CN115181804A - Molecular marker related to sheep growth traits, detection method and application thereof - Google Patents
Molecular marker related to sheep growth traits, detection method and application thereof Download PDFInfo
- Publication number
- CN115181804A CN115181804A CN202210655356.3A CN202210655356A CN115181804A CN 115181804 A CN115181804 A CN 115181804A CN 202210655356 A CN202210655356 A CN 202210655356A CN 115181804 A CN115181804 A CN 115181804A
- Authority
- CN
- China
- Prior art keywords
- sheep
- molecular marker
- primer pair
- seq
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a molecular marker related to sheep growth traits, and a detection method and application thereof. According to the invention, PCR amplification and sequence analysis are carried out on the sheep ALB gene, an A/T polymorphic site is found to exist at the 558 th site of an amplified fragment, a KASPar primer is further used for detecting the polymorphic site of 1271 sheep and establishing a least square model, correlation analysis is carried out on the genotype and the growth character, and finally it is determined that the amplified ALB gene fragment can be used as a molecular marker related to the average daily gain of sheep. The invention can be used for selecting and reserving the TT homozygotic sheep to enter the core group as the breeding sheep by detecting the molecular marker, so as to improve the growth characteristics of the sheep and be beneficial to increasing the economic benefit.
Description
Technical Field
The invention belongs to the technical field of molecular markers, and particularly relates to an ALB gene fragment serving as a molecular marker influencing sheep growth traits, and a detection method and application thereof.
Background
Albumin (ALB) is the most abundant circulating protein that acts as a carrier protein for a variety of endogenous molecules, including fatty acids, hormones, and metabolites. In humans, several studies have shown that ALB levels are negatively correlated with body fat percentage (Chang, xu, ferrant, & Krakoff, 2019), a reduced maternal serum ALB ratio in late gestation will affect the birth weight of a pregnant woman, and there is a positive correlation (Wada et al, 2021). In addition, there is a report that the duck ALB gene is strongly negatively associated with FCR and RFI. However, it is unclear whether or not ALB is associated with, or has some relationship with, sheep growth traits.
The sheep industry is an important component of modern animal husbandry, can be used as a production raw material of wool spinning industry, and improves the economic income of people. With the general improvement of living standard of people, mutton is popular due to low cholesterol, lean meat, high nutrition and tenderness (Hehua et al, 2020).
The invention discusses the relevance of different genotypes of the ALB gene and sheep growth traits by sequencing and analyzing the ALB gene, and aims to provide gene materials for improving the genetic improvement aspect of the sheep growth traits and accelerate the breeding process of high-quality mutton sheep.
Disclosure of Invention
In order to solve the technical problems, the invention provides a molecular marker related to sheep growth traits and application thereof. The molecular marker is obtained by amplifying sheep ALB gene, and the specific nucleotide sequence of the molecular marker is shown as SEQ ID NO. 1. The DNA sequence of the sheep ALB gene is amplified and sequenced, the polymorphic site of the ALB gene is searched, the correlation between different genotypes and sheep growth traits is analyzed, a detection method of a molecular marker containing the polymorphic site is established, and the molecular marker can be applied to the cultivation of a novel high-quality new mutton sheep variety.
In order to achieve the purpose, the invention adopts the following technical scheme that:
a molecular marker related to sheep growth traits, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein W at position 558bp represents A or T, and the A/T polymorphism of sheep ALB gene at the position is caused due to the fact that the sequence has an A/T mutation at base 558.
The results of the genotype and character association analysis show that the ALB g.8699A > T mutation site is significantly related to the Average Daily Gain (ADG) of the sheep along with the extension of the determination period. The average daily gain of the sheep carrying the TT genotype is more important than that of the sheep carrying the TA or AA genotype (P is less than 0.05), so that the TT is known to be the dominant genotype.
Preferably, the primer pair for detecting the molecular marker comprises a sequence with a nucleotide sequence shown as SEQ ID NO.2 and SEQ ID NO. 3.
A KASPar primer pair for detecting the molecular marker comprises a forward primer 1 with a nucleotide sequence shown as SEQ ID NO.4, a forward primer 2 shown as SEQ ID NO.5 and a universal reverse primer C shown as SEQ ID NO. 6.
A kit for detecting the above molecular marker, said kit comprising a PCR primer pair or KASPar primer pair for detecting the above molecular marker.
A method for detecting a molecular marker related to sheep growth traits, wherein the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein W at the 558bp position represents A or T, the method comprises the step of detecting sheep genomic DNA by using the primer pair or the kit, and the specific detection method comprises the following steps:
a) Amplifying the sheep genome DNA by using the primer pair, the KASPar primer pair or the kit containing the primer pair;
b) Identifying the polymorphic sites of the amplification product obtained in step a).
In step b), the typing and identification methods include, but are not limited to, direct sequencing, probe, gene chip, and high resolution melting curve.
The method for detecting the molecular marker related to the sheep growth traits by using the primer pair comprises the following steps:
a) Extracting genome DNA by taking sheep blood as a sample, and performing high-flux water bath PCR amplification by using a primer pair with a nucleotide sequence shown as SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6;
b) After the amplification is finished, a BMG PHERAstar instrument is used for detecting a fluorescence signal and checking a typing result.
The molecular marker and the detection method of the polymorphic site, the primer pair or the kit thereof are applied to the detection of the growth traits of the sheep, and the molecular marker is detected in the genomic DNA of the sheep to be detected, and the type of the polymorphic site is analyzed, so that the growth traits of the sheep can be determined, and the fast-growing sheep can be screened.
The molecular marker and the detection method of the polymorphic site, the primer pair or the kit thereof are applied to sheep breeding, and the primer pair or the kit is used for amplifying and detecting sheep genomic DNA to determine the genotype of the ALB gene of a sample to be detected, so that a fast-growing sheep variety can be bred from the genotype.
Finding out the variation site of gene and the relation between gene and character through correlation analysis with character is one important means of researching gene function and is also the basis for marker assisted selection.
The invention discovers that an A/T polymorphic site exists at the 558 th site of an amplified fragment by carrying out PCR amplification and sequencing on the ALB gene of a representative sheep Hu sheep variety, and determines a molecular marker related to the growth character of the sheep by detecting 1271 Hu sheep polymorphism and establishing a least square model.
The invention detects the molecular marker by designing KASPar primers required by competitive allele specific PCR (KASP), and the detection method does not need to synthesize a specific fluorescent probe aiming at each SNP site, but is based on the unique ARM PCR principle, so that all site detection is finally amplified by using a universal fluorescent primer, the cost of the reagent is greatly reduced, and the invention has higher accuracy, and provides a simple, convenient, accurate and low-cost operation method for the detection of the molecular marker.
The invention has the beneficial effects that:
the invention provides molecular markers related to sheep growth traits and polymorphic sites of A/T thereof, and effectively identifies whether the sheep is a fast-growing sheep or not by determining the genotype of the polymorphism, thereby providing an effective detection means for the breeding of the fast-growing sheep. The invention can be used for breeding sheep with TT homozygous sheep as breeding sheep by detecting molecular markers and polymorphism sites, so as to improve the growth characteristics of sheep and contribute to improving the economic benefit of the breeding industry.
Drawings
FIG. 1 is a gel electrophoresis diagram of a sheep ALB gene fragment used as a molecular marker in the invention; wherein, lane M: DL 2000Marker, lanes 1-10: ALB gene amplification results.
FIG. 2 shows the sequencing result of the sheep ALB gene mutation site.
FIG. 3 shows the typing result of KASPar SNP at g.8699A > T mutation site of sheep ALB gene in the invention; where the red dots near the left indicate TT genotype, the green dots near the middle indicate TA genotype, and the blue dots near the right indicate AA genotype.
Detailed Description
The following examples are intended to further illustrate the invention but are not to be construed as limiting the invention. Modifications and substitutions may be made thereto without departing from the spirit and scope of the invention.
Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art, and unless otherwise specified, the reagents used in the methods are analytically pure or above.
Example 1 amplification of ALB Gene
A pair of primers is designed by using sheep ALB gene DNA (GenBank accession number: NC-040257.1) as a template and utilizing Oligo7.0 software: a forward primer and a reverse primer, wherein the primer sequences are as follows:
forward primer (SEQ ID No. 2): 5'-TTCATAGCAGGCATATTGGT-3'
Reverse primer (SEQ ID NO. 3): 5'-TCTAGAGCATCTGCCACAA-3'
(2) Amplification and sequencing of ALB Gene
Carrying out PCR amplification on the genomic DNA extracted from the sheep whole blood cells as a DNA template, wherein the total volume of the amplification reaction is 25 mu L, the DNA template is 1 mu L, the 2 XPCR Master Mix is 12.4 mu L, the forward primer is 0.8 mu L (the concentration is 10 mu mol/L), the reverse primer is 0.8 mu L (the concentration is 10 mu mol/L), and ddH 2 O10. Mu.L. PCR amplification reaction conditions: pre-denaturation at 94 ℃ for 3min, denaturation at 94 ℃ for 30s, annealing at 54.5 ℃ for 30s, extension at 72 ℃ for 30s, circulation for 35 times, and final extension at 72 ℃ for 10min.
The PCR amplification reaction product was detected by 1.5% agarose gel electrophoresis, and the result is shown in FIG. 1, which indicated that 603bp specific amplified fragment was obtained. Sequencing the PCR fragment obtained by amplification, wherein the sequencing result shows that the specific nucleotide sequence of the amplified fragment is shown as SEQ ID NO.1, wherein a polymorphic site exists in the fragment, particularly W at the 558bp site is A or T, namely, the A/T polymorphism exists at the 558bp site of the amplified ALB gene fragment (SEQ ID NO. 1) (see figure 2).
Wherein, SEQ ID NO.1:
TAGTTCTGTCTGTGCCTCTAGGCTTAGCAGCACGGGTTGAAAATCTTCATAGCAGGCATATTGGTACAAGTATGGTCTTAGAGCACAATGAATGTGTTCTGTCGACATAGTAAATGTCTGGGGAGGAAGCACAGGAATGTCACTTTACAGTGAACACTTTTCACCTACTTGCTTGTAGGCAGATCTTGCCAAGTACATATGTGATCATCAAGACGCACTCTCCAGTAAACTGAAGGAATGCTGTGATAAGCCTGTGTTGGAAAAATCCCACTGCATTGCTGAGGTAGATAAAGATGCCGTGCCTGAAAACCTGCCCCCATTAACTGCTGACTTTGCTGAAGATAAGGAGGTTTGCAAAAACTATCAGGAAGCAAAAGACGTCTTCCTGGGCTCGTAAGTGGATAAAAAATGATCCTTTCATACTTTTATATGATCTCAGAATTTAGGAAATTATTCTAGGCTTTCCTTTGGAATTGCTACAATTTTTCACGTTGCCTGCAATGTTTCTTTATTCTTTCCTCTTCTGGCCGTTAAACATTTTTGGAAAAATTGCTTTTWAAAAATTGTCATAAAATAATACATGCTTGTGGCAGATGCTCTAGA。
DNA sequence homology search identification:
the DNA sequence obtained after sequencing was subjected to sequence homology comparison with known physiologically functional genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software of the website of the National Center for Biotechnology Information (NCBI, national Center for Biotechnology Information, http:// www.ncbi.nlm.nih.gov) to identify and obtain functional Information of the DNA sequence. The search result shows that the homology of the sequenced sequence and the sheep ALB gene DNA (GenBank accession number: NC-040257.1) is 99 percent.
Example 2 establishment of genotyping detection method
1) Primer sequence design
Designing KASPar primer pairs for the A/T polymorphic sites of the amplified fragments in example 1 for the specific detection of the polymorphic sites, the nucleotide sequences of the designed KASPar primer pairs are as follows:
forward primer A1 (SEQ ID NO. 4) for detecting AlleX:
5’-GAAGGTGACCAAGTTCATGCTCCGTTAAACATTTTTGGAAAAA TTGCTTTTA-3’；
forward primer A2 (SEQ ID NO. 5) for detecting AlleY:
5’-GAAGGTCGGAGTCAACGGATTCCGTTAAACATTTTTGGAAAAA TTGCTTTTT-3’；
general reverse primer C (SEQ ID NO. 6): 5'-GCATCTGCCACAAGCATGTATT ATTTTATG-3'.
The above primers were synthesized by Beijing Biotechnology Ltd. Each primer set of the KASPar primer pair was diluted to 10. Mu. Mol/L and the primers A1: and (3) primer A2: and mixing the primers C in a volume ratio of 12.
2) DNA quality control
The extraction of genomic DNA from sheep whole blood can be carried out by using a DNA extraction kit. And (3) performing quality detection on the extracted genome DNA, and respectively detecting by adopting 1% agarose electrophoresis and Nanodrop2100, wherein the qualified DNA requirements are as follows: (1) Agarose electrophoresis showed a single DNA band with no apparent dispersion. (2) Nanodrop2100 detects that A260/280 is between 1.8 and 2.0; a260/230 is between 1.8 and 2.0; 270nm had no significant light absorption. The amount of DNA used was calculated to be 10 to 20 ng/sample in accordance with KASPar detection technique and genome size of LGC company in England, and the extracted genomic DNA was diluted to a concentration of 10 to 20 ng/. Mu.L for use as a DNA template.
3) Genotyping
Firstly, 1.5uL of diluted DNA template (10-20 ng/. Mu.L) to be detected and blank control (No template control, NTC, adopting sterile water) are respectively added into a 384-hole reaction plate by using a K-pette liquid separating workstation, and the DNA is dried for 30min at 60 ℃ (a drying box, LGC company), so that the DNA becomes dry powder for standby.
Each primer of the above KASPar primer pair was diluted to 10. Mu. Mol/L and the primer set was adjusted according to primer A1: a2: and C, uniformly mixing the mixture as a primer mixture according to the volume ratio of 12.
Then under a Kraken operating system, a Meridian sample adding workstation is utilized to respectively add 1 × Master Mix (1536 micro-porous plate, the product number: part No. KBS-1016-011) and a primer mixed solution into each reaction hole, the micro-porous plates are sequentially placed on a Kube heat sealing instrument and a Fusion laser film sealing instrument for film sealing after the Mix split charging is finished, and the high-throughput water bath PCR amplification is carried out by utilizing a Hydrocycler. The PCR reaction is carried out in a high-flux water bath system Hydrocycler, and the specific procedures are as follows:
pre-denaturation at 94 ℃ for 15 min;
amplification in touch down sequence for 10 cycles of 94 ℃ at 20 seconds (denaturation) -61 ℃ to 55 ℃ for 1 minute (renaturation & extension), 0.6 ℃ reduction per cycle;
amplification was continued for 26 cycles at 94 ℃ for 20 seconds (denaturation) to 55 ℃ for 60 seconds.
After the amplification is finished, a BMG PHERAstar instrument is used for detecting a fluorescence signal and checking the typing condition, and the specific result is shown in figure 3. Each dot in the figure represents a portion of the material to be tested, with the red dot near the left indicating that the locus is of the homozygous genotype "TT"; the blue dots near the right indicate that the locus is homozygous genotype "AA"; the green circle near the middle indicates that the locus is a heterozygous genotype "TA" or "AT"; the black dots represent NTC (not shown in FIG. 3), which is a blank control.
4) Application of molecular marker in sheep growth trait association analysis
The test detects the polymorphism of 1271 Hu sheep, determines the genotype, establishes a least square model as described below and performs correlation analysis on the genotype and the growth traits.
Y ijk ＝μ+Genotype i +P j +F k +M l +ε ijkl Wherein, Y ijk Is a phenotypic observation of growth traits, mu is the mean population, genotype i For genotype effects, P j For batch effect, F k For the paternal effect, M l Is a maternal effect,. Epsilon ijkl For random errors, assume ε ijkl Independent of each other, obey N (0, sigma) 2 ) And (4) distribution.
The genotype test results show that in 1271 individuals, 418 AA genotypes, 642 genotypes of TA and 211 genotypes of TT are available. The results of the genotype-trait association analysis are shown in table 1, where ADG represents the average daily gain in kg. ADG80-100 represents average daily sheep weight gain of 80-100 scales; ADG80-120 represents average daily sheep weight gain on a scale of 80-120; ADG80-140 represents average daily sheep 80-140 weight gain; ADG80-160 represents average daily sheep weight gain on a balance of 80-160; ADG80-180 indicates average daily weight gain of sheep 80-180.
TABLE 1 Association analysis of ALB gene polymorphism and growth traits of Hu sheep
Note: p <0.05 indicates significant difference.
The results show that the ALB g.8699A > T mutation site is significantly related to the average daily gain of the Hu sheep as the measurement period is prolonged. The staged daily increase of sheep carrying TT genotype is better than that of sheep carrying TA genotype (P < 0.05). From this, it is known that the T allele is a dominant allele. During breeding, TT genotype is selected for breed conservation, and during breeding, TT genotype is taken as a breeding sheep to be hybridized with other sheep. Especially, artificial insemination is performed by adopting the sperm of the TT genotype stud ram, so that the breeding efficiency can be greatly improved, and the ram flock with the advantage of growth speed can be obtained.
Sequence listing
<110> university of agriculture in Gansu province
<120> molecular marker related to sheep growth traits, and detection method and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 603
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tagttctgtc tgtgcctcta ggcttagcag cacgggttga aaatcttcat agcaggcata 60
ttggtacaag tatggtctta gagcacaatg aatgtgttct gtcgacatag taaatgtctg 120
gggaggaagc acaggaatgt cactttacag tgaacacttt tcacctactt gcttgtaggc 180
agatcttgcc aagtacatat gtgatcatca agacgcactc tccagtaaac tgaaggaatg 240
ctgtgataag cctgtgttgg aaaaatccca ctgcattgct gaggtagata aagatgccgt 300
gcctgaaaac ctgcccccat taactgctga ctttgctgaa gataaggagg tttgcaaaaa 360
ctatcaggaa gcaaaagacg tcttcctggg ctcgtaagtg gataaaaaat gatcctttca 420
tacttttata tgatctcaga atttaggaaa ttattctagg ctttcctttg gaattgctac 480
aatttttcac gttgcctgca atgtttcttt attctttcct cttctggccg ttaaacattt 540
ttggaaaaat tgcttttwaa aaattgtcat aaaataatac atgcttgtgg cagatgctct 600
aga 603
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ttcatagcag gcatattggt 20
<210> 3
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tctagagcat ctgccacaa 19
<210> 4
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gaaggtgacc aagttcatgc tccgttaaac atttttggaa aaattgcttt ta 52
<210> 5
<211> 52
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gaaggtcgga gtcaacggat tccgttaaac atttttggaa aaattgcttt tt 52
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gcatctgcca caagcatgta ttattttatg 30
Claims (10)
1. A molecular marker related to sheep growth traits is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, wherein W at 558bp represents A or T, and the mutation causes the A/T polymorphism of the molecular marker.
2. A PCR primer pair for detecting the molecular marker of claim 1, which comprises sequences shown as SEQ ID NO.2 and SEQ ID NO. 3.
3. A KASPar primer pair for detecting the molecular marker of claim 1, wherein the KASPar primer pair comprises a forward primer 1 with a nucleotide sequence shown in SEQ ID No.4, a forward primer 2 with a nucleotide sequence shown in SEQ ID No.5 and a universal reverse primer C with a nucleotide sequence shown in SEQ ID No. 6.
4. A kit for detecting the molecular marker of claim 1, comprising the PCR primer pair of claim 2 or the KASPar primer pair of claim 3.
5. A method of detecting the molecular marker of claim 1, comprising the steps of:
a) Amplifying sheep genomic DNA using the PCR primer pair of claim 2 or the KASPar primer pair of claim 3, or using the kit of claim 4;
b) Typing and identifying the polymorphic sites of the amplification products obtained in the step a).
6. The method according to claim 5, wherein the typing in step b) is a sequencing method, a fluorescent probe method, a gene chip method or a high resolution melting curve method.
7. The method of claim 5, wherein the KASPar primer pair of claim 3 is used for PCR amplification, and after amplification is complete, the typing result is determined by detecting a fluorescent signal.
8. Use of a molecular marker and its polymorphic site as defined in claim 1, or a primer pair as defined in claim 2 or 3, or a kit as defined in claim 4, or a method as defined in any one of claims 5 to 7 for the detection of a growth trait in sheep.
9. Use of a molecular marker as claimed in claim 1 and its polymorphic site, or a primer pair as claimed in claim 2 or 3, or a kit as claimed in claim 4, or a method as claimed in any one of claims 5 to 7 in sheep breeding.
10. Use according to claim 9, for breeding purposes in order to sort out fast-growing sheep.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210655356.3A CN115181804A (en) | 2022-06-10 | 2022-06-10 | Molecular marker related to sheep growth traits, detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210655356.3A CN115181804A (en) | 2022-06-10 | 2022-06-10 | Molecular marker related to sheep growth traits, detection method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115181804A true CN115181804A (en) | 2022-10-14 |
Family
ID=83512828
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210655356.3A Pending CN115181804A (en) | 2022-06-10 | 2022-06-10 | Molecular marker related to sheep growth traits, detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115181804A (en) |
-
2022
- 2022-06-10 CN CN202210655356.3A patent/CN115181804A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109694915B (en) | Molecular marker related to sheep tail fat weight and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN105969879B (en) | Primer group for high-throughput detection of AhFAD2A gene mutation site typing and detection method | |
| CN111647649B (en) | Method for assisted selection of cattle growth traits based on CCDC39 gene CNV detection | |
| CN111172295B (en) | Method for detecting cow VAMP7 gene CNV marker and special kit | |
| CN115141889A (en) | SNP marker related to Chinese southern Holstein cow milk production traits and application thereof | |
| CN113502335B (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN115029444A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN110541041A (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| CN111926086B (en) | Molecular marker influencing oblique growth of chicken body and application thereof | |
| CN112921101A (en) | Molecular marker related to sheep remaining feed intake and application thereof | |
| CN111910008A (en) | Molecular marker related to chicken growth and development and application thereof | |
| CN115992251A (en) | Molecular marker related to Hu sheep growth traits and application thereof | |
| CN116083592A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN115109856A (en) | Molecular marker related to sheep stage body weight, detection method and application thereof | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN114921568A (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN114959052A (en) | Molecular marker related to Hu sheep physique and application thereof | |
| CN115181804A (en) | Molecular marker related to sheep growth traits, detection method and application thereof | |
| CN110592237A (en) | Primer, probe, kit and detection method for detecting weight traits of white geese in east Zhejiang province | |
| CN114717336B (en) | Molecular marker related to sheep viscera weight and application thereof | |
| CN115948564A (en) | Molecular marker related to sheep growth traits and application thereof | |
| CN114182026B (en) | Molecular marker related to feed conversion rate of Hu sheep and application of molecular marker | |
| CN115074449A (en) | Molecular marker related to sheep tail fat deposition and application thereof | |
| CN115044682A (en) | Molecular marker related to growth traits of Hu sheep, detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |