers that an A/T polymorphic site exists at the 558 th site of an amplified fragment by carrying out PCR amplification and sequence analysis on sheep ALB genes, further uses KASPar primer pair 1271 to detect the polymorphic site of sheep and establishes a least squares model, carries out correlation analysis on genotype and growth traits, and finally determines that the amplified ALB gene fragment can be used as a molecular marker related to average daily gain of sheep. The detection of the molecular marker can be used for selecting the sheep with the TT homozygous gene into the core group as the sheep so as to improve the growth characteristics of sheep and facilitate the increase of economic benefits.

Description

Molecular markers related to sheep growth traits, their detection methods and applications

Technical Field

The invention belongs to the technical field of molecular markers, and in particular relates to an ALB gene fragment as a molecular marker affecting sheep growth traits, a detection method and an application thereof.

Background Art

Albumin (ALB) is the most abundant circulating protein, which acts as a carrier protein for a variety of endogenous molecules, including fatty acids, hormones, and metabolites. In humans, some studies have shown that ALB levels are negatively correlated with body fat percentage (Chang, Xu, Ferrante, & Krakoff, 2019), and a decrease in maternal serum ALB ratio in late pregnancy will affect the birth weight of pregnant women's infants, and there is a positive correlation (Wada et al., 2021). In addition, there is a report showing that the duck ALB gene is strongly negatively correlated with FCR and RFI. However, it is not clear whether ALB is related to growth traits in sheep, or what the association is.

The sheep industry is an important part of modern animal husbandry. It can produce raw materials for the wool textile industry and increase people's economic income. With the general improvement of people's living standards, mutton is widely popular because of its low cholesterol, lean meat, high nutrition and tenderness (Hehua et al., 2020).

The present invention sequences and analyzes the ALB gene to explore the correlation between its different genotypes and sheep growth traits, aiming to provide genetic materials for improving the genetic improvement of sheep growth traits and accelerate the breeding process of high-quality meat sheep.

Summary of the invention

In order to solve the above technical problems, the present invention provides a molecular marker related to sheep growth traits and its application. The molecular marker of the present invention is amplified from the sheep ALB gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying the DNA sequence of the sheep ALB gene and sequencing, the polymorphic sites of the ALB gene are found, the correlation between different genotypes and sheep growth traits is analyzed, and a detection method for molecular markers containing polymorphic sites is established, and the molecular marker can be applied to the breeding of new high-quality mutton sheep.

To achieve the above object, the present invention adopts the following technical solutions:

A molecular marker related to sheep growth traits, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at the 558 bp position represents A or T, and since the above sequence has an A/T mutation at the 558th base, it leads to the A/T polymorphism of the sheep ALB gene at this site.

The results of genotype-trait association analysis showed that with the extension of the measurement period, the ALB g.8699A>T mutation site was significantly correlated with the average daily gain (ADG) of sheep. The average daily gain of 80-100, 80-140, and 80-160 of sheep carrying the TT genotype was better than that of sheep carrying the TA or AA genotype (P<0.05), which shows that TT is the dominant genotype.

A primer pair for detecting the above molecular markers. Preferably, the primer pair for detecting the above molecular markers comprises nucleotide sequences such as sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

A KASPar primer pair for detecting the above molecular markers, the KASPar primer pair comprising a forward primer 1 having a nucleotide sequence as shown in SEQ ID NO.4, a forward primer 2 as shown in SEQ ID NO.5 and a universal reverse primer C as shown in SEQ ID NO.6.

A kit for detecting the above molecular markers, wherein the kit comprises a PCR primer pair or a KASPar primer pair for detecting the above molecular markers.

A method for detecting a molecular marker related to sheep growth traits, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at position 558 bp represents A or T, and the method comprises using the above primer pair or kit to detect sheep genomic DNA, and the specific detection method comprises the following steps:

a) amplifying sheep genomic DNA using the above primer pair, KASPar primer pair or a kit comprising the above primer pair;

b) identifying the polymorphic sites of the amplified product obtained in step a).

Wherein, in step b), the above-mentioned typing and identification methods include but are not limited to direct sequencing method, probe method, gene chip method, and high-resolution melting curve method.

The method for detecting molecular markers related to sheep growth traits using the above primer pair comprises the following steps:

a) extracting genomic DNA from sheep blood as a sample, and performing high-throughput water bath PCR amplification using primer pairs with nucleotide sequences such as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

b) After amplification, use the BMG PHERAstar instrument to detect the fluorescence signal and check the typing results.

The molecular markers and their polymorphic sites, primer pairs or kit detection methods as described above are used in the detection of sheep growth traits. By detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, the growth traits of the sheep can be determined, and fast-growing sheep can be screened out.

The molecular markers and the detection methods of the polymorphic sites, primer pairs or kits described above are used in sheep breeding. The genotype of the ALB gene of the sample to be tested is determined by amplifying and detecting the genomic DNA of the sheep using the primer pairs or kits described above, so that fast-growing sheep breeds can be bred therefrom.

Finding the mutation sites of genes and discovering the relationship between genes and traits through association analysis is an important means of studying gene function and is also the basis for marker-assisted selection.

The present invention performs PCR amplification and sequencing on the ALB gene of Hu sheep, a representative sheep breed, and finds that there is an A/T polymorphic site at the 558th position of the amplified fragment. By detecting the polymorphism of 1271 Hu sheep and establishing a least squares model, a molecular marker related to the growth traits of sheep is determined. The molecular marker can be used for the breeding of new high-quality meat sheep breeds, provides an effective genetic engineering means for the genetic improvement of sheep growth traits, and has great practical application value.

The present invention detects the above molecular markers by designing KASPar primers required for competitive allele-specific PCR (KASP). This detection method does not need to synthesize specific fluorescent probes for each SNP site, but is based on its own unique ARM PCR principle, so that all site detections are ultimately amplified using universal fluorescent primers, which greatly reduces the cost of reagents and has high accuracy, providing a simple, accurate and low-cost operating method for the detection of molecular markers of the present invention.

The beneficial effects of the present invention are:

The present invention provides a molecular marker related to sheep growth traits and its A/T polymorphic site, and effectively identifies whether the sheep are fast-growing by measuring the genotype of the polymorphism, thereby providing an effective detection method for the selection and breeding of fast-growing sheep. The present invention can be used to select TT homozygous sheep as breeding sheep through the detection of molecular markers and polymorphic sites, so as to improve the growth traits of sheep and help improve the economic benefits of the breeding industry.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG1 is a gel electrophoresis diagram of the sheep ALB gene fragment used as a molecular marker in the present invention; wherein, lane M: DL 2000 Marker, lanes 1-10: ALB gene amplification results.

FIG. 2 is the sequencing result of the sheep ALB gene mutation site in the present invention.

Figure 3 is the KASPar SNP typing result of the g.8699A>T mutation site of the sheep ALB gene in the present invention; wherein, the red dot near the left side represents the TT genotype, the green dot near the middle represents the TA genotype, and the blue dot near the right side represents the AA genotype.

DETAILED DESCRIPTION

The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the present method are of analytical grade or above.

Example 1 ALB gene amplification

Using sheep ALB gene DNA (GenBank accession number: NC_040257.1) as a template, a pair of primers were designed using Oligo7.0 software: forward primer and reverse primer. The primer sequences are as follows:

Forward primer (SEQ ID NO.2): 5'-TTCATAGCAGGCATATTGGT-3'

Reverse primer (SEQ ID NO.3): 5'-TCTAGAGCATCTGCCACAA-3'

(2) ALB gene amplification and sequencing

The genomic DNA extracted from the whole blood cells of sheep was used as a DNA template for PCR amplification. The total reaction volume of the amplification was 25 μL, including 1 μL DNA template, 12.4 μL 2×PCR Master Mix, 0.8 μL forward primer (concentration of 10 μmol/L), 0.8 μL reverse primer (concentration of 10 μmol/L), and 10 μL ddH ₂ O. The PCR amplification reaction conditions were: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 54.5°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, and finally 72°C extension for 10 min.

The PCR amplification reaction product was detected by 1.5% agarose gel electrophoresis, and the result is shown in Figure 1, which shows that a 603bp specific amplified fragment was obtained. The amplified PCR fragment was sequenced, and the sequencing result showed that the specific nucleotide sequence of the amplified fragment was as shown in SEQ ID NO.1, wherein there was a polymorphic site in the fragment, specifically W at the 558bp site was A or T, that is, the amplified ALB gene fragment (SEQ ID NO.1) had A/T polymorphism at the 558bp site (see Figure 2).

Among them, SEQ ID NO.1:

TAGTTCTGTCTGTGCCTCTAGGCTTAGCAGCACGGGTTGAAAATCTTCATAGCAGGCATATTGGTACAAGTATGGTCTTAGAGCACAATGAATGTGTTCTGTCGACATAGTAAATGTCTGGGGAGGAAGCACAGGAATGTCACTTTACAGTGAACACTTTTCACCTACTTGCTTGTAGGCAGATCTTGCCAAGTACATATGTGATCATCAAGACGCACTCTCCAGTAAACTGAAGGAATGCTGTGATAAGCCTGTGTT GGAAAAATCCCACTGCATTGCTGAGGTAGATAAAGATGCCGTGC CTGAAAACCTGCCCCCCATTAACTGCTGACTTTGCTGAAGATAAGGAGGTTTGCAAAAACTATCAGGAAGCAAAAGACGTCTTCCTGGGCTCGTAAGTGGATAAAAAATGATCCTTTCATACTTTTATATGATCTCAGAATTTAGGAAATTATTCTAGGCTTTCCTTTGGAATTGCTACAATTTTTCACGTTGCCTGCAATGTTTCTTTTATTCTTTCCTCTTCTGGCCGTTAAACATTTTTGGAAAAATTGCTTTTWAAAAATT GTCATAAAATAATACATGCTTGTGGCAGATGCTCTAGA.

DNA sequence homology search and identification:

The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence was 99% homologous to the partial sequence of the sheep ALB gene DNA (GenBank accession number: NC_040257.1).

Example 2 Establishment of genotyping detection method

1) Primer sequence design

A KASPar primer pair was designed for the A/T polymorphic site of the amplified fragment in Example 1, so as to be used for specific detection of the polymorphic site. The nucleotide sequence of the designed KASPar primer pair is:

Forward primer A1 (SEQ ID NO.4) for detecting AlleleX:

5’-GAAGGTGACCAAGTTCATGCTCCGTTAAACATTTTTGGAAAAAA TTGCTTTTA-3’;

Forward primer A2 (SEQ ID NO.5) for detecting AlleleY:

5’-GAAGGTCGGAGTCAACGGATTCCGTTAAACATTTTTGGAAAAAA TTGCTTTTT-3’;

Universal reverse primer C (SEQ ID NO. 6): 5'-GCATCTGCCACAAGCATGTATT ATTTTATG-3'.

The above primers were synthesized by Beijing Shenggong Biotechnology Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol/L and mixed in a volume ratio of 12:12:30 for use.

2) DNA quality control

The extraction of genomic DNA from the whole blood of sheep can be performed using a DNA extraction kit. The quality of the extracted genomic DNA is tested by 1% agarose electrophoresis and Nanodrop2100, respectively. The qualified DNA requires: (1) agarose electrophoresis shows a single DNA band without obvious diffusion. (2) Nanodrop2100 detection A260/280 is between 1.8-2.0; A260/230 is between 1.8-2.0; there is no obvious light absorption at 270nm. According to the KASPar detection technology of LGC Company in the UK and the size of the genome, the amount of DNA is calculated to be 10-20ng/sample, and the extracted genomic DNA is diluted to a concentration of 10-20ng/μL as a DNA template.

3) Genotyping

First, use the K-pette dispensing workstation to add 1.5uL of the diluted test DNA template (10-20ng/μL) and the blank control (No template control, NTC, using sterile water) into a 384-well reaction plate, and dry it at 60℃ for 30min (drying oven, LGC company) to turn the DNA into dry powder for use.

Each primer in the above KASPar primer pair was diluted to 10 μmol/L, and mixed at a volume ratio of 12:12:30 for primer A1:A2:C to prepare a primer mixture for later use.

Then, under the Kraken operating system, 1× Master mix (1536 microplate, Part No. KBS-1016-011) and primer mixture were added to each reaction well using the Meridian sample loading workstation. After the Mix was dispensed, the microplate was immediately placed on the Kube heat sealer and the Fusion laser sealer for sealing, and the high-throughput water bath PCR amplification was performed using the Hydrocycler. The PCR reaction was performed in the high-throughput water bath system Hydrocycler, and the specific procedure was as follows:

Pre-denaturation at 94°C for 15 minutes;

94℃, 20 seconds (denaturation) - 61℃-55℃, 1 minute (renaturation & extension), 10 cycles of touch down sequence, decreasing 0.6℃ per cycle;

Amplification was continued for 26 cycles from 94°C, 20 seconds (denaturation) to 55°C, 60 seconds.

After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing situation. The specific results are shown in Figure 3. Each dot in the figure represents a test material, where the red dot near the left side indicates that the site is a homozygous genotype "TT"; the blue dot near the right side indicates that the site is a homozygous genotype "AA"; the green dot near the middle indicates that the site is a heterozygous genotype "TA" or "AT"; the black dot represents NTC (not shown in Figure 3), which is the blank control.

4) Application of the molecular markers of the present invention in association analysis of sheep growth traits

A total of 1,271 Hu sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and growth traits.

Y _ijk =μ+Genotype _i +P _j +F _k +M _l +ε _ijkl where Y _ijk is the phenotypic observation of growth traits, μ is the overall mean, Genotype _i is the genotype effect, P _j is the batch effect, F _k is the paternal effect, M _l is the maternal effect, and ε _ijkl is the random error. It is assumed that ε _ijkl are independent of each other and obey the N(0,σ ² ) distribution.

The results of genotype detection showed that among 1271 individuals, there were 418 individuals with AA genotype, 642 individuals with TA genotype, and 211 individuals with TT genotype. The results of genotype-trait association analysis are shown in Table 1, where ADG in the table represents average daily weight gain, in kg. ADG80-100 represents the average daily weight gain of sheep from 80 to 100 days; ADG80-120 represents the average daily weight gain of sheep from 80 to 120 days; ADG80-140 represents the average daily weight gain of sheep from 80 to 140 days; ADG80-160 represents the average daily weight gain of sheep from 80 to 160 days; ADG80-180 represents the average daily weight gain of sheep from 80 to 180 days.

Table 1 Association analysis between ALB gene polymorphism and growth traits in Hu sheep

Note: P<0.05 indicates significant difference.

The results showed that as the measurement period was prolonged, the ALB g.8699A>T mutation site was significantly correlated with the average daily weight gain of Hu sheep. The staged daily weight gain of sheep carrying the TT genotype was better than that of sheep carrying the TA genotype (P<0.05). It can be seen that the T allele is a dominant allele. During breeding, the TT genotype is selected for seed preservation, and during breeding, the TT genotype is used as a breeding sheep and hybridized with other sheep. In particular, artificial insemination with semen from TT genotype rams can greatly improve breeding efficiency and obtain a flock with an advantageous growth rate.

Sequence Listing

<110> Gansu Agricultural University

<120> Molecular markers related to sheep growth traits, their detection methods and applications

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 603

<212> DNA

<213> Artificial Sequence

<400> 1

tagttctgtc tgtgcctcta ggcttagcag cacgggttga aaatcttcat agcaggcata 60

ttggtacaag tatggtctta gagcacaatg aatgtgttct gtcgacatag taaatgtctg 120

gggaggaagc acaggaatgt cactttacag tgaacacttt tcacctactt gcttgtaggc 180

agatcttgcc aagtacatat gtgatcatca agacgcactc tccagtaaac tgaaggaatg 240

ctgtgataag cctgtgttgg aaaaatccca ctgcattgct gaggtagata aagatgccgt 300

gcctgaaaac ctgcccccat taactgctga ctttgctgaa gataaggagg tttgcaaaaa 360

ctatcaggaa gcaaaagacg tcttcctggg ctcgtaagtg gataaaaaat gatcctttca 420

tacttttata tgatctcaga atttaggaaa ttatctagg ctttcctttg gaattgctac 480

aatttttcac gttgcctgca atgtttcttt attctttcct cttctggccg ttaaacattt 540

ttggaaaaat tgcttttwaa aaattgtcat aaaataatac atgcttgtgg cagatgctct 600

aga 603

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

ttcatagcag gcatattggt 20

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 3

tctagagcat ctgccacaa 19

<210> 4

<211> 52

<212> DNA

<213> Artificial Sequence

<400> 4

gaaggtgacc aagttcatgc tccgttaaac atttttggaa aaattgcttt ta 52

<210> 5

<211> 52

<212> DNA

<213> Artificial Sequence

<400> 5

gaaggtcgga gtcaacggat tccgttaaac atttttggaa aaattgcttt tt 52

<210> 6

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 6

gcatctgcca caagcatgta ttatttatg 30

Claims (9)

1. The application of a molecular marker related to sheep growth traits in sheep breeding is disclosed, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, W at 558bp represents A or T, and the mutation leads to the A/T polymorphism of the molecular marker; the method is characterized in that the staged daily gain of the sheep carrying the TT genotype is better than that of the sheep carrying the TA genotype.

2. Use of a PCR primer pair for detecting a molecular marker associated with sheep growth traits in sheep breeding, wherein the PCR primer pair comprises sequences of nucleotide sequences shown as SEQ ID No.2 and SEQ ID No.3, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1, wherein W at 558bp represents a or T, the mutation resulting in a/T polymorphism of the molecular marker; the method is characterized in that the staged daily gain of the sheep carrying the TT genotype is better than that of the sheep carrying the TA genotype.

3. Use of a KASPar primer pair for detecting a molecular marker associated with sheep growth traits in sheep breeding, wherein the KASPar primer pair comprises a forward primer 1 having a nucleotide sequence shown as SEQ ID No.4, a forward primer 2 having a nucleotide sequence shown as SEQ ID No.5 and a universal reverse primer C having a nucleotide sequence shown as SEQ ID No.6, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1, wherein W at 558bp represents a or T, the mutation resulting in an a/T polymorphism of the molecular marker; the method is characterized in that the staged daily gain of the sheep carrying the TT genotype is better than that of the sheep carrying the TA genotype.

4. Use of a kit for detecting a molecular marker associated with sheep growth traits in sheep breeding, wherein the kit comprises a PCR primer pair having a nucleotide sequence shown as SEQ ID No.2-3 or a KASPar primer pair having a nucleotide sequence shown as SEQ ID No.4-6, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID No.1, wherein W at 558bp represents a or T, the mutation resulting in an a/T polymorphism of the molecular marker; the method is characterized in that the staged daily gain of the sheep carrying the TT genotype is better than that of the sheep carrying the TA genotype.

5. Use of a method for detecting a molecular marker associated with sheep growth traits in sheep breeding comprising the steps of:

a) Amplifying sheep genome DNA by using a PCR primer pair with a nucleotide sequence shown as SEQ ID NO.2-3 or a KASPar primer pair with a nucleotide sequence shown as SEQ ID NO.4-6, or a kit containing the PCR primer pair or the KASPar primer pair;

b) And c) carrying out typing identification on specific sites of A or T represented by W at 558bp of the nucleotide sequence of the amplified product obtained in the step a) as shown in SEQ ID NO.1, wherein the staged daily gain of sheep carrying the TT genotype is better than that of sheep carrying the TA genotype.

6. The use according to claim 5, wherein the typing method in step b) is a sequencing method, a fluorescent probe method, a gene chip method or a high resolution dissolution profile method.

7. The use according to claim 5, wherein the PCR amplification is performed using a KASPar primer pair having a nucleotide sequence shown in SEQ ID NO.4-6, and the typing result is determined by detecting a fluorescent signal after the amplification is completed.

8. Use of a molecular marker associated with a sheep growth trait, or a PCR primer pair for detecting a molecular marker associated with a sheep growth trait, a KASPar primer pair, or a kit comprising a PCR primer pair or KASPar primer pair for detecting a molecular marker associated with a sheep growth trait, or a method for detecting a molecular marker associated with a sheep growth trait in sheep growth trait detection, characterized in that the nucleotide sequence of the molecular marker is as shown in SEQ ID No.1, wherein W at 558bp in the sequence SEQ ID No.1 is a or T, the mutation resulting in an a/T polymorphism of the molecular marker, wherein the staged daily gain of sheep carrying the TT genotype is superior to sheep carrying the TA genotype;

the nucleotide sequence of the PCR primer pair is shown as SEQ ID NO. 2-3;

The nucleotide sequences of the KASPar primer pairs are shown in SEQ ID NO. 4-6.

9. Use according to any one of claims 1 to 7, characterized in that the breeding purpose is to pick out fast-growing sheep.