CN115074449B - Molecular marker related to sheep tail fat deposition and application thereof - Google Patents

Molecular marker related to sheep tail fat deposition and application thereof Download PDF

Info

Publication number
CN115074449B
CN115074449B CN202210743613.9A CN202210743613A CN115074449B CN 115074449 B CN115074449 B CN 115074449B CN 202210743613 A CN202210743613 A CN 202210743613A CN 115074449 B CN115074449 B CN 115074449B
Authority
CN
China
Prior art keywords
sheep
molecular marker
seq
fat deposition
primer pair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210743613.9A
Other languages
Chinese (zh)
Other versions
CN115074449A (en
Inventor
张小雪
马宗武
李发弟
王维民
张德印
李晓龙
赵源
张煜坤
林长春
王江荟
程江博
杨晓斌
黄永亮
崔盼盼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gansu Agricultural University
Original Assignee
Gansu Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gansu Agricultural University filed Critical Gansu Agricultural University
Priority to CN202210743613.9A priority Critical patent/CN115074449B/en
Publication of CN115074449A publication Critical patent/CN115074449A/en
Application granted granted Critical
Publication of CN115074449B publication Critical patent/CN115074449B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a molecular marker related to sheep tail fat deposition and application thereof. The invention discovers that an A/G polymorphic site exists at the 123 rd position of an amplified fragment by carrying out PCR amplification and sequence analysis on sheep RAP1GAP genes, further uses KASPar primer pair 1029 Hu sheep polymorphic sites to detect and establish a least squares model, carries out correlation analysis on genotypes and tail fat deposition, and finally determines that the amplified RAP1GAP gene fragment can be used as a molecular marker related to sheep tail fat deposition. According to the invention, through detecting the molecular marker, the sheep homozygous for AA can be selected to enter the core group for breeding, so that the sheep can be used for reducing fat deposition at the tail part of the sheep, and the economic benefit can be increased.

Description

Molecular marker related to sheep tail fat deposition and application thereof
Technical Field
The invention belongs to the technical field of molecular markers, and particularly relates to a RAP1GAP gene fragment serving as a molecular marker related to influence of sheep tail fat deposition and application thereof.
Background
Sheep, a common livestock, is an important production and living data in agricultural areas, and meat and wool products play a significant role in improving and enhancing local production and living. According to historical records, the wild ancestor of sheep is fine tailed sheep. Later, sheep with a fei-tail or a fei-hip (Moradi, nejati-Javaremi, moradi-Shahrbabak, dodds, & Mcewan, 2012) were bred by artificial selection. Sheep can be classified into five types according to their tail size: short-tailed sheep, long-tailed sheep, short-fat-tailed sheep, long-fat-tailed sheep and fat-buttock sheep. The tail fat of sheep provides sufficient energy to maintain the normal need for forage shortages in winter (Ermias, yami, & Rege,2002; kashan, azar, afzalzadeh, & Salehi, 2005). However, people would like to choose to purchase low fat mutton products to get a healthier diet. As a high fat diet can lead to increased incidence of cardiovascular disease, diabetes and bowel cancer. With commercial sheep farming, excessive deposition of tail fat limits the commercial value of mutton. It also reduces feed conversion rate and increases raising cost. In practice, it has been found that the mating conception rate of large tailsheep is lower than that of small tailsheep because the natural mating is hindered by the enlarged tail.
RAP1GAP (RAP 1 GTPase activating protein) is a protein coding gene, the first identified member of the GTPase Activating Protein (GAP) family (Frisch & Zwartkruis,2010; rubingfeld, munemitsu, clark, conroy, & Polakis, 1991), which is relatively well studied in human medicine. RAP1GAP inhibits extracellular signals of melanoma cells, regulating kinase activity, cell proliferation, survival and migration (Zheng et al, 2009). In vitro, overexpression of RAP1GAP impairs proliferation and enhances apoptosis of tumor cells (D "Silva et al, 2005; mitra et al, 2008;Tsygankova et al, 2007; zhang & l, 2006; zheng et al, 2009). Previous studies have found that overexpression of RAP1GAP reduces proliferation of rat thyroid cells (Tsygankova, feshchenko, klein, & Meinkoth, 2004). It is not clear whether the RAP1GAP gene is related to sheep tail fat.
The invention discusses the association between different genotypes and sheep tail fat deposition traits by sequencing and analyzing the RAP1GAP gene, and aims to provide gene materials for reducing the genetic improvement aspect of sheep tail fat deposition and accelerate the cultivation process of the novel variety of the small-tail high-quality mutton sheep with independent intellectual property.
Disclosure of Invention
In order to solve the technical problems, the invention provides a molecular marker related to sheep tail fat deposition and application thereof.
The molecular marker is amplified from sheep RAP1GAP gene, and its specific nucleotide sequence is shown in SEQ ID NO. 1. By amplifying the DNA sequence of the sheep RAP1GAP gene and sequencing, searching polymorphic sites of the RAP1GAP gene, analyzing the relativity of different genotypes and sheep tail fat deposition, thereby establishing a detection method of a molecular marker containing the polymorphic sites, and being capable of being applied to the cultivation of new varieties for reducing sheep tail fat deposition.
In order to achieve the above purpose, the invention adopts the following technical scheme:
In one aspect, the present invention provides a molecular marker related to sheep tail fat deposition, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein R at 123bp represents A or G, and the sequence has an A/G mutation at 123 base, so that the A/G polymorphism of sheep RAP1GAP gene at the site is caused.
In a second aspect, the invention provides a primer pair for detecting the molecular marker, which comprises a primer R-F and a primer R-R, wherein the sequence of the primer R-F is shown as SEQ ID NO.2, and the sequence of the primer R-R is shown as SEQ ID NO. 3.
In addition, the invention also provides a KASPar primer pair for detecting the molecular marker, preferably, the KASPar primer pair comprises a forward primer for detecting AlleleG, a forward primer for detecting AlleleA and a universal reverse primer, wherein the sequence of the forward primer for detecting AlleleG is shown as SEQ ID NO.4, the sequence of the forward primer for detecting AlleleA is shown as SEQ ID NO.5, and the sequence of the universal reverse primer is shown as SEQ ID NO. 6.
In a third aspect, the invention provides a detection kit for detecting the molecular marker, which comprises a primer pair or/and a KASPar primer pair for detecting the molecular marker.
In a fourth aspect, the present invention also provides a method for detecting a molecular marker related to sheep tail fat deposition, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and R at the 123bp position represents A or G, the method comprises detecting sheep genomic DNA by using the primer pair or the kit, and the specific detection method comprises the following steps:
1) Amplifying sheep genomic DNA using the primer pair, KASPar primer pair, or a kit comprising the primer pair;
2) And (3) carrying out typing identification on polymorphic sites of the amplification product obtained in the step (1).
Wherein, in the step 2), the method of typing identification includes, but is not limited to, a direct sequencing method, a fluorescent probe method, a gene chip method, a high resolution dissolution profile method.
Under the condition that the molecular marker sequence and the polymorphic site are known, designing a corresponding probe for the polymorphic site, and detecting the molecular marker and the polymorphic site by using the SNP typing method belong to the conventional and mature technology in the field, and the probe designed for the polymorphic site can be also contained in the kit of the third aspect of the invention.
More specifically, the method for detecting the molecular marker related to sheep tail fat deposition by using the primer pair comprises the following steps:
a) Extracting genome DNA by taking sheep blood as a sample, and carrying out PCR amplification on the genome DNA by utilizing primers shown in SEQ ID NO.2 and SEQ ID NO. 3;
b) Sequencing and sequence analysis are carried out on the PCR amplification products, so that the genotype is determined by the base type of the polymorphic site.
Furthermore, the invention relates to a method for detecting molecular markers associated with sheep tail fat deposition by using a KASPar primer pair, which comprises the following steps:
a) Extracting genome DNA from sheep blood serving as a sample, and performing high-throughput water bath PCR amplification by using a primer pair shown in SEQ ID No. 4-6;
b) After amplification, fluorescence signals were detected using BMG PHERAstar instrument and the typing results were checked.
According to the invention, the detection is carried out on the molecular marker by designing the KASPar primer required by competitive allele specific PCR (KASP), the detection method does not need to synthesize a specific fluorescent probe aiming at each SNP locus, and all locus detection is finally carried out by using a universal fluorescent primer based on the unique ARM PCR principle, so that the cost of reagents is greatly reduced, the accuracy is higher, and a simple, convenient, accurate and low-cost operation method is provided for the detection of the molecular marker.
In a fifth aspect, the invention provides an application of the detection method of the molecular marker, the PCR primer pair, the KASPar primer or the kit in sheep tail fat deposition property detection, wherein the detection method can determine the sheep tail fat deposition degree by detecting the molecular marker in genome DNA of sheep to be detected and analyzing the type of polymorphic sites, and then screening out sheep with small tails.
In a sixth aspect, the invention provides an application of the detection method of the molecular marker PCR primer pair, the KASPar primer or the kit in sheep breeding, and the primer pair or the kit is used for amplifying and detecting genome DNA of sheep to determine the genotype of the molecular marker of a sample to be detected, so that a small tail type sheep variety with less tail fat deposition can be bred.
Finding mutation sites of genes, finding the relationship between genes and traits through association analysis between the genes and the traits is an important means for researching gene functions and is also a basis for marker-assisted selection. The invention discovers that an A/G polymorphism site exists at the 123 rd position of an amplified fragment by carrying out PCR amplification and sequencing on RAP1GAP genes of sheep representing a hu sheep, and determines a molecular marker related to sheep tail fat deposition character by detecting 1029 hu sheep polymorphism and an established least squares model, and the molecular marker can be used for breeding small tail fat sheep, provides an effective genetic engineering means for sheep tail fat genetic improvement and has great practical application value.
The invention has the beneficial effects that:
the invention provides a molecular marker related to sheep tail fat deposition and a polymorphism site of A/G thereof, and the polymorphism genotype is detected to effectively identify whether the sheep is small tail fat type or not, so that an effective detection means is provided for breeding the small tail fat type sheep.
The molecular marker and the detection of the polymorphic locus can be used for selecting the sheep with the homozygous AA as the breeding source for breeding, so as to reduce the fat deposition in the tail and improve the economic benefit of sheep breeding industry.
Drawings
FIG. 1 is a gel electrophoresis diagram of sheep RAP1GAP gene fragment in example 1.
FIG. 2 shows the sequencing result of the mutation site of sheep RAP1GAP gene g.13561G > A in example 1.
FIG. 3 shows the result of KASPAR SNP typing of the RAP1GAP gene amplified fragment of sheep in example 1.
Detailed Description
The invention analyzes the relation between the mononucleotide polymorphism of the RAP1GAP gene of Hu sheep and the fat deposition character of tail. In addition, the expression level of the RAP1GAP gene in the tailfat of small tailed sheep and large tailed sheep was also studied. The invention can provide valuable molecular markers for sheep breeding.
The following examples serve to further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions made to the invention without departing from the spirit and nature of the invention are intended to be within the scope of the invention.
Unless otherwise indicated, all technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the present invention are of analytical purity or above.
EXAMPLE 1 amplification of the RAP1GAP Gene
A pair of primers was designed using oligo7.0 software using sheep RAP1GAP gene DNA (GenBank accession number: NC-040253.1) as a template: R-F and R-R, the primer sequences are as follows:
R-F(SEQ ID NO.2)：5’-CACTCCTCCCACCATCCGTTC-3’
R-R(SEQ ID NO.3)：5’-CCAGCCTCTCTCCTAGAAACC-3’
(2) Amplification and sequencing of the RAP1GAP Gene
The total volume of the PCR reaction was 35. Mu.L, including: 2X PCR MASTER Mix 17.5. Mu.L, 10. Mu. Mol/L of upstream primer R-F1. Mu.L, 10. Mu. Mol/L of downstream primer R-R1. Mu.L, 1.5. Mu.L of DNA template, and ddH 2 O14. Mu.L. Wherein the DNA template is sheep blood for extracting genome DNA.
The PCR amplification procedure was: pre-denaturation at 94℃for 3min, denaturation at 94℃for 30s, annealing at 58.5℃for 30s, extension at 72℃for 30s, cycling for 35 times, and extension at 72℃for 10min. .
The PCR amplification reaction products were detected by 1.5% agarose gel electrophoresis, and the results are shown in FIG. 1, in which lanes M: molecular weight 2000marker lanes 1-10: RAP1GAP gene amplification results. Sequencing the amplified PCR fragment, wherein the nucleotide sequence of the amplified fragment is shown as SEQ ID NO.1, and 937bp is added, wherein a polymorphic site exists in the fragment, specifically R at the 123bp site is A or G, namely the amplified RAP1GAP gene fragment (SEQ ID NO. 1) has A/G polymorphism at the 123bp site (see figure 2).
Wherein, SEQ ID NO.1:
CACTCCTCCCACCATCCGTTCCCAGGGCCTAGGGACCCTCCAGGAGACTCCCTTTCCAGGAGCTCAGGGTTAGCAGCATCTTAGGTTTGGGTGGGTGCAGCTTGGCTAGAAGGGCCATGAGCRAAGGATGCTTTGAACCTATGAAATTCTCTCAAGGCAAATGTGTTTTTCCGTGATTATGTCTCTAGTCCAGCAAAGTGAGAGTGATGAGTCAACGGAGACCGAGAGAGGAAAACTGGTTAACATGGGAGGCTGCCTGGCCAGGCAGGAAGCCCAGCACTGCCCTGCCCCCTGCTCAGGATACCGCCCCCGCCACCTGCCCCCAGCAGATAACCTGAATGGGAATGACAGGGGGCAGGGAAAGCATGGAAGGTCACTGGGGATCCACTGGGTTTCCCCAGGGGCTTAGATGGTAAGGAATCTATCTGCAATGCAGGAGACTGCAGTTCGATCCCTGGGATAGGAAGATGCCCTGGGGGAGGGCATGGCAGCCCACTCCAGTATTCTTGCCTGGAGAATCCCAGAGACAGAGGAGCCCAGCGGGCTATGGCCCACAGGGTCACATAGGATCGGATGTGCAACTAACGCTAAGCCTAGCTGGCGAGAATCGGCCCCACGAGCCCCATCTGGAACCCAGGCTCTTCTCTTCCCAGGAGGCTGCCCCTCCCCGGGGCCCTCAGGTGTCCCTGTGGAGTGTTGGGAAGGCAGCACTGGAGGCAGGGGGTGGGACTTTCAGGGTTCAGCCCGGGGTGAACTTGGAGAGGGAGCTCTGCGTCCCGCCACCCCTGTCTGCTTTCCTCCTCCTTCACACTGTCTGGCACCTGTTTGAACAACTCGGGTGCAAAATCAGGGTGGCCCAGAAGAGGAGGCTTCTTCTGAGAAGGAGGGCCTGGTCCCTGGAGGGCAGCCTGGCTCTGGTTTCTAGGAGAGAGGCTGG.DNA Sequence homology search identification:
The DNA sequence obtained after sequencing was compared for sequence homology with known physiological functional genes published in GenBank database by BLAST (Basic Local ALIGNMENT SEARCH Tool) software of the national center for Biotechnology information (NCBI, national Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) website to identify and obtain functional information of the DNA sequence. The search result shows that the homology of the sequence to the partial sequence of sheep RAP1GAP gene DNA (GenBank accession number: NC_ 040253.1) is 99%.
Example 2 establishment of genotyping assay
1. Primer sequence design
A KASPar primer pair is designed for the G/A polymorphic site of the amplified fragment in example 1, so as to be used for specific detection of the polymorphic site, and the nucleotide sequence of the KASPar primer pair after optimization is designed is as follows:
the forward primer A1 for detection AlleleG is shown in SEQ ID NO.4, wherein:
SEQ ID NO.4：GAAGGTGACCAAGTTCATGCTGAATTTCATAGGTTCAAAGCATCCTTC；
the forward primer A2 for detecting AlleleA is shown as SEQ ID NO.5,
SEQ ID NO.5：GAAGGTCGGAGTCAACGGATTAGAATTTCATAGGTTCAAAGCATCCTTT；
The general reverse primer C is shown as SEQ ID NO.6,
SEQ ID NO.6：TGGGTGCAGCTTGGCTAGAAGG。
The primers were synthesized by Beijing Biotechnology Co. Each set of primers in the KASPar primer pair was diluted to 10. Mu. Mol/L and mixed in a volume ratio of 12:12:30 (primer A1: primer A2: primer C) for further use.
2. Extracted genome DNA and quality control
The extraction of genomic DNA from sheep blood can be performed using a DNA extraction kit. The quality detection of the extracted genome DNA is carried out, 1% agarose electrophoresis and Nanodrop2100 are adopted for detection respectively, and the qualified DNA requires: (1) Agarose electrophoresis showed a single DNA band without significant diffusion. (2) Nanodrop2100 detection a260/280 is between 1.8-2.0; a260/230 is between 1.8 and 2.0; there is no significant light absorption at 270 nm. And according to KASPar detection technology and genome size of LGC company in UK, the dosage of DNA is 10-20 ng/sample, and the diluted concentration of extracted genome DNA is 10-20 ng/mu L as DNA template for standby.
3. Genotyping
Firstly, a K-pette liquid-separating workstation is used for respectively adding 1.5 mu L of diluted DNA template to be detected (10-20 ng/muL) and blank control (No template control, NTC, sterilized water is adopted) into 384-hole reaction plates, and drying is carried out for 30min at 60 ℃ (a drying oven, LGC company) so that the DNA is changed into dry powder for standby.
Each of the above KASPar primer pairs was diluted to 10. Mu. Mol/L and was prepared as described for primer A1: a2: and C, uniformly mixing the mixture according to the volume ratio of 12:12:30 to obtain a primer mixture for later use.
And then adding a mixed solution of 1 XMaster Mix (1536 microwell plates, product number: part No. KBS-1016-011) and a primer into each reaction well by using a Meridian sample adding workstation under Kraken operation system, putting the microwell plates on a Kube heat sealing instrument and a Fusion laser membrane sealing instrument in sequence for membrane sealing after Mix split charging, and carrying out high-flux water bath PCR amplification by using Hydrocyler. The PCR reaction was performed in a high throughput water bath system Hydrocycler, with the following specific procedures:
Pre-denaturation at 94 ℃ for 15 min;
94 ℃,20 seconds (denaturation) -61 ℃ -55 ℃,1 minute (renaturation & extension), 10 cycles of amplification in the touchdown order, 0.6 ℃ decrease per cycle;
amplification was continued for 26 cycles at 94℃for 20 seconds (denaturation) -55℃for 60 seconds.
After amplification, a BMG PHERAstar instrument is used for detecting fluorescent signals and checking the parting condition, and the specific result is shown in fig. 3. Wherein each dot in the figure represents a piece of material to be tested, wherein the red dot near the left side indicates that the locus is homozygous for genotype "AA"; the green dot near the middle indicates that the locus is heterozygous genotype "AG" or "GA"; blue dots near the right indicate that the locus is homozygous genotype "GG"; the black dots indicate NTC (not shown in fig. 3), i.e. water as a control.
4. Application of molecular marker in sheep tail fat deposition correlation analysis
The polymorphism of 1029 Hu sheep is detected in the experiment, the genotype of the Hu sheep is determined, a least squares model is established as described below, and the correlation analysis of the genotype and the growth character is carried out.
Yijk＝μ+Genotypei+Pj+Sk+εijk
Wherein Y ijk is the observed value of tail fat deposition, mu is the overall average, genotype i is the genotype effect, P j is the batch effect, S k is the seasonal effect, ε ijk is the random error, and ε ijk are assumed to be independent of each other and follow the N (0, σ2) distribution.
Genotype detection results showed 218 of the 1029 individuals with GG genotype, 521 of the AG genotype and 290 of the AA genotype. The results of genotype-trait association analysis are shown in Table 1.
TABLE 1 sheep RAP1GAP gene polymorphism and tail fat deposition correlation analysis
Note that: the different letters of the subscript between the same row of data indicate significant differences (P < 0.05), and the same letter or no letter indicates insignificant differences (P > 0.05).
The results show that the G/A polymorphic site of the amplified fragment SEQ ID NO.1 is significantly associated with ovine tail fat deposition. The deposition of tail fat is smaller in sheep carrying the AA genotype than in sheep carrying the GG genotype (P < 0.05). From this, the A allele was found to be the dominant allele. Indicating that the RAP1GAP g.13561G > A mutation site can be used as a potential molecular marker (P < 0.05) for affecting sheep tail fat deposition. During breeding, AA genotype is selected for seed conservation, so that fat deposition in sheep tails can be reduced, and dominant sheep flocks with less tail fat deposition can be obtained.
Sequence listing
<110> Gansu agricultural university
<120> A molecular marker related to sheep tail fat deposition and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 937
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 1
cactcctccc accatccgtt cccagggcct agggaccctc caggagactc cctttccagg 60
agctcagggt tagcagcatc ttaggtttgg gtgggtgcag cttggctaga agggccatga 120
gcraaggatg ctttgaacct atgaaattct ctcaaggcaa atgtgttttt ccgtgattat 180
gtctctagtc cagcaaagtg agagtgatga gtcaacggag accgagagag gaaaactggt 240
taacatggga ggctgcctgg ccaggcagga agcccagcac tgccctgccc cctgctcagg 300
ataccgcccc cgccacctgc ccccagcaga taacctgaat gggaatgaca gggggcaggg 360
aaagcatgga aggtcactgg ggatccactg ggtttcccca ggggcttaga tggtaaggaa 420
tctatctgca atgcaggaga ctgcagttcg atccctggga taggaagatg ccctggggga 480
gggcatggca gcccactcca gtattcttgc ctggagaatc ccagagacag aggagcccag 540
cgggctatgg cccacagggt cacataggat cggatgtgca actaacgcta agcctagctg 600
gcgagaatcg gccccacgag ccccatctgg aacccaggct cttctcttcc caggaggctg 660
cccctccccg gggccctcag gtgtccctgt ggagtgttgg gaaggcagca ctggaggcag 720
ggggtgggac tttcagggtt cagcccgggg tgaacttgga gagggagctc tgcgtcccgc 780
cacccctgtc tgctttcctc ctccttcaca ctgtctggca cctgtttgaa caactcgggt 840
gcaaaatcag ggtggcccag aagaggaggc ttcttctgag aaggagggcc tggtccctgg 900
agggcagcct ggctctggtt tctaggagag aggctgg 937
<210> 2
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 2
cactcctccc accatccgtt c 21
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 3
ccagcctctc tcctagaaac c 21
<210> 4
<211> 48
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 4
gaaggtgacc aagttcatgc tgaatttcat aggttcaaag catccttc 48
<210> 5
<211> 49
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 5
gaaggtcgga gtcaacggat tagaatttca taggttcaaa gcatccttt 49
<210> 6
<211> 22
<212> DNA
<213> Artificial sequence (ARTIFICIAL SEQUENCE)
<400> 6
tgggtgcagc ttggctagaa gg 22

Claims (9)

1. Use of a molecular marker associated with sheep tail fat deposition in sheep breeding, the nucleotide sequence of the molecular marker being shown in SEQ ID No.1, wherein R at 123bp represents a or G, the mutation resulting in a/G polymorphism of the molecular marker, wherein tail fat deposition of sheep carrying the AA genotype is significantly smaller than that of sheep carrying the GG genotype.
2. The application of the primer pair for detecting the molecular marker related to sheep tail fat deposition in sheep breeding is characterized in that the primer pair comprises a primer R-F and a primer R-R, wherein the sequence of the primer R-F is shown as SEQ ID NO.2, and the sequence of the primer R-R is shown as SEQ ID NO. 3; the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein R at 123bp represents A or G, and the mutation leads to the A/G polymorphism of the molecular marker, and the nucleotide sequence is characterized in that the tail fat deposition of sheep carrying the AA genotype is obviously smaller than that of sheep carrying the GG genotype.
3. Use of a KASPar primer pair for detecting a molecular marker associated with sheep tail fat deposition in sheep breeding, characterized in that the KASPar primer pair comprises a forward primer for detecting AlleleG, a forward primer for detecting AlleleA and a universal reverse primer, wherein the sequence of the forward primer for detecting AlleleG is shown as SEQ ID No.4, the sequence of the forward primer for detecting AlleleA is shown as SEQ ID No.5, and the sequence of the universal reverse primer is shown as SEQ ID No. 6; the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein R at 123bp represents A or G, and the mutation leads to the A/G polymorphism of the molecular marker, and the nucleotide sequence is characterized in that the tail fat deposition of sheep carrying the AA genotype is obviously smaller than that of sheep carrying the GG genotype.
4. The application of the detection kit for detecting the molecular marker related to sheep tail fat deposition in sheep breeding is characterized by comprising a primer pair with a nucleotide sequence shown as SEQ ID NO.2-3 or/and a KASPar primer pair with a nucleotide sequence shown as SEQ ID NO. 4-6; the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein R at 123bp represents A or G, and the mutation leads to the A/G polymorphism of the molecular marker, and the nucleotide sequence is characterized in that the tail fat deposition of sheep carrying the AA genotype is obviously smaller than that of sheep carrying the GG genotype.
5. Use of a method for detecting a molecular marker associated with sheep tail fat deposition in sheep breeding comprising the steps of:
1) Amplifying sheep genome DNA by using a primer pair with nucleotide sequences shown as SEQ ID NO.2-3 or a KASPar primer pair with nucleotide sequences shown as SEQ ID NO.4-6, or a kit containing the PCR primer pair or the KASPar primer pair;
2) Carrying out typing identification on specific sites of A or G represented by R at 123bp shown in SEQ ID NO.1 in the nucleotide sequence of the amplification product obtained in the step 1); the deposition of tail fat of sheep carrying the AA genotype is significantly smaller than that of sheep carrying the GG genotype.
6. The method according to claim 5, wherein the typing method in step 2) is a sequencing method, a gene chip method, a fluorescent probe method or a high resolution dissolution profile method.
7. The use according to claim 5, wherein the KASPar primer pair according to claim 3 is used for PCR amplification, and after amplification, the typing result is determined by detecting a fluorescent signal.
8. Use of a molecular marker or a primer pair having a nucleotide sequence shown in SEQ ID No.2-3 or a KASPar primer pair having a nucleotide sequence shown in SEQ ID No.4-6, or a kit comprising the aforementioned primer pair or KASPar primer pair, or a method for detecting a molecular marker associated with sheep tail fat deposition in sheep tail fat deposition trait detection, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID No.1, wherein R at 123bp represents a or G, the mutation resulting in a/G polymorphism of the molecular marker, wherein tail fat deposition of sheep carrying the AA genotype is significantly smaller than sheep carrying the GG genotype.
9. Use according to any one of claims 1 to 7 in sheep breeding for the purpose of selecting small tail sheep.
CN202210743613.9A 2022-06-27 2022-06-27 Molecular marker related to sheep tail fat deposition and application thereof Active CN115074449B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210743613.9A CN115074449B (en) 2022-06-27 2022-06-27 Molecular marker related to sheep tail fat deposition and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210743613.9A CN115074449B (en) 2022-06-27 2022-06-27 Molecular marker related to sheep tail fat deposition and application thereof

Publications (2)

Publication Number Publication Date
CN115074449A CN115074449A (en) 2022-09-20
CN115074449B true CN115074449B (en) 2024-08-16

Family

ID=83256121

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210743613.9A Active CN115074449B (en) 2022-06-27 2022-06-27 Molecular marker related to sheep tail fat deposition and application thereof

Country Status (1)

Country Link
CN (1) CN115074449B (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109694915B (en) * 2019-01-08 2022-03-25 甘肃农业大学 Molecular marker related to sheep tail fat weight and application thereof
CN110643716B (en) * 2019-10-18 2023-05-02 甘肃润牧生物工程有限责任公司 Molecular marker related to sheep tail fat weight and application thereof
CN112921104B (en) * 2020-11-23 2022-11-01 扬州大学 Variable shear marker for assisting in selecting weight of sheep tail fat, detection primer and application thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
rs402539262;佚名;《ensembl》;20220429;第1页 *

Also Published As

Publication number Publication date
CN115074449A (en) 2022-09-20

Similar Documents

Publication Publication Date Title
CN109694915B (en) Molecular marker related to sheep tail fat weight and application thereof
CN112251518B (en) Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof
CN113502335B (en) Molecular marker related to sheep growth traits and application thereof
CN110643716B (en) Molecular marker related to sheep tail fat weight and application thereof
CN114182026B (en) Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker
CN115029444A (en) Molecular marker related to sheep growth traits and application thereof
CN106947826B (en) Method for detecting single nucleotide polymorphism of cattle SERPINA3 gene and application thereof
CN117821607A (en) Molecular marker related to Hu sheep growth traits and application of molecular marker in breeding
CN115044682B (en) Molecular marker related to Hu sheep growth traits, detection method and application thereof
CN112921101A (en) Molecular marker related to sheep remaining feed intake and application thereof
CN115074449B (en) Molecular marker related to sheep tail fat deposition and application thereof
CN114959052B (en) Molecular marker related to Hu sheep body ruler and application thereof
CN114959051B (en) Molecular marker related to Hu sheep weight and application thereof
CN115109856A (en) Molecular marker related to sheep stage body weight, detection method and application thereof
CN115992251A (en) Molecular marker related to Hu sheep growth traits and application thereof
CN116083592A (en) Molecular marker related to sheep growth traits and application thereof
CN115772573A (en) Molecular marker related to sheep body size character, detection method and application thereof
CN115181804B (en) Molecular marker related to sheep growth traits, detection method and application thereof
CN115125309B (en) Molecular marker related to sheep tail fat and application thereof
CN114941035B (en) Molecular marker related to sheep stage weight character and application thereof
CN116334233A (en) Molecular marker related to sheep tail fat deposition, detection method and application thereof
CN110592237A (en) Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province
CN114717336B (en) Molecular marker related to sheep viscera weight and application thereof
CN116254348A (en) Molecular marker related to sheep growth traits, detection method and application thereof
CN118685537A (en) Molecular marker related to sheep tail fat deposition character and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant