CN112921101A - Molecular marker related to sheep remaining feed intake and application thereof - Google Patents
Molecular marker related to sheep remaining feed intake and application thereof Download PDFInfo
- Publication number
- CN112921101A CN112921101A CN202110206714.8A CN202110206714A CN112921101A CN 112921101 A CN112921101 A CN 112921101A CN 202110206714 A CN202110206714 A CN 202110206714A CN 112921101 A CN112921101 A CN 112921101A
- Authority
- CN
- China
- Prior art keywords
- sheep
- molecular marker
- gene
- detecting
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a molecular marker related to the remaining feed intake of sheep and application thereof. According to the invention, PCR amplification and sequence analysis are carried out on the sheep ME1 gene, a C/T polymorphic site is found to exist at the 453 th site of an amplified fragment, a KASPar primer pair is further used for detecting the corresponding polymorphic site and establishing a least square model, and correlation analysis is carried out on the genotype and the residual feed intake of 507 Hu sheep, so that the existence of a molecular marker related to the residual feed intake of sheep in the amplified ME1 gene fragment is determined. In breeding practice, TT homozygous sheep can be selected to enter a core group, and the reduction of feed consumption and breeding cost is facilitated by reducing the residual feed intake.
Description
Technical Field
The invention relates to molecular marker-assisted selection of a new mutton sheep variety, in particular to the typing detection of a Single Nucleotide Polymorphism (SNP) site of an ME1 gene and the application of the SNP site as a molecular marker influencing the remaining feed intake of sheep.
Background
In the production practice of mutton sheep, the cost of forage accounts for 65-70% of the total cost, so that the improvement of the feed efficiency has important significance for economy and environmental protection. The Residual Feed Intake (RFI) is the difference between the actual feed intake of the livestock and the expected feed intake calculated according to the production performance (body weight gain, milk production, egg production, etc.) and the standard of maintaining the body weight (Koch, R.M., et al, Efficiency of feed in term of animal skill Sci.1963,22(2): 486-. RFI reflects the difference of feed utilization efficiency caused by the metabolism difference determined by the genetic background of the livestock and poultry, and is independent of the body size and the production performance of the livestock and poultry, even the properties such as slaughter performance, meat quality and the like, and the body weight gain of the livestock and poultry is considered in the calculation process and the metabolic weight of the livestock and poultry is corrected. While genetic improvement of RFI does not adversely affect or has little impact on growth and production traits, it is one of the incomparable advantages of FCR. Therefore, RFI is a breeding index for accurately evaluating the efficiency of feed utilization. Finding out the variation site of gene and the relation between gene and character through correlation analysis with character is one important means of researching gene function and is also the basis for marker assisted selection.
Malic enzyme 1(Malic enzyme 1, ME1) belongs to a member of Malic enzyme (Malic enzyme) family, and the coding gene is ME1, which plays an important role in the synthesis of endogenous fatty acid, and its expression is closely related to the synthesis efficiency of fatty acid. Guan et al found that ME1 Gene may act as or be linked with major Gene to affect Growth characteristics of chicken (Hong-Ying, GUAN, et al. correlation Analysis Between Single-Nucleotide Polymorphism of Chicken Dehydrogene Gene 5' -flying Region and Growth and Body Composition mutations in Chiken. acta genetic Sinica, 2006.). ME1 is also involved in energy metabolism of skeletal and cardiac muscles in vivo (Gibala M J, Young M E, Taegtmeye H. Anaplerosis of the citric acid cycle: role in energy metabolism of heart and muscle muscles [ J ]. Acta Physiologica Scandinavica,2010,168(4): 657-. At present, the research on the ME1 gene mainly focuses on the fat deposition aspect, and the residual food consumption belongs to medium heritability and is influenced by factors such as basal metabolism, nutrient digestion and metabolism, energy output, body activity, body temperature regulation and the like. Other literature reports also include Chinese patent CN104862411A, which discloses a molecular marker closely linked with the hot pepper root knot nematode resistant gene Me1, and SSR primers and application thereof.
KASP is an abbreviation for competitive Allele Specific PCR (Kompetitive Allle Specific PCR), and the KASP detection technique does not require the synthesis of a Specific fluorescent probe for each SNP site, but rather allows all site detections to be eventually amplified using universal fluorescent primers based on the ARM PCR principle.
At present, reports of sequencing and analyzing the ME1 gene and researching the correlation between different genotypes of the ME1 gene and the residual feed intake of sheep are not found.
Disclosure of Invention
The invention aims to provide a molecular marker related to the remaining feed intake of sheep and application thereof. Through amplifying and sequencing the DNA sequence of the sheep ME1 gene, the polymorphic site of the ME1 gene is searched, and the relevance of different genotypes of the polymorphic site and the sheep residual feed intake is discussed, so that the detection method of the molecular marker related to the sheep residual feed intake can be established.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a molecular marker associated with sheep remaining feed, which marker is located in intron 13 (specifically 206265bp) of sheep ME1 gene (GenBank accession No.: NC-040259.1 of reference sequence) and can be obtained by amplifying sheep ME1 gene, and specifically, which marker is located in 453 of sheep ME1 gene fragment with a nucleotide sequence shown in SEQ. ID. NO.1, wherein Y represents C or T, that is, the above sequence has a C/T mutation at 453 base, thereby resulting in C/T polymorphism of sheep ME1 gene at the corresponding site.
In a second aspect, the present invention provides a primer for detecting a molecular marker associated with sheep remaining feed intake, any primer (e.g., PCR primer pair) that specifically amplifies the above-mentioned sheep ME1 gene fragment or other homologous fragment containing the polymorphic site (i.e., position 453 of seq. id No.1) contained in the fragment (e.g., KASPar primer pair) is suitable for detecting the molecular marker.
Preferably, the nucleotide sequence of the PCR primer pair of the sheep ME1 gene fragment is:
an upstream primer M-F: 5 '-GAACCTAGACTGGCTATTCGT-3' (SEQ. ID. NO. 2);
the downstream primer M-R: 5 '-ATCAAGCAGAACTACCGACCA-3' (SEQ. ID. NO. 3).
Preferably, the nucleotide sequence of the KASPar primer pair is:
forward primer F1 for detection of allele C:
5＇-GAAGGTGACCAAGTTCATGCTACAAACACACAAAAAAACTTCCTCTCAG-3＇(SEQ.ID.NO.4)；
forward primer F2 for detection of allele T:
5＇-GAAGGTCGGAGTCAACGGATTAAACAAACACACAAAAAAACTTCCTCTCAA-3＇(SEQ.ID.NO.5)；
a universal reverse primer R: 5 '-CTTGATGGGAAGGGAGGGTTTGAAATT-3' (SEQ. ID. NO. 6).
In a third aspect, the invention provides a kit for detecting a molecular marker related to the remaining feed intake of sheep, which comprises the above-mentioned primers for detecting a molecular marker related to the remaining feed intake of sheep, such as a PCR primer pair and a KASPar primer pair.
In a fourth aspect, the invention provides a method for detecting a molecular marker related to the remaining feed intake of sheep, which comprises the following steps:
1) amplifying an ME1 gene fragment containing the polymorphic site by using sheep genome DNA as a template;
2) typing and identifying the corresponding polymorphic sites of the amplification products obtained in the step 1).
Any method for SNP typing can be used for typing, including but not limited to direct sequencing, probe method, gene chip method, high resolution melting curve method, and other methods (for example, KASP detection technology) capable of detecting the polymorphic sites where known molecular markers are located.
Preferably, the method for detecting the molecular marker related to the remaining feed intake of the sheep specifically comprises the following steps:
1.1) extracting genome DNA (deoxyribonucleic acid) as a template by taking sheep individual blood as a sample, and amplifying by using PCR (polymerase chain reaction) primer pairs shown in SEQ.ID.NO.2 and SEQ.ID.NO. 3;
1.2) sequencing and sequence analyzing the amplified product, thereby determining the genotype of the sheep individual through analyzing the obtained base type of the polymorphic site.
Preferably, the method for detecting the molecular marker related to the remaining feed intake of the sheep specifically comprises the following steps:
2.1) taking sheep individual blood as a sample to extract genome DNA as a template, and carrying out high-flux water bath PCR amplification by using a KASPar primer pair shown in SEQ. ID. NO. 4-6;
2.2) after the amplification is finished, detecting a fluorescence signal and checking the genotyping result of the sheep individual at the polymorphic site.
In a fifth aspect, the invention provides an application of the detection primer, the kit or the detection method of the molecular marker in detection of sheep remaining feed, wherein the ME1 gene of a sheep to be detected is amplified and detected, and the genotype of the polymorphic site is analyzed, so that the sheep with low remaining feed can be determined, and then the sheep with low remaining feed (for example, the sheep with the polymorphic site of the TT genotype) can be screened out.
In a sixth aspect, the invention provides an application of the detection primer, the kit or the detection method of the molecular marker in sheep breeding, wherein the ME1 gene is amplified and detected to determine the genotype of a corresponding polymorphic site of a sheep to be detected, so that a sheep population with low residual feed intake can be bred (for example, a sheep homozygous for TT is selected to enter a core population, and the reduction of the feed consumption and the breeding cost is facilitated by reducing the residual feed intake of the sheep), so as to accelerate the breeding process of sheep varieties.
Preferably, the breeding is the breeding of grain-saving sheep varieties.
The invention has the beneficial effects that:
experiments show that a C/T polymorphic site (discovered by PCR amplification and sequencing) existing at the 453 th site of a sheep ME1 gene fragment has a molecular marker related to the remaining feed intake of sheep (discovered by detecting the polymorphism of 507 Hu sheep and an established least square model), and the molecular marker provides an effective genetic engineering means for genetic improvement of sheep feed efficiency, can be used for breeding grain-saving sheep and breeding new varieties of grain-saving high-quality mutton sheep, and has significant practical application value.
Furthermore, the invention designs the KASPar primer pair to carry out molecular marker detection, thereby obviously reducing the cost of the reagent and simultaneously keeping the accuracy of the gold standard of the Taqman probe, thereby providing a simple, convenient, accurate and low-cost operation method for the detection of the molecular marker.
Drawings
FIG. 1 is a gel electrophoresis diagram of a PCR product of a fragment of the sheep ME1 gene containing a molecular marker in an example of the present invention; wherein, lane M: DL 2000Marker, lanes 1-10: ME1 gene amplification results.
FIG. 2 shows the sequencing result of g.453C > T of the mutation site of sheep ME1 gene in the example of the present invention.
FIG. 3 shows the result of KASPar SNP typing of the mutation site (g.453C > T) of sheep ME1 gene in example of the present invention; where the red dots near the left represent the TT genotype, the green dots near the middle represent the TC genotype, and the blue dots near the right represent the CC genotype.
Detailed Description
The invention is described in further detail below with reference to the figures and examples, which are provided for illustration only and are not intended to limit the scope of the invention as claimed.
(I) amplification of ME1 Gene
(1) Primer design
With reference to sheep ME1 gene DNA (GenBank accession No.: NC-040259.1), a pair of primers M-F and M-R were designed using Oligo7.0 software, and the primer sequences were as follows:
M-F：5＇-GAACCTAGACTGGCTATTCGT-3＇(SEQ.ID.NO.2)
M-R：5＇-ATCAAGCAGAACTACCGACCA-3＇(SEQ.ID.NO.3)
(2) amplification and sequencing of the ME1 Gene
The total volume of the PCR reaction system is 25 mu L: genomic DNA template 1. mu.L, 2 XPCR Master Mix 12.4. mu.L, forward primer M-F0.8. mu.L (10. mu.M), reverse primer M-R0.8. mu.L (10. mu.M), and ddH2O 10μL。
PCR amplification procedure: pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 54.5 ℃ for 30s, extension at 72 ℃ for 30s, and circulation for 35 times; finally, extension is carried out for 10min at 72 ℃.
The PCR reaction product was detected by 1.5% agarose gel electrophoresis, and the result showed that 575bp specific amplified fragment was obtained (FIG. 1). The amplified product fragment is sequenced, and the sequencing result shows that the primer can be used for amplifying a 575bp DNA fragment from the sheep ME1 gene, the sequence information can refer to the nucleotide sequence (SEQ. ID. NO.1) shown in the specification, and a polymorphic site exists in the fragment (namely the amplified ME1 gene fragment has C/T polymorphism at a 453bp site; FIG. 2).
5＇-GAACCTAGACTGGCTATTCGTTTCTTATATGATATTATACATGTTTCAATGCCATTCTCCCAAATCATCCCACCCTCTCCCTCTCCCACAGAGTCTTTATAACTTTAATTTTTCAGAAATGCATAATTTTACATTGAGAAGAGATAGTTAATCATTCTACTATTATTCAAAGTCACACGTATTCAAATAAGTTTGTCATACAAACAGCTCTTTAAGGATTGCATTCTTAAAAAACTGGAGTGAATTAAAGAGCACATGTGGAGTGATTAATTTTGACAGTGGAATCTGTTTTTCTCAACACAGGGAAGGAGAGAATGTCAAGACATGGAGGAGATAGTTTGAGATGATGAAAAGAGAAATTGAGATAGTTTTCTCCGATTAGTTGGAATTTTCTCAGCAAAGTGAAGAGAATCAAATTGGTACTTGATGGGAAGGGAGGGTTTGAAATTGACYTGAGAGGAAGTTTTTTTGTGTGTTTGTTTTTGAGTTTTAAAGAATAAAAGCATCATGTGTAACCATGGGGGCCCAAGTAAGGTTAGGAAAAGTGTGACATGTCAAGCGACAACTATGAAAGG-3＇
DNA sequence homology search identification:
the DNA sequence obtained after sequencing (SEQ. ID. NO.1) was compared with the sequence of a gene published in the GenBank database by BLAST (basic Local Alignment Search tool) software of the website of the National Center for Biotechnology Information (NCBI, National Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) and showed 99% sequence homology to a portion of the DNA of the sheep ME1 gene (GenBank accession No. NC-040259.1).
(II) establishment of genotyping detection method
(1) Primer sequence design
Designing a KASPar primer pair against the C/T polymorphic site of the amplified fragment of (A) for specific detection of said polymorphic site, said KASPar primer pair having the nucleotide sequence:
forward primer F1 for detecting allee C:
5＇-GAAGGTGACCAAGTTCATGCTACAAACACACAAAAAAACTTCCTCTCAG(SEQ.ID.NO.4)-3＇
forward primer F2 for detecting allee T:
5＇-GAAGGTCGGAGTCAACGGATTAAACAAACACACAAAAAAACTTCCTCTCAA-3＇(SEQ.ID.NO.5)
a universal reverse primer R: 5 '-CTTGATGGGAAGGGAGGGTTTGAAATT-3' (SEQ. ID. NO.6)
The primers are synthesized by Beijing Biotechnology Co., Ltd, and each primer in the KASPar primer pair is diluted to 10 μmol/L and mixed uniformly according to the volume ratio of 12:12:30 (primer F1: primer F2: primer R) for later use.
(2) DNA quality control
The quality of the extracted genome DNA is detected by 1% agarose electrophoresis and Nanodrop2100 respectively, and the qualified DNA requirements are as follows: agarose electrophoresis showed that the DNA band was single and not dispersed significantly; the Nanodrop2100 detects A260/280 between 1.8 and 2.0 (DNA sample is not polluted by protein); a260/230 is between 1.8 and 2.0 (the concentration of salt ions in the DNA sample is low); no significant light absorption at 270nm (DNA samples without phenol contamination) was observed. According to KASP detection technology and genome size of LGC company in England, the amount of genome DNA is converted into 10-20 ng/sample, and the diluted DNA concentration is 10-20 ng/mu L, which is used as a DNA template for standby.
(3) Genotyping
Firstly, 1.5 muL of diluted DNA template (10-20 ng/muL) to be detected and blank control (NTC, namely water control) are respectively added into a 384-hole reaction plate by using a K-pette liquid separation workstation, and the DNA is dried for 30min at 60 ℃ (a drying box, LGC company) to become dry powder for later use. Then under a Kraken operating system, 1 xMaster Mix (1536 micro plate with the product number of Part No. KBS-1016-. The specific procedure for carrying out the PCR reaction in the Hydrocycler high-throughput water bath system was:
1) pre-denaturation at 94 ℃ for 15 min;
2) amplification in touch down sequence for 10 cycles of 94 ℃ at 20 seconds (denaturation) -61 ℃ to 55 ℃ for 1 minute (renaturation & extension), 0.6 ℃ reduction per cycle;
3) amplification was continued for 26 cycles at 94 ℃ for 20 seconds (denaturation) to 55 ℃ for 60 seconds.
After amplification is finished, detecting a fluorescence signal by using a BMG PHERAStar instrument and checking the typing condition, wherein the specific result is shown in figure 3, each dot in figure 3 represents a sample to be detected, and a red dot close to the left side represents that the site is a homozygous genotype TT (T: T); the blue dots near the right indicate that the locus is homozygous genotype "CC" (C: C); the green dots near the middle indicate that the locus is a heterozygous genotype "TC" or "CT" (T: C); the black dots represent NTCs (not shown in fig. 3).
Correlation analysis of (III) mutation site ME1g.453C > T polymorphism and sheep residual feed intake
The test detects the polymorphism of 507 Hu sheep (the test sheep are raised in Defu agriculture science and technology Limited company in Ministry county in 2019 from 5 months to 12 months, and blood samples are collected after 180 days of raising test), determines the genotype, establishes the following least square model, and performs the correlation analysis of the genotype and the residual feed intake.
Yijkl＝μ+Genotypei+Pj+Fk+Ml+εijkl
Wherein, YijklIs an observed value of the remaining feed intake, mu is the overall mean, GenotypeiFor genotype effects, PjFor batch effect, FkFor the paternal effect, MlIs a maternal effect,. epsilonijklFor random errors, assume εijklIndependently of each other, obey an N (0, σ 2) distribution.
In the invention, the predicted feed intake of sheep is calculated according to the actual daily feed intake (AFI) of test sheep, the Average Daily Gain (ADG) and the average middle-term metabolic weight (MBW) multiple regression model, wherein the ADG and the MBW are used as fixed effects, and the calculation method is based on the regression model constructed by the heavy waves (the heavy waves, the production performance and the body composition of different RFI fattening lambs and the digestive metabolism research, Lanzhou, Gansu agricultural university, 2016), and the concrete model is as follows:
ADG＝(BW180-BW80)/N，MBW＝[1/2×(BW180+BW80)]0.75，Yi＝β0+β1(ADGi)+β2(MBWi)+ei
wherein ADG is average daily gain and MBW is average metaphase metabolic body weight (W)0.75)，BW80For testing initial body weight, BW180For final body weight test, N is days of rearing, YiRepresents the actual dry matter intake, beta, of animal i0Representing the regression intercept, beta1、β2Is a fixed value, beta1Indicates the degree of influence of ADG on food intake,. beta.2It indicates the degree of influence of MBW on food intake. e.g. of the typeiRandom error of animal i, i.e. RFI-actual intake-predicted intake。
According to the genotype detection result, there were 12 TT genotypes, 182 TC genotypes and 313 CC genotypes in 507 individuals. The results of genotype and trait association analysis are shown in table 1, and the results show that the mutation site me1g.453c > T is significantly related to the remaining feed intake of the Hu sheep as the measurement period is prolonged. Wherein the remaining feed intake of individuals with CC genotype is significantly higher than that of individuals with TT genotype (P < 0.05); the residual feed intake of TC individuals is lower than that of CC individuals and higher than that of TT individuals, but the difference is not significant (P > 0.05).
TABLE 1 correlation analysis of sheep ME1 Gene polymorphism with remaining feed intake
Note: the data in the same row with different corner symbols represent significant difference (P <0.05), and the data with the same letter represents insignificant difference
The results show that as the T allele factor increases, the remaining food consumption of the corresponding individual decreases, and thus the T allele is known to be the dominant allele. The TT genotype of the mutation site ME1g.453C > T can be used as a potential molecular marker for influencing the remaining feed intake of sheep (such as Hu sheep).
In a word, the DNA sequence of the sheep ME1 gene is amplified and sequenced to find a polymorphic site (specifically, a mutation site g.453C > T) on the ME1 gene, and the method can be applied to the cultivation of new varieties of grain-saving high-quality mutton sheep by detecting molecular markers related to the residual feed intake of sheep.
<110> university of agriculture in Gansu province
<120> molecular marker related to sheep remaining feed intake and application thereof
<160> 6
<210> 1
<211> 575
<212> DNA
<213> Ovis aries
<400> 1
gaacctagac tggctattcg tttcttatat gatattatac atgtttcaat gccattctcc 60
caaatcatcc caccctctcc ctctcccaca gagtctttat aactttaatt tttcagaaat 120
gcataatttt acattgagaa gagatagtta atcattctac tattattcaa agtcacacgt 180
attcaaataa gtttgtcata caaacagctc tttaaggatt gcattcttaa aaaactggag 240
tgaattaaag agcacatgtg gagtgattaa ttttgacagt ggaatctgtt tttctcaaca 300
cagggaagga gagaatgtca agacatggag gagatagttt gagatgatga aaagagaaat 360
tgagatagtt ttctccgatt agttggaatt ttctcagcaa agtgaagaga atcaaattgg 420
tacttgatgg gaagggaggg tttgaaattg acytgagagg aagttttttt gtgtgtttgt 480
ttttgagttt taaagaataa aagcatcatg tgtaaccatg ggggcccaag taaggttagg 540
aaaagtgtga catgtcaagc gacaactatg aaagg 575
<210> 2
<211> 21
<212> DNA
<213> M-F
<400> 2
gaacctagac tggctattcg t 21
<210> 3
<211> 21
<212> DNA
<213> M-R
<400> 3
atcaagcaga actaccgacc a 21
<210> 4
<211> 49
<212> DNA
<213> F1
<400> 4
gaaggtgacc aagttcatgc tacaaacaca caaaaaaact tcctctcag 49
<210> 5
<211> 51
<212> DNA
<213> F2
<400> 5
gaaggtcgga gtcaacggat taaacaaaca cacaaaaaaa cttcctctca a 51
<210> 6
<211> 27
<212> DNA
<213> R
<400> 6
cttgatggga agggagggtt tgaaatt 27
Claims (10)
1. A PCR primer pair for detecting molecular markers is characterized in that: the fragment amplified by the PCR primer pair comprises a molecular marker site related to the sheep residual feed, and the molecular marker is positioned at the C/T mutation site of the sheep ME1 gene.
2. The PCR primer set for detecting molecular markers according to claim 1, wherein: in the PCR primer pair, the nucleotide sequence of the upstream primer is shown as SEQ.ID.NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ.ID.NO. 3.
3. A KASPar primer pair for detecting molecular markers is characterized in that: the fragment amplified by the KASPar primer pair comprises a molecular marker site related to the residual feed intake of sheep, and the molecular marker is positioned at the C/T mutation site of the sheep ME1 gene.
4. The KASPar primer pair for detecting molecular markers of claim 3, wherein: in the KASPar primer pair, the nucleotide sequence of the forward primer for detecting the allele C is shown as SEQ.ID.NO.4, the nucleotide sequence of the forward primer for detecting the allele T is shown as SEQ.ID.NO.5, and the nucleotide sequence of the universal reverse primer is shown as SEQ.ID.NO. 6.
5. A kit for detecting a molecular marker, comprising: the kit comprises the primer pair of claim 1 or 3, or any one of a primer which can specifically amplify a sheep ME1 gene fragment with the nucleotide sequence shown in SEQ ID No.1 and a primer which can specifically amplify other fragments which are homologous with the sheep ME1 gene fragment and contain the C/T mutation site contained in the sheep ME1 gene fragment.
6. A method of detecting a molecular marker, comprising: the method comprises the following steps:
1) amplifying an ME1 gene segment by taking sheep genome DNA as a template;
2) typing and identifying the molecular marker sites of the amplification products obtained in the step 1), wherein the molecular markers are positioned at the C/T mutation sites of the sheep ME1 gene.
7. The method of claim 6, wherein the step of detecting the molecular marker comprises: the method specifically comprises the following steps: the PCR primer pair of claim 1 is used for amplification, and sequencing and sequence analysis are carried out on an amplification product to obtain the base type of the mutation site.
8. The method of claim 6, wherein the step of detecting the molecular marker comprises: the method specifically comprises the following steps: the KASPar primer pair of claim 3 is used for PCR amplification, and the typing result of the mutation site is determined by a fluorescent signal after the amplification is finished.
9. The application of a molecular marker related to the remaining feed intake of sheep in the detection of the remaining feed intake of sheep or sheep breeding is characterized in that: the molecular marker is positioned at the C/T mutation site of the sheep ME1 gene.
10. Use of a primer pair according to any one of claims 1 to 4 or a kit according to claim 5 or a method according to any one of claims 6 to 8 for the detection of sheep residual feed intake or sheep breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110206714.8A CN112921101A (en) | 2021-02-24 | 2021-02-24 | Molecular marker related to sheep remaining feed intake and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110206714.8A CN112921101A (en) | 2021-02-24 | 2021-02-24 | Molecular marker related to sheep remaining feed intake and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112921101A true CN112921101A (en) | 2021-06-08 |
Family
ID=76171608
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110206714.8A Pending CN112921101A (en) | 2021-02-24 | 2021-02-24 | Molecular marker related to sheep remaining feed intake and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112921101A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113502335A (en) * | 2021-07-08 | 2021-10-15 | 甘肃农业大学 | Molecular marker related to sheep growth traits and application thereof |
| CN114742290A (en) * | 2022-03-30 | 2022-07-12 | 东北农业大学 | Method for predicting conversion efficiency of white feather broiler feed through plasma metabolite abundance modeling |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667279A (en) * | 2013-12-30 | 2014-03-26 | 华中农业大学 | Molecular marker of gene Resistin related to average daily gain of pigs and application of molecular marker |
-
2021
- 2021-02-24 CN CN202110206714.8A patent/CN112921101A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667279A (en) * | 2013-12-30 | 2014-03-26 | 华中农业大学 | Molecular marker of gene Resistin related to average daily gain of pigs and application of molecular marker |
Non-Patent Citations (2)
| Title |
|---|
| M. BARTZ等: "Transcript level of the porcine ME1 gene is affected by SNP in its 3′UTR, which is also associated with subcutaneous fat thickness", 《J ANIM BREED GENET》 * |
| ZHANG, D等: "Polymorphisms in ovine ME1 and CA1 genes and their association with feed efficiency in Hu sheep", 《J ANIM BREED GENET》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113502335A (en) * | 2021-07-08 | 2021-10-15 | 甘肃农业大学 | Molecular marker related to sheep growth traits and application thereof |
| CN113502335B (en) * | 2021-07-08 | 2023-07-21 | 甘肃润牧生物工程有限责任公司 | Molecular marker related to sheep growth traits and application thereof |
| CN114742290A (en) * | 2022-03-30 | 2022-07-12 | 东北农业大学 | Method for predicting conversion efficiency of white feather broiler feed through plasma metabolite abundance modeling |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107475412B (en) | Molecular marker related to egg-laying traits of chickens and application of molecular marker in chicken breeding | |
| CN109694915B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN109694916B (en) | Molecular marker related to sheep feed conversion rate and application thereof | |
| Naqvi | Application of molecular genetic technologies in livestock production: potentials for developing countries | |
| CN105969845B (en) | The molecular labeling of eye muscle area character related gene SVEP1 and its application | |
| CN109913559B (en) | RYR2 gene as molecular marker influencing sheep feed conversion rate and application thereof | |
| CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN113502335A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN107475413B (en) | Method for screening crassostrea gigas parent shellfish with high content of unsaturated fatty acid C20:3 omega 6 | |
| CN110643716B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN109652560B (en) | Genetic marker related to yak milk quality and application thereof | |
| CN111154892A (en) | Primer pair, kit, method and application for detecting sheep BMPR1B gene insertion/deletion polymorphism | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof | |
| CN105543362B (en) | Detection method and molecular breeding method for single nucleotide polymorphism of cattle PPAR β gene | |
| CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
| CN115181805A (en) | Molecular marker related to yellow degree of leg skin of yellow-feathered broilers and application of molecular marker | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN114959052A (en) | Molecular marker related to Hu sheep physique and application thereof | |
| CN111154891B (en) | Primer pair, kit, method and application for detecting sheep IGF2BP1 gene insertion/deletion polymorphism | |
| WO2021207992A1 (en) | Dezhou donkey's multi-thoracic vertebral trait-related snp site detection kit and use method thereof | |
| CN113913530A (en) | Molecular marker related to sheep body height and application thereof | |
| CN111850139B (en) | Molecular marker located on pig chromosome 12 and related to formation of pig monocrchidism and application | |
| CN109161601B (en) | Method for auxiliary rapid detection of cattle growth traits by using SNP marker of PLAGL1 gene and application thereof | |
| CN108841933B (en) | Detection method of single nucleotide polymorphism sites of cattle RET gene, detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20210608 |
|
| RJ01 | Rejection of invention patent application after publication |