CN114182026B - Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker - Google Patents
Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker Download PDFInfo
- Publication number
- CN114182026B CN114182026B CN202210015613.7A CN202210015613A CN114182026B CN 114182026 B CN114182026 B CN 114182026B CN 202210015613 A CN202210015613 A CN 202210015613A CN 114182026 B CN114182026 B CN 114182026B
- Authority
- CN
- China
- Prior art keywords
- sheep
- molecular marker
- conversion rate
- feed conversion
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P60/00—Technologies relating to agriculture, livestock or agroalimentary industries
- Y02P60/80—Food processing, e.g. use of renewable energies or variable speed drives in handling, conveying or stacking
- Y02P60/87—Re-use of by-products of food processing for fodder production
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a molecular marker related to a Hu sheep feed conversion rate, a detection method and application of the molecular marker. According to the invention, through PCR amplification and sequence analysis of the ADCY8 gene of the Hu sheep, a T/C polymorphic site exists at 486 th site of an amplified fragment, further KASPar primer pair 981 polymorphic sites of the Hu sheep are used for detection and least squares model establishment, and correlation analysis is carried out on genotype and feed conversion rate, so that the amplified ADCY8 gene fragment can be finally determined to be used as a molecular marker related to the feed conversion rate of the Hu sheep. The molecular marker can be used for selecting and reserving the TT homozygous Hu sheep to enter the core group so as to improve the feed conversion rate of the Hu sheep, reduce the production cost and be beneficial to increasing the economic benefit.
Description
Technical Field
The invention belongs to the technical field of molecular marker preparation and application, and particularly relates to an ADCY8 gene segment serving as a molecular marker for influencing the feed conversion rate of Hu sheep and application thereof.
Background
Adenylate cyclase (ADCY 8) is a membrane-bound enzyme that catalyzes the formation of ATP to cyclic AMP. The enzymatic activity is controlled by several hormones, and the different polypeptides are involved in the transduction of signals from the receptor to the catalytic moiety. The stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) with GTPase activity, which regulate the activity of the adenylate cyclase catalytic subunit (RefSeq, jul 2008). In response to calcium entry catalyzing cAMP formation, resulting in cAMP signaling activation, affecting processes such as synaptic plasticity and insulin secretion, ADCY8 levels are positively correlated with body mass index and Hb1Ac levels, and whole genome analysis studies have established a correlation between ADCY8 gene variation, obesity and abnormal adipose tissue pool (Abdel-Halim, s.m., al Madhoun, a., bitar, m.s., & Al-mula, f., 2020).
According to the data of the national statistical office, the stock of sheep and goats in 2017 reaches 3.02 hundred million, and the mutton yield reaches 471.07 ten thousand tons, which is the world maximum mutton production and consumption country (Zhang Xiaoxue. Different residual feed intake lamb production performance and rumen microbiology and liver transcriptome research [ D ]. Lanzhou university, 2019.). The mutton production is fed under the condition of house feeding mostly at present, has great dependence on grains, can maximally improve the conversion rate of the sheep flock feed, can solve the problem of insufficient grain supply, and can effectively improve the economic benefit. On the premise of not influencing the normal growth of animals, the method reduces the index related to the genetic improvement of feed input, namely the improvement of the feed utilization rate of livestock and poultry, and has important research significance.
The feed utilization rate of animals refers to the utilization rate of the animals on the fed diet, and is mainly influenced by the diet and the animals. Feed Efficiency (FE) is a short term for Feed conversion rate (Feed conversion ration, FCR), also called Feed return, and generally the Feed conversion rate refers to the amount of Feed consumed by an animal weighing 1kg, i.e. Feed interval/gain (F/G), and is an important economic indicator for measuring the utilization rate of Feed for a long time. In addition, the weight gain feed ratio (G/F) is an index for representing the relation between the weight gain and the daily ration feed intake of the livestock and poultry. How to screen out genes related to the feed conversion rate of the Hu sheep and what is related to the genes, and cultivate new varieties of grain-saving high-quality mutton sheep for the Hu sheep, so that the pressure on grains can be effectively solved.
The invention discusses the correlation between different genotypes and the feed conversion rate of the Hu sheep by sequencing and analyzing the ADCY8 gene, and aims to provide gene materials for the aspect of genetic improvement of the feed conversion rate of the Hu sheep and accelerate the cultivation process of new high-quality mutton sheep varieties with independent intellectual property and high feed conversion rate.
Disclosure of Invention
In order to solve the technical problems, the invention provides a molecular marker related to the feed conversion rate of Hu sheep and application thereof.
In order to achieve the above purpose, the invention adopts the following technical scheme:
a molecular marker related to the feed conversion rate of Hu sheep is obtained by amplifying the ADCY8 gene of Hu sheep, and specifically, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein Y at 486 th position of the sequence represents C or T, and the C/T polymorphism of the ADCY8 gene of Hu sheep at the position is caused due to the T/C mutation at the base.
A primer set for detecting the above molecular marker, any primer capable of specifically amplifying the molecular marker of the present invention or a fragment containing the above polymorphic site is suitable for detecting the molecular marker, preferably, a forward primer having a nucleotide sequence shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence shown in SEQ ID NO. 3.
A KASPar primer pair for detecting a molecular marker as described above, preferably, the nucleotide sequence of the KASPar primer pair comprises a forward primer A1 for detecting AlleC as shown in SEQ ID NO.4, a forward primer A2 for detecting AlleT as shown in SEQ ID NO.5, and a universal reverse primer C as shown in SEQ ID NO. 6. A kit for detecting the molecular marker, wherein the kit comprises the primer pair or the KASPar primer pair for detecting the molecular marker.
A method for detecting molecular markers related to the feed conversion rate of Hu sheep, wherein the nucleotide sequence of the molecular markers is shown as SEQ ID NO.1, the method comprises the steps of detecting the ADCY8 gene of the Hu sheep by using the primer pair or the kit, and the specific detection method comprises the following steps:
a) Amplifying the Hu sheep genomic DNA using the primer pair, the KASPar primer pair or a kit comprising the primer pair as described above;
b) Identifying the polymorphic site of the amplification product obtained in step a).
Preferably, in step b), any SNP typing method may be applied to the detection of the molecular markers in the present invention, and the above-mentioned methods for SNP typing identification include, but are not limited to, direct sequencing method, probe method, gene chip method, high resolution dissolution profile method.
Under the condition that the molecular marker sequence and the polymorphic site are known, designing a corresponding probe aiming at the polymorphic site, and detecting the molecular marker and the polymorphic site by utilizing the SNP typing method belong to the conventional and mature technology in the field, and the probe designed aiming at the polymorphic site can also be contained in the kit.
A method for detecting molecular markers related to the feed conversion rate of Hu sheep by using the primer pair, which comprises the following steps:
a) Extracting genome DNA by taking Hu sheep blood as a sample, and carrying out PCR amplification on the extracted genome DNA by utilizing primers with nucleotide shown as SEQ ID NO.2 and SEQ ID NO. 3;
b) Sequencing and sequence analysis are carried out on the PCR amplification products, so that the genotype is determined by the base type of the polymorphic site.
A method for detecting molecular markers associated with feed conversion in a hu sheep using a KASPar primer pair as described above, comprising the steps of:
a) Extracting genome DNA from Hu sheep blood as a sample, and performing high-throughput water bath PCR amplification by using a primer pair with a nucleotide sequence shown as SEQ ID NO. 4-6;
b) After amplification, fluorescence signals are detected by using a BMG PHERAstar instrument and the typing result is checked.
The molecular marker and the polymorphic site thereof, the primer pair or the kit and the application of the detection method thereof in the detection of the feed conversion rate of the Hu sheep can determine the feed conversion rate of the Hu sheep by detecting the molecular marker and analyzing the type of the polymorphic site in the Hu sheep to be detected, and further screen out the Hu sheep with high feed conversion rate.
The molecular marker and the polymorphism site, the primer pair or the kit thereof are applied to the breeding of Hu sheep, and the primer pair or the kit is utilized to amplify and detect the genome of the Hu sheep to determine the genotype of a sample to be detected, so that the Hu sheep variety with high feed conversion rate can be bred from the genotype.
The invention has the beneficial effects that:
the molecular marker related to the weight of the Hu sheep and the polymorphic site are provided by the invention, the molecular marker is obtained by amplifying the ADCY8 gene of the Hu sheep, a T/C polymorphic site exists, whether the Hu sheep is the Hu sheep with high feed conversion rate is effectively identified by measuring the genotype of the polymorphism, and an effective detection means is provided for breeding the Hu sheep with high feed conversion rate. The molecular marker and the detection of polymorphic loci can be used for selecting and reserving the Hu sheep with the TT homozygous into the core group, and the Hu sheep with high feed conversion rate can be bred in a large amount, so that the feed conversion rate of the Hu sheep is improved, the utilization rate of the feed is improved, the production cost is reduced, and the economic benefit is increased.
Drawings
FIG. 1 is a gel electrophoresis diagram of a fragment of the ADCY8 gene for a Hu sheep as a molecular marker in the invention; wherein, lane M: DL 2000marker, lanes 1-10: amplification results of ADCY8 gene.
FIG. 2 shows the result of KASPar SNP typing of a T mutation site of g.4816C > of an ADCY8 gene amplification sequence of Hu sheep in the invention; wherein, the red dot near the left represents TT genotype, the green dot near the middle represents TC genotype, and the blue dot near the right represents CC genotype.
FIG. 3 shows the sequencing result of ADCY8 gene mutation sites of Hu sheep in the invention.
Detailed Description
According to the invention, through carrying out a large number of PCR amplification and sequence analysis on the ADCY8 gene of the Hu sheep, a T/C polymorphic site exists at 486 th site of an amplified fragment, further, KASPar primer pair 981 polymorphic sites of the Hu sheep are used for detection and a least squares model is established, and correlation analysis is carried out on genotype and feed conversion rate, so that finally, the amplified ADCY8 gene fragment can be used as a molecular marker related to the feed conversion rate of the Hu sheep, and the specific nucleotide sequence is shown in SEQ ID NO. 1. The DNA sequence of the ADCY8 gene of the Hu sheep is amplified and sequenced to identify the polymorphic site of the ADCY8 gene, so that a detection method of a molecular marker related to the feed conversion rate of the Hu sheep can be established, the molecular marker can be applied to the cultivation of new high-quality mutton sheep varieties with high feed conversion rate, the molecular marker can be used for breeding the Hu sheep with high feed conversion rate, and an effective genetic engineering means is provided for genetic improvement of the feed conversion rate of the Hu sheep, so that the molecular marker has great practical application value.
The following examples serve to further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions made to the invention without departing from the spirit and nature of the invention are intended to be within the scope of the invention.
Unless otherwise indicated, all technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the methods are of analytical purity or above.
Example 1 amplification of the ADCY8 Gene
(1) Primer design
A pair of primers M-F and M-R is designed by using Hu sheep ADCY8 gene DNA (GenBank accession number: NC_ 040260) as a template and utilizing Oligo7.0 software, and the primer sequences are as follows
Forward primer M-F is SEQ ID NO.2:5 '-GCACAAGTACCAAGACTGACA-3',
reverse primer M-R is SEQ ID NO.3:5 '-CGTCCATATCCAGAAAGCATT-3'.
(2) Amplification and sequencing of the ADCY8 Gene
The PCR reaction used a 35. Mu.L system in which 1.5. Mu.L of DNA template, 1. Mu.L of forward primer, 1. Mu.L of reverse primer, and 1. Mu.L of ddH were used 2 O 14μL。
The reaction procedure for PCR amplification was: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 52℃for 30s, extension at 72℃for 30s, cycling for 35 times, and extension at 72℃for 10min.
The reaction products of the PCR amplification were detected by 1.5% agarose gel electrophoresis, and the results are shown in FIG. 1, in which M lanes: DL 2000marker, lanes 1-10: amplification results of ADCY8 gene. The result showed that a 889bp specific amplified fragment was obtained. Sequencing the amplified PCR fragment, wherein the specific nucleotide sequence of the amplified fragment is shown as SEQ ID NO.1, and a polymorphic site exists in the 889bp fragment, namely Y at 486bp represents T or C, namely the amplified ADCY8 gene fragment has T/C polymorphism at 486bp site, as shown in figure 2.
SEQ ID NO.1:GCACAAGTACCAAGACTGACACTGTTGTCTGGGTCTGTTTCAGCTGCTCGGTGAAGACCGGTTTCAAGACATTGAAAAGATTAAGACCATTGGTAGTACCTACATGGCCGTGTCAGGCCTGTCACCTGAAAAGCAGGTAAAGGAATGCTCTAGACTCGACCACACCCTCCGGCAGGGACCTCACTGTGGTTATGTCGCTGAAGGTGGGAGAGTGGTGGGCTGTCAGCGCCAGGAGACCTGGTGACTGGCAGGGAGAAACTTTGATAAGTGGACCTTCCAGGTGTGTGATGTATTTGTTCCCCATGTAAGCAGGATCCACTGGGTGAAACGATGCTTCTTTATGATTGAGACGCCTTTAGGCTTCACTCTGAAACTCACTGTTCACTTGATGTGCAAAATCAGGACCGAGAAATACCAATTATGAGCGTTTGCTGGTGTTGCTAAACCCATGATCCCAGCCTGTTTTCTTACTCTTACTTTTGTTTYCTCCTCCAAAAGTGATGATAATAATAGCTCCAGTTTTTAAAAATTGAAAGTCAGACTTTAAAACATTTTTTATGTATTTATTTTTTGGCTGCACTGGGTCTTCGTTGCAGCATGCAGGCTTTCTCTCCTTATGTTGAGTGGGGGCATCTCATTATGGTGGCTTTTCTTGTTGTGGAGCTCGGGCTCTAGGGCACGTGGGCTCAGTAGTTGTGGCTCCTGGGCTCCAGTATTAATAGTTTTACTTTTTTGAGAGGTGATTGTGTGCCAGGCACTAGTGTTAAGTGGGAAAACCAACATCTACCCCCCAAGGTCAGTGGATGAATTTACCTGGGATAGAGTCATGCTGCCCGCACAAAGCCCTGCCCATGGTAGGTCCTCAGTAAATGCTTTCTGGATATGGACG
DNA sequence homology search identification:
the DNA sequence obtained after sequencing was compared for sequence homology with known physiological functional genes published in the GenBank database by means of the BLAST (Basic Local Alignment Search Tool) software of the national center for Biotechnology information (NCBI, national Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) website to identify and obtain functional information of the DNA sequence. The search result shows that the partial sequence homology of the sequenced sequence and the ADCY8 gene DNA of Hu sheep (GenBank accession number: NC-040260) reaches 99 percent.
Example 2 establishment of genotyping assay
(1) Primer sequence design
A KASPar primer pair was designed for the C/T polymorphic site of the amplified fragment of example 1 for specific detection of the polymorphic site described in example 1, the nucleotide sequence of the KASPar primer pair being:
forward primer A1 (SEQ ID NO. 4) for detecting AlleC:
5＇-GAAGGTGACCAAGTTCATGCTTATTATTATCATCACTTTTGGAGGAGG-3＇；
forward primer A2 (SEQ ID NO. 5) for detecting AlleT:
5＇-GAAGGTCGGAGTCAACGGATTCTATTATTATCATCACTTTTGGAGGAG-3＇A；
universal reverse primer C (SEQ ID No. 6): 5 '-GATCCCAGCCTGTTTTCTTACTCTTAC-3'.
The primers were synthesized by Beijing Biotechnology Co. Each of the above KASPar primer pairs was diluted to 10. Mu. Mol/L and was used as forward primer A1: forward primer A2: the reverse primer C is uniformly mixed according to the volume ratio of 12:12:30 to prepare a primer mixture for standby.
(2) DNA quality control
The quality of genomic DNA extracted from a Hu sheep blood sample is detected by 1% agarose electrophoresis and Nanodrop2100, and the qualified DNA requires: agarose electrophoresis showed single DNA bands without significant dispersion; nanodrop2100 detection A260/280 is between 1.8-2.0 (DNA sample has no protein contamination); a260/230 is between 1.8 and 2.0 (DNA sample salt ion concentration is low); there was no significant light absorption at 270nm (no phenol contamination of the DNA sample). The DNA amount was calculated to be 10-20 ng/sample based on KASP detection technique and genome size from LGC, UK, and the diluted DNA concentration was 10-20 ng/μl for use.
(3) Genotyping
Firstly, a K-pette liquid-separating workstation is used for respectively adding 1.5uL of diluted DNA template to be detected (10-20 ng/. Mu.L) and blank control (No template control, NTC) into 384-hole reaction plates, and drying is carried out for 30min at the temperature of a drying box at 60 ℃ so that the DNA becomes dry powder for standby. And then adding a mixed solution of 1 XMaster Mix (1536 microwell plate product No. KBS-1016-011) and a primer into each reaction well by using a Meridian sample adding workstation under a Krake operating system, putting the microwell plates on a Kube heat sealing instrument and a Fusion laser membrane sealing instrument in sequence for sealing membranes immediately after Mix packaging, and carrying out high-flux water bath PCR amplification by using a hydroloader. The PCR reaction is carried out in a high-flux water bath system, and the specific procedures are as follows:
pre-denaturation at 94 ℃ for 15 min;
94 ℃,20 seconds (denaturation) -61 ℃ -55 ℃,1 minute (renaturation & extension), 10 cycles of amplification in the touchdown order, 0.6 ℃ decrease per cycle;
amplification was continued for 26 cycles at 94℃for 20 seconds (denaturation) -55℃for 60 seconds.
After amplification, the fluorescence signal was detected by using a BMG PHERAstar instrument and the typing was checked, and the specific results are shown in FIG. 3. Each dot in the figure represents a piece of material to be tested, wherein the red dot near the left side indicates that the locus is homozygous for genotype "TT"; the blue dot near the right indicates that the locus is homozygous genotype "CC"; the green dots near the middle indicate that the locus is heterozygous genotype "CT" or "TC"; the pink dots represent NTC (not shown in fig. 3), i.e. a blank control, the DNA template of which was water.
(4) Application of molecular marker in Hu sheep feed conversion rate marker correlation analysis
The experiment detects polymorphism of 981 Hu sheep altogether, determines genotype thereof, establishes a least squares model as described below, and carries out genotype and feed conversion rate correlation analysis.
Y ijk ＝μ+Genotype i +P j +S k +ε ijk
Wherein Y is ijk Mu is the overall average, genotype, as observed for feed conversion i For genotypic effect, P j For batch effect, S k For seasonal effects, ε ijk For random error, assume ε ijk Independent of each other, obeys the N (0, σ2) distribution.
Genotype detection results show that of 981 individuals, the CC genotype has 541 individuals, the CT genotype has 388 individuals, and the TT genotype has 52 individuals. The results of genotype and trait association analysis are shown in table 1, wherein the method for determining the feed conversion rate of the Hu sheep is calculated according to the following formula according to the average daily gain and average daily feed intake of the experimental sheep: feed conversion ratio (Feed conversion rate, FCR) =average daily feed intake (kg/d)/average daily gain (kg/d). Residual feed intake (Residual feed intake, RFI) =β 0 +β 1 (ADG i )+β 2 MBW i +e i . Wherein beta is 0 Represents regression intercept, ADG i Is the average daily gain of Hu sheep individual i, and beta 1 Is a fixed value, beta, for showing the influence degree of ADG on individual feed intake 2 And is also a fixed value, representing the influence degree of average metaphase metabolic weight on feed intake. e, e i The RFI of the Hu sheep individual i is the difference between the actual feed intake and the expected feed intake of the individual. Wherein the average daily gain is expressed by the formula ADG i ＝(FBW i -IBW i ) Calculated by N, FBW i Is the experimental end-stage weight, IBW, of Hu sheep individual i i Is the initial body weight of the individual i, N is the number of days of the test; whereas the average metaphase body weight is represented by the formula MBW i ＝[1/2(FBW i +IBW i )] 0.75 Calculated (Zhang Xiaoxue. Different residual feed intake lamb production Performance and rumen microflora and liver transcriptome study [ D)]University of lanzhou, 2019.).
In Table 1, RFI 100-120 represents the residual feed intake for 100-120 days; RFI 100-140 represents the residual feed intake of 100-140 days; RFI 100-160 represents the residual feed intake of 100-160 days; RFI100-180 represents the residual feed intake of 100-180 days.
FCR 100-120 represents feed conversion rate of 100-120 days; FCR 100-140 represents feed conversion rate of 100-140 days; FCR 100-160 represents feed conversion rate of 100-160 days; FCR 100-180 represents feed conversion of 100-180 days.
TABLE 1 analysis of ADCY8 gene polymorphism and feed conversion rate correlation in Hu sheep
Note that: the same row of data marked with different letters indicates that the difference is significant (P < 0.05), and the same or no letters indicate that the difference is not significant (P > 0.05).
The results show that the ADCY8 gene amplification sequence g.4816C > T mutation site is obviously related to the feed conversion rate of the Hu sheep along with the extension of the measurement period. The feed conversion rate of sheep carrying the TT genotype is better than that of sheep carrying the CC genotype (P < 0.05). From this, it was found that the T allele was the dominant allele. The mutant site C/T of the sequence shown in SEQ ID NO.1 at 486bp can be used as a molecular marker (P < 0.05) for influencing the feed conversion rate of Hu sheep. The method provides a detection technical means for identifying whether the sheep is a Hu sheep with high feed conversion rate in breeding.
Sequence listing
<110> Gansu Runmu bioengineering Limited liability company
<120> a molecular marker related to feed conversion rate of Hu sheep and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 889
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gcacaagtac caagactgac actgttgtct gggtctgttt cagctgctcg gtgaagaccg 60
gtttcaagac attgaaaaga ttaagaccat tggtagtacc tacatggccg tgtcaggcct 120
gtcacctgaa aagcaggtaa aggaatgctc tagactcgac cacaccctcc ggcagggacc 180
tcactgtggt tatgtcgctg aaggtgggag agtggtgggc tgtcagcgcc aggagacctg 240
gtgactggca gggagaaact ttgataagtg gaccttccag gtgtgtgatg tatttgttcc 300
ccatgtaagc aggatccact gggtgaaacg atgcttcttt atgattgaga cgcctttagg 360
cttcactctg aaactcactg ttcacttgat gtgcaaaatc aggaccgaga aataccaatt 420
atgagcgttt gctggtgttg ctaaacccat gatcccagcc tgttttctta ctcttacttt 480
tgtttyctcc tccaaaagtg atgataataa tagctccagt ttttaaaaat tgaaagtcag 540
actttaaaac attttttatg tatttatttt ttggctgcac tgggtcttcg ttgcagcatg 600
caggctttct ctccttatgt tgagtggggg catctcatta tggtggcttt tcttgttgtg 660
gagctcgggc tctagggcac gtgggctcag tagttgtggc tcctgggctc cagtattaat 720
agttttactt ttttgagagg tgattgtgtg ccaggcacta gtgttaagtg ggaaaaccaa 780
catctacccc ccaaggtcag tggatgaatt tacctgggat agagtcatgc tgcccgcaca 840
aagccctgcc catggtaggt cctcagtaaa tgctttctgg atatggacg 889
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
gcacaagtac caagactgac a 21
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
cgtccatatc cagaaagcat t 21
<210> 4
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
gaaggtgacc aagttcatgc ttattattat catcactttt ggaggagg 48
<210> 5
<211> 48
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
gaaggtcgga gtcaacggat tctattatta tcatcacttt tggaggag 48
<210> 6
<211> 27
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gatcccagcc tgttttctta ctcttac 27
Claims (10)
1. A molecular marker related to feed conversion rate of hu sheep, characterized in that the nucleotide sequence of the molecular marker is shown in SEQ ID No.1, wherein Y at 486 th bp of the sequence is C or T, and the mutation results in a C/T polymorphism of the molecular marker.
2. A pair of PCR primers for detecting the molecular marker of claim 1, comprising a forward primer having a nucleotide sequence shown in SEQ ID No.2 and a reverse primer shown in SEQ ID No. 3.
3. A KASPar primer pair for detecting the molecular marker of claim 1, wherein the KASPar primer pair comprises a forward primer A1 for detecting allec as shown in SEQ ID No.4, a forward primer A2 for detecting allet as shown in SEQ ID No.5, and a universal reverse primer C as shown in SEQ ID No. 6.
4. A kit for detecting the molecular marker of claim 1, wherein the kit comprises the primer pair of claim 2 or 3.
5. A method of detecting the molecular marker of claim 1, comprising the steps of:
a) Amplifying the Hu sheep genomic DNA using the primer pair of claim 2 or 3, or using the kit of claim 4;
b) Identifying the polymorphic site of the amplification product obtained in step a).
6. The method according to claim 5, wherein in step b), the method of identification is selected from the group consisting of sequencing, fluorescent probe, gene chip, high resolution dissolution profile.
7. The method according to claim 5, wherein the KASPar primer set according to claim 3 is used for PCR amplification, and after the amplification, the typing result is determined by detecting a fluorescent signal.
8. Use of the molecular marker of claim 1 or the primer pair of claim 2 or 3, or the kit of claim 4, or the method of any one of claims 5-7 in a hu sheep feed conversion rate assay.
9. Use of the molecular marker of claim 1 or the primer pair of claim 2 or 3, or the kit of claim 4, or the method of any one of claims 5-7 in a hu sheep breeding.
10. The use according to claim 9, wherein the breeding is breeding of Hu sheep with high feed conversion rate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210015613.7A CN114182026B (en) | 2022-01-07 | 2022-01-07 | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210015613.7A CN114182026B (en) | 2022-01-07 | 2022-01-07 | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114182026A CN114182026A (en) | 2022-03-15 |
| CN114182026B true CN114182026B (en) | 2023-07-25 |
Family
ID=80545621
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210015613.7A Active CN114182026B (en) | 2022-01-07 | 2022-01-07 | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114182026B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115181804B (en) * | 2022-06-10 | 2024-09-20 | 甘肃农业大学 | Molecular marker related to sheep growth traits, detection method and application thereof |
| CN115044682B (en) * | 2022-06-14 | 2024-08-30 | 兰州大学 | Molecular marker related to Hu sheep growth traits, detection method and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109554489A (en) * | 2019-01-25 | 2019-04-02 | 甘肃农业大学 | Molecular marker related to sheep feed conversion rate and application thereof |
| CN109694916A (en) * | 2019-01-08 | 2019-04-30 | 甘肃农业大学 | One kind molecular labeling relevant to sheep forage conversion ratio and its application |
| CN109913559A (en) * | 2019-03-28 | 2019-06-21 | 甘肃农业大学 | RYR2 gene is as the molecular labeling and its application for influencing sheep forage conversion ratio |
-
2022
- 2022-01-07 CN CN202210015613.7A patent/CN114182026B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109694916A (en) * | 2019-01-08 | 2019-04-30 | 甘肃农业大学 | One kind molecular labeling relevant to sheep forage conversion ratio and its application |
| CN109554489A (en) * | 2019-01-25 | 2019-04-02 | 甘肃农业大学 | Molecular marker related to sheep feed conversion rate and application thereof |
| CN109913559A (en) * | 2019-03-28 | 2019-06-21 | 甘肃农业大学 | RYR2 gene is as the molecular labeling and its application for influencing sheep forage conversion ratio |
Non-Patent Citations (2)
| Title |
|---|
| ＮＡＣ饲喂努比亚山羊对ＡＤＣＹ８、ＰＩＫ３Ｒ２基因在性腺轴组织表达水平研究;洪 磊等;《家畜生态学报》;第41卷(第8期);全文 * |
| Polymorphisms in ovine ME1 and CA1 genes and their association with feed efficiency in Hu sheep;DEyin Zhang等;《JOURNAL OF ANIMAL BREEDING AND GENETICS》;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114182026A (en) | 2022-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109694915B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN114182026B (en) | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN110643716B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN111926086A (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN115044682B (en) | Molecular marker related to Hu sheep growth traits, detection method and application thereof | |
| CN114959051B (en) | Molecular marker related to Hu sheep weight and application thereof | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN102260734A (en) | Method for rapidly detecting goat Six6 gene single nucleotide polymorphism and application thereof | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof | |
| CN114941035B (en) | Molecular marker related to sheep stage weight character and application thereof | |
| CN115074449B (en) | Molecular marker related to sheep tail fat deposition and application thereof | |
| CN115181804B (en) | Molecular marker related to sheep growth traits, detection method and application thereof | |
| CN115125309B (en) | Molecular marker related to sheep tail fat and application thereof | |
| CN116083604B (en) | SNP molecular marker affecting sheep weaning weight and application thereof | |
| CN116656831A (en) | Molecular marker for sheep residual feed intake, detection method and application thereof | |
| CN118064598A (en) | Primer for detecting molecular marker related to weight and application of primer | |
| CN117625803A (en) | SNP molecular marker affecting sheep stage weight and application thereof | |
| CN118685537A (en) | Molecular marker related to sheep tail fat deposition character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |