CN115141889A - SNP marker related to Chinese southern Holstein cow milk production traits and application thereof - Google Patents
SNP marker related to Chinese southern Holstein cow milk production traits and application thereof Download PDFInfo
- Publication number
- CN115141889A CN115141889A CN202210686431.2A CN202210686431A CN115141889A CN 115141889 A CN115141889 A CN 115141889A CN 202210686431 A CN202210686431 A CN 202210686431A CN 115141889 A CN115141889 A CN 115141889A
- Authority
- CN
- China
- Prior art keywords
- genotype
- milk
- snp marker
- southern
- holstein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides SNP marks related to milk production traits of Chinese southern Holstein cows and application thereof, wherein the first SNP mark is positioned at 39037752bp on the 18 th chromosome reverse strand of the genome of the Chinese southern Holstein cows, the basic group is C or T, the 305d milk volume of a CC genotype individual of the first SNP mark is remarkably higher than that of a CT genotype individual and a TT genotype individual, and the total milk volume and the peak milk volume are remarkably higher than those of the CT genotype individual and the TT genotype individual; the second SNP marker is located at 39037665bp on the 18 th chromosome reverse strand of the genome of southern Holstein cows in China, the basic group is G or A, and the total milk volume and peak milk of the GG genotype individual of the second SNP marker are both obviously higher than those of the GA genotype individual. The two SNP loci provided by the invention enrich the molecular marker genetic resource library of cow breeding, and the molecular marker auxiliary selection is utilized to improve the milk yield of the Chinese southern Holstein cow, and simultaneously, the breeding character of the Chinese southern Holstein cow can not be influenced.
Description
Technical Field
The invention relates to the field of molecular biology, in particular to two SNP markers related to the milk production traits of Chinese southern Holstein cows and application thereof.
Background
Compared with the northern regions, the southern regions in China have the geographical and climatic characteristics of complex landform, high temperature and high humidity climate, relatively dense population and the like, and the characteristics restrict the development mode of increasing the total milk yield by enlarging the feeding scale in aspects of capital, land, climate, manpower and the like. In addition, the selection of the breeding of the dairy cows in the southern area of China is not severe enough for a long time, and the dairy cows generally have the problems of small quantity of improved varieties, low yield level, complex population resources, poor genetic quality and the like. Therefore, the method improves the milk yield by improving the variety of the dairy cows and cultivating the local high-yield dairy cow population, and is a key way for helping milk enterprises to improve the income and further promoting the development of the dairy cow industry in China.
With the rapid development of molecular biology technology, molecular genetic markers and marker-assisted selection are increasingly widely studied in livestock breeding. At present, the more widely used molecular genetic markers are: restriction Fragment Length Polymorphism markers (RFLPs), random Amplified polymorphic DNA markers (RAPDs), amplified Fragment Length Polymorphism markers (AFLPs), single Nucleotide Polymorphism markers (SNPs), and the like. The SNP marker has the advantages of stable heredity, low mutation rate, convenience for automatic detection and the like, so that the development of the SNP genetic marker related to the milk production traits of the dairy cows can powerfully promote the breeding work of high-yield dairy cow varieties (lines).
The Snapshot technique is a novel sequencing technique. The technology is based on a fluorescent labeling single base extension principle, a primer is used for amplifying a fragment where target SNPs are located, an amplification product is used as a template for single base extension after being purified, sequencing enzyme, four kinds of ddNTP with fluorescent labels and an extension primer of which the 5' -end is close to an SNP locus are used for carrying out PCR reaction, one base is extended by the primer, namely, the primer is terminated, after the primer is detected by a sequencer, the SNP locus corresponding to the extension product is determined according to the moving position of a peak, the type of the doped base can be known according to the color of the peak, and therefore the genotype of a sample is determined. The technology has the advantages of accurate typing, high flux, high detection speed, no limitation of SNP site polymorphism characteristics and sample number, and the like.
In the process of breeding the dairy cows, by searching key genes related to the milk yield of the dairy cows and screening SNP markers closely related to the improvement of the milk yield for breeding, early seed selection and improvement of the breeding accuracy can be realized, so that the genetic breeding process is accelerated, the milk production performance of the dairy cows is fundamentally improved, the continuous and healthy development of the dairy cows in China is promoted, however, at present, the number of SNP markers related to the milk production traits of the Holstein dairy cows in the south of China is small, and the gene bank is short.
Disclosure of Invention
The embodiment of the invention provides two SNP markers related to the milk production traits of Chinese southern Holstein cows and application thereof, and aims to solve the problem that the SNP markers related to the milk production traits of the Chinese southern Holstein cows are lacked in the related technology.
In a first aspect, the invention provides two SNP markers related to the milk production traits of southern Holstein cows in China, wherein the first SNP marker is positioned at 39037752bp on the 18 th chromosome reverse strand of genome of the southern Holstein cows in China, the basic group is C or T, the 305d milk volume of a CC genotype individual of the first SNP marker is remarkably higher than that of a CT genotype individual and that of a TT genotype individual, and the total milk volume and the peak milk volume are both remarkably higher than those of the CT genotype individual and the TT genotype individual; the second SNP marker is located at 39037665bp on the 18 th chromosome reverse strand of the genome of southern Holstein cows in China, the basic group is G or A, and the total milk volume and peak milk of the GG genotype individual of the second SNP marker are both obviously higher than those of the GA genotype individual.
In a second aspect, the present invention provides a primer pair for detecting the above-mentioned SNP marker:
a forward primer: 5 'CCATACTCAGCCAGCACAGCACAGCAO 3' as shown in SEQ ID NO:1 is shown in the specification;
reverse primer: 5 'GGGGCGAAATGAAAACTTCAACT-3' as shown in SEQ ID NO:2, respectively.
In a third aspect, the present invention provides a kit for detecting the SNP marker, the kit comprising the primer set and at least one of the following single-base extension primers:
single base extension primer for the first SNP marker:
5 'TTTTTTTTTTTTTTTTTTTTGAAGGTGTTCTCATTCAGTATGGG-3', as shown in SEQ ID NO:3 is shown in the figure;
single base extension primer for the second SNP marker:
5 '-TTTTTGTCGTCTTCCYTGTCGTGAAC-3' as set forth in SEQ ID NO:4, wherein Y in the nucleotide sequence is degenerate base and represents C or T.
In a fourth aspect, the invention provides the use of the SNP marker, the primer pair and the kit in the auxiliary identification of the milk production traits of southern Holstein cows in China.
In a fifth aspect, the invention provides a method for breeding Chinese southern Holstein cows, which comprises the step of evaluating the milk production traits of the Chinese southern Holstein cows to be tested by detecting the SNP marker on the Chinese southern Holstein cows to be tested.
The method for breeding the southern Holstein cows in China specifically comprises the following steps:
extracting the genome DNA of the southern Holstein cow to be detected in China;
taking the genome DNA of the Chinese southern Holstein cow to be detected as a template, and carrying out multiple PCR amplification reaction by using the primer pair;
and carrying out single base extension reaction on the PCR amplification product by using the single base extension primer, sequencing the extension product, determining the genotypes of the first SNP marker and the second SNP marker, and breeding the dominant variety of the milk production character according to the genotypes.
On the basis of the technical scheme, one of parents for cross breeding at least meets one of the following conditions: (i) The first SNP marker contains allele C, and (ii) the second SNP marker contains allele G. Thereby leading the dominant allele to be diffused rapidly in the population and accelerating the process of cultivating the offspring with dominant milk production traits. Preferably, an individual who fulfils at least one of the following conditions is selected as the milk producing trait dominant individual: (i) The first SNP marker is CC genotype, (ii) the second SNP marker is GG genotype. More preferably, an individual with the first SNP marker being of CC genotype and the second SNP marker being of GG genotype is selected as the milk producing trait dominant individual. Preferably, southern holstein cows in china are holstein cows in the wuhan region.
The technical scheme provided by the invention has the beneficial effects that:
(1) The two SNP markers which are obviously related to the total milk volume and the peak milk of the Holstein cow in south China provided by the invention are characterized in that the rs41871650 site of the first SNP marker and the rs209034260 site of the second SNP marker are both positioned on the HP gene, and simultaneously the rs41871650 site and the milk volume of the cow 305d are respectively positioned on the HP genePole(s)Are significantly related. The two SNP markers enrich the molecular marker genetic resource library for breeding the dairy cows, and the molecular marker auxiliary selection by using the two SNP markers is favorable for improving the milk yield of the Chinese south Holstein dairy cows and simultaneously can not influence the reproductive traits of the Chinese south Holstein dairy cows.
(2) The invention can rapidly diffuse the dominant genotype for improving the milk production characteristics (305 d milk yield, total milk yield and peak milk) of the dairy cow in the group by combining the rs41871650 site and the rs209034260 site for marker-assisted selection, thereby fundamentally improving the lactation performance of the offspring group, having great promotion effect on improving the production performance of the dairy cow and the genetic quality of the dairy cow and being beneficial to cultivating the local high-yield dairy cow group. Meanwhile, the selection of the dominant genotype does not cause adverse effects on the breeding level of the population, particularly the age at first birth and the calving interval, and is beneficial to the balanced breeding of important economic characters of Holstein cows in southern China.
(3) According to the invention, through the combined selection of two SNP marker dominant genotypes, the accuracy of selection is greatly increased, and the early breeding and accurate breeding of the dairy cows are facilitated to be realized. In addition, the rs41871650 site and the rs209034260 site are obviously related to a plurality of milk production traits, and the selection efficiency of individuals with excellent milk production traits is improved by the combined selection of the 305d milk yield, the total milk yield and the peak milk trait.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the drawings required to be used in the description of the embodiments are briefly introduced below, and it is obvious that the drawings in the description below are only some embodiments of the present invention, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.
FIGS. 1 to 3 are graphs showing the result of rs41871650 locus typing;
FIGS. 4 to 6 are graphs showing the result of typing at site rs 209034260.
Detailed Description
To make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below with reference to specific embodiments, and it is obvious that the described embodiments are some, but not all embodiments of the present invention. All other embodiments, which can be obtained by a person skilled in the art without making any creative effort based on the embodiments in the present invention, belong to the protection scope of the present invention.
The invention finds out two SNP markers which are closely related to improving milk yield through modern molecular biology technology and statistical method, and the two SNP markers are positioned on Haptoglobin (HP) genes. The HP gene is positioned in a 39037402-39043531bp interval on the 18 th chromosome reverse chain (revertstrand) of a cow, is alpha 2 globulin synthesized by the liver, accounts for about 1 percent of the total protein of plasma, and has the molecular weight of 1000-2000 kDa. Since hemoglobin (Hb) has peroxidase activity, HP can protect body tissues from oxidative damage by binding to it; once HP binds to Hb, the iron ions in Hb are not available to the siderophore bacteria. Therefore, HP has certain indirect bacteriostatic activity. And the HP also has the effects of promoting angiogenesis, regulating lipid metabolism, regulating immunity and the like. HP can be used as an effective marker molecule for judging the occurrence, severity and prognosis of diseases such as cow mastitis, endometritis, foot-and-mouth disease, pneumonia and the like, and in addition, the molecule can indirectly reflect the changes of milk components and milk quality and can be used as a candidate index for evaluating the milk quality. However, at present, no report is made on the influence of the polymorphic sites and genetic variation of the HP gene on the milk production traits of the dairy cows.
The information on the two SNP markers obtained in the present invention is shown in Table 1.
TABLE 1 information of 2 SNP markers for association analysis
Note: using "chromosome number located: the position of the SNP is marked in the form of a position on a chromosome ".
Example 1: acquisition and identification of two SNP markers closely related to improvement of milk yield
1.1 blood sample and Collection of phenotypic data
785 Chinese southern Holstein cows in a certain large-scale dairy farm in Wuhan Hubei are taken as experimental objects, tail vein blood collection is carried out, EDTA anticoagulation is carried out, and the milk is preserved at the temperature of-20 ℃. The milk production traits (lactation days, milk yield of 305d, total milk yield, peak milk, peak day, milk fat rate and milk protein rate), reproductive traits (age at first birth day, calving interval) and health traits (somatic cell count) of the cows are monitored, and 777 complete first-born cow data, 386 second-born cow data and 92 third-born cow data are obtained.
1.2 extraction and detection of Total DNA
Whole genome DNA was extracted from Blood samples of 785 southern Holstein cows in China using a TIA Namp Blood DNA Kit Blood genome DNA extraction Kit. 200. Mu.L of buffer GB and 20. Mu.L of proteinase K were added to 200. Mu.L of whole blood, the mixture was thoroughly inverted and mixed, and then, 350. Mu.L of buffer BD was added thereto after sufficiently standing at 56 ℃, and the mixture was thoroughly inverted and mixed, and then, passed through an adsorption column. After 500. Mu.L of buffer GDB and 600. Mu.L of rinse PWB were added to the column, respectively, and centrifuged, the residual rinse in the column was dried at room temperature. And finally, transferring the adsorption column into a centrifuge tube, dropwise adding an elution buffer TB, standing at room temperature, centrifuging and collecting the solution. mu.L of DNA sample was checked for purity and concentration by electrophoresis on 1% agarose gel, and then diluted to a working concentration of 5-10 ng/. Mu.L.
1.3PCR reaction
According to a reference sequence provided by NCBI, PCR amplification primers are designed by using Primer3.0 online software, and two SNP markers at the rs41871650 site and the rs209034260 site share one pair of PCR amplification primers:
a forward primer: 5 'CCATACTCAGCCAGCACAGCACACAGCAO 3';
reverse primer: 5 'GGGGCGAAATGAAAACTTCAACT-3'.
The PCR reaction system (20. Mu.L) contained 1 XGC-I buffer (purchased from Takara Co., ltd.), 3.0mM Mg 2+ 0.3mM dNTP,1U Hot Start Taq enzyme (available from Qiagen), 1. Mu.L of sample DNA and 0.5. Mu.L of each of the forward and reverse primers, at a primer concentration of 1.5. Mu.M. The reaction process is as follows: (1) 95 ℃ for 2min; (2) Sequentially carrying out three steps of 11 cycles of 94 ℃ for 20s, 65 ℃ for 40s (-0.5 ℃/cycle) and 72 ℃ for 1.5 min; (3) Sequentially carrying out 24 cycles of 94 ℃ for 20s, 59 ℃ for 30s and 72 ℃ for 1.5 min; (4) 72 ℃ for 2min. The nucleotide sequence of the amplification product is shown as SEQ ID NO:5, the length is 309bp:
1.4PCR product purification
5U of SAP enzyme and 2U of Exonaclease I enzyme were added to 10. Mu.L of the LPCR product, incubated at 37 ℃ for 1 hour, and then inactivated at 75 ℃ for 15min.
1.5Snapshot Single base extension reaction
The purified PCR product was subjected to a single base extension reaction using Snapshot Multiplex kit from ABI.
The single base extension primer (SF) of the rs41871650 site is:
5’-TTTTTTTTTTTTTTGAAGGTGTTCTCATTCAGTATGGG-3’；
the single base extension primer (SF) of the rs209034260 site is as follows:
5’-TTTTTTTGTCGTCTTCCYTGTCGTGAAC-3’。
wherein Y is degenerate base, and represents C or T.
The extension reaction system (10. Mu.L) included 5. Mu.L Snapshot Multiplex kit (purchased from ABI), 2. Mu.L purified Multiplex PCR product, 2. Mu.L ultrapure water, and 1. Mu.L extension primer mixture, wherein the primer concentration at rs41871650 site was 1.6. Mu.M, and the primer concentration at rs209034260 site was 0.8. Mu.M. The reaction process is as follows: (1) 96 ℃ for 1min; (2) The temperature of 96 ℃ is 10s, the temperature of 55 ℃ is 5s, the temperature of 60 ℃ is 30s, and the three steps are 28 cycles.
1.6 purification of extension products
Add 1U SAP enzyme to 10. Mu.L extension product, incubate for 1h at 37 ℃ and inactivate for 15min at 75 ℃.
1.7 sequencing of extension products
mu.L of the purified extension product was taken and mixed with 0.5. Mu.L of Liz 120SIZE STANDARD, 9. Mu.L of Hi-Di, denatured at 95 ℃ for 5 minutes and applied to ABI3730XL sequencer, and the raw data obtained was analyzed by Gene mapper4.1 (applied biosystems, USA). And respectively calculating the genotype frequency and the allele frequency of the two sites by using Excel, and analyzing the Hardy-Weinberg equilibrium condition of the two sites by using a chi-square test.
Example 2: association analysis of SNP and production traits
Calculating the genotype frequency and the allele frequency of each site by using Excel, and analyzing the Hardy-Weinberg equilibrium condition of each site by using a Chi-square test. The milk fat rate, milk protein rate and somatic cell number were examined positively by univariate procedure of SAS on-line program (https:// welome. Oda. SAS. Com /), data transformation was performed by BOX-COX method, and abnormal values were eliminated by "mean. + -. 3-fold standard deviation". The influence of the genotype on each corrected character is detected by a GLM process, wherein a detection model is Y = mu + P + S + G + e, and a detection model for the day age of first birth is Y = mu + G + e; wherein Y is an individual character phenotype value, mu is a population mean value, P is a fixed effect of the number of fetuses, S is a fixed effect of the calving season, G is a fixed effect of the genotype, and e is a random error effect. Multiple comparisons of individual trait phenotype values for different genotypes were performed using the DUNCAN method.
2.1 Gene and genotype frequencies
The DNA of the milk cow blood is detected by 1 percent agarose gel electrophoresis, and the strip is bright and has no protein pollution. The mass concentration of more than 95% of samples is more than 10 ng/muL, and the concentration and the purity can meet the requirements of Snapshot typing experiments by adopting a NanoDrop2000 nucleic acid concentration instrument.
Through detection, the gene frequency and the genotype frequency of the rs41871650 site and the rs209034260 site are shown in table 2, and both genes are in a Harden Winberg equilibrium state (P > 0.05).
TABLE 2 genotype frequencies and Gene frequencies at two SNP sites
2.2 phenotypic data statistics
The statistical results of the 10 milk production trait indicators (days of lactation, 305d milk volume, total milk volume, peak milk, peak day, milk fat rate, milk protein rate, somatic cell count, age at first birth and calving interval) for the southern holstein cow population in china selected in the test are shown in table 3. The overall production level of the experimental population is higher, but the difference between individuals is larger, and a larger breeding space exists.
TABLE 3 statistical results of milk production traits
2.3 Association analysis
Correlation analysis shows the effect of different genotypes at different sites of the HP gene on milk production traits, and the results are shown in Table 4.
The rs41871650 site of the HP gene reached significant levels (P < 0.05) in 305d milk volume, total milk volume, peak milk and day old of birth, with no significant association with other traits. Multiple comparison results show that: the milk amount of the HP gene rs41871650 site CC genotype individual 305d is remarkably higher than that of the CT genotype and the TT genotype (P < 0.01), and the average increase range is 4.54 percent (CT type) and 3.84 percent (TT type); the total milk amount of the CC genotype individual is obviously higher than that of the CT genotype and the TT genotype (P < 0.05), and the average increase range is 7.32 percent (CT type) and 6.46 percent (TT type); the peak milk of CC genotype individuals is obviously higher than that of CT genotype and TT genotype (P < 0.05), and the average increase range is 3.28 percent (CT type) and 2.98 percent (TT type). The rs41871650 site CC genotype individual initial birth day age has no significant difference with CT genotype and TT genotype individuals (P is more than 0.05), however, there were significant differences between CT genotype and TT genotype individuals (P < 0.05).
The rs209034260 site of the HP gene reached significant levels (P < 0.05) for total and peak milk, with no significant correlation to other traits. The results of multiple comparisons show that: the total milk amount of an individual with the rs209034260 locus GG genotype is remarkably higher than that of an individual with the GA genotype (P < 0.05), and the average increase is about 3.66%; the peak milk of the rs209034260 locus GG genotype individual is significantly higher than that of the GA genotype (P < 0.05), and the average increase range is about 2.51%.
TABLE 4 Association analysis of SNP loci of HP genes with milk production traits of cows (LSM + -sE)
Note: different lower case letters indicate that the difference is obvious (P < 0.05) when compared with different genotypes of the same character at the same site, and different upper case letters indicate that the difference is extremely obvious (P < 0.01) when compared with different genotypes of the same character at the same site, and the difference is the same below.
The research result shows that SNP sites capable of influencing the milk production traits of the dairy cows exist on the HP gene, and rs41871650 site and rs209034260 site on the HP gene can be used for marker-assisted selection of the milk production traits of the dairy cow population.
The milk amount of the rs41871650 site CC genotype individual 305d is remarkably higher than that of the CT genotype and the TT genotype, the total milk amount and the peak milk amount of the CC genotype individual are remarkably higher than those of the CT genotype and the TT genotype, and meanwhile, the initial birth day age of the CC genotype individual is not remarkably different from that of the CT genotype and the TT genotype. The peak milk refers to the highest milk yield of a day measured 150 days after delivery, the peak milk is positively correlated with the whole fetal milk yield, and the whole fetal milk yield can be increased by 200-250kg when the peak milk is increased by 1kg according to statistics. The initial day age is the number of days between the date of first calving and the date of birth of the cow, can reflect the sexual maturity of individual cows as well as the pregnancy capability of the individual cows simultaneously, and is one of important reproductive traits. Research proves that the age of the day of primiparity has obvious influence on milk fat percentage, milk protein and production life, and the milk production character is improved along with the reduction of the age of the day of primiparity. In general, the test results of the invention show that the comprehensive milk production characteristics (305 d milk quantity, total milk quantity and peak milk) of the CC genotype individual at the rs41871650 site are superior to those of the TT genotype individual, and meanwhile, the invention has no significant influence on the age of the day of first birth and the calving interval. The total milk amount and peak milk of the individual with the GG genotype at the rs209034260 site are obviously higher than those of the GA genotype, and meanwhile, other production traits of the individual with the GG genotype have no obvious difference with other genotypes.
In production practice, by selecting individuals with the first SNP marker containing allele T and/or the second SNP marker containing allele G as one of the parents, the dominant alleles of the two loci can be rapidly diffused in the population by a cross breeding method, and the breeding process of the dominant new variety of the milk-producing character is accelerated. The individual with the CC genotype at the rs41871650 site and the GG genotype at the rs209034260 site can also be selected as an optimal potential individual to be used for cultivating a new variety with superior milk production traits, and meanwhile, the breeding traits of the individual cannot be negatively influenced.
The two SNP markers provided by the invention are applied to seed selection, and can realize early seed selection and improve the breeding accuracy, thereby accelerating the genetic breeding process, fundamentally improving the milk production performance of dairy cows and promoting the sustainable and healthy development of the dairy cow industry in China.
The foregoing are merely exemplary embodiments of the present invention, which enable those skilled in the art to understand or practice the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Sequence listing
<110> Wuhan city college of agricultural sciences
<120> SNP marker related to Chinese southern Holstein cow milk production traits and application thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
cctactcagc cacagcacag c 21
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ggggcgaaat gaaaacttca act 23
<210> 3
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tttttttttt ttttgaaggt gttctcattc agtatggg 38
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tttttttgtc gtcttccytg tcgtgaac 28
<210> 5
<211> 309
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ccatactcag ccacagcaca gctcttgtca aagctcagga tcccggccgc ataccaggtg 60
tcgtcttcct tgtcgtgaac gacgaaggcg ctgccggcgt cgccatagca ggtgtcgtcc 120
tggtacttgg acaggccgac gcagaaggtg ttctcattca gtatgggttg cacccctaca 180
gggctcttag ctgtcttatt tttaggtgcg tcgacgccct catagtgttt cacacacttg 240
tcttggtcag ccacaggtag catgacatac ttcagatgct ccgtaaagtt gaagttttca 300
tttcgcccc 309
Claims (7)
1. The application of the second SNP marker in the auxiliary identification of the milk production traits of southern Holstein cows in China is characterized in that: the second SNP marker is located at 39037665bp on the 18 th chromosome reverse strand of the genome of southern Holstein cows in China, the basic group is G or A, and the total milk volume and peak milk of GG genotype individuals of the second SNP marker are obviously higher than those of GA genotype individuals.
2. The application of the kit for detecting the second SNP marker in the auxiliary identification of the milk production traits of southern Holstein cows in China is characterized in that: the kit for detecting the second SNP marker comprises a primer pair for detecting the second SNP marker and a single-base extension primer;
the second SNP marker is located at the 39037665bp position on the 18 th chromosome reverse chain of the genome of a southern Holstein cow in China, the base is G or A, and the total milk volume and the peak milk of a GG genotype individual of the second SNP marker are obviously higher than those of a GA genotype individual;
the primer pair comprises:
a forward primer: 5 'CCATACTCAGCCACACACACAGAGC 3',
reverse primer: 5 'GGGGCGAAATGAAAACTTCAACT-3';
the single-base extension primer is as follows:
5’-TTTTTTTGTCGTCTTCCYTGTCGTGAAC-3’；
wherein Y in the nucleotide sequence is degenerate base and represents C or T.
3. A method for breeding Chinese south Holstein cows is characterized in that: by detecting a second SNP marker of the Chinese south Holstein cow to be detected, evaluating the milk production character of the Chinese south Holstein cow to be detected, and selecting individuals with dominant alleles and genotypes capable of improving the milk production to carry out breeding work; the second SNP marker is located at 39037665bp on the 18 th chromosome reverse strand of the genome of southern Holstein cows in China, the basic group is G or A, and the total milk volume and peak milk of GG genotype individuals of the second SNP marker are obviously higher than those of GA genotype individuals.
4. The method of breeding a southern holstein cow in china according to claim 3, comprising the steps of:
extracting the genome DNA of the southern Holstein cow to be detected in China;
taking the genome DNA of the Chinese southern Holstein cow to be detected as a template, and performing multiple PCR amplification reaction by using a primer pair; the primer pair comprises:
a forward primer: 5 'CCATACTCAGCCACAGCACAGC-3',
reverse primer: 5 'GGGGCGAAATGAAAACTTCAACT-3';
carrying out single base extension reaction on the PCR amplification product by using a single base extension primer of a second SNP marker, sequencing the extension product, determining the genotype of the second SNP marker, and selecting an individual of a target genotype to breed a dominant variety of the produced milk; the single base extension primer of the second SNP marker is as follows:
5’-TTTTTTTGTCGTCTTCCYTGTCGTGAAC-3’；
wherein, Y in the nucleotide sequence is degenerate base and represents C or T.
5. The method of breeding a southern holstein cow in china according to claim 4, wherein: one of the parents for cross breeding meets at least the following conditions: the second SNP marker contains allele G.
6. The method of breeding chinese south holstein cows according to claim 5, wherein: selecting an individual of which the first SNP marker is a CC genotype and the second SNP marker is a GG genotype as a dominant individual of the milk production trait; the first SNP marker is located at the 39037752bp position on the 18 th chromosome reverse strand of the genome of a southern Holstein cow in China, the base is C or T, the 305d milk volume of a CC genotype individual of the first SNP marker is remarkably higher than that of a CT genotype individual and that of a TT genotype individual, and the total milk volume and the peak milk volume are remarkably higher than those of the CT genotype individual and the TT genotype individual.
7. The method for breeding southern holstein cows of china according to any one of claims 3 to 6, wherein: the southern Holstein cows in China are Holstein cows in Wuhan region.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210686431.2A CN115141889A (en) | 2021-01-28 | 2021-01-28 | SNP marker related to Chinese southern Holstein cow milk production traits and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210686431.2A CN115141889A (en) | 2021-01-28 | 2021-01-28 | SNP marker related to Chinese southern Holstein cow milk production traits and application thereof |
| CN202110120752.1A CN112662788B (en) | 2021-01-28 | 2021-01-28 | SNP marker related to milk production traits of Holstein cows in south China and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110120752.1A Division CN112662788B (en) | 2021-01-28 | 2021-01-28 | SNP marker related to milk production traits of Holstein cows in south China and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115141889A true CN115141889A (en) | 2022-10-04 |
Family
ID=75414895
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210686431.2A Pending CN115141889A (en) | 2021-01-28 | 2021-01-28 | SNP marker related to Chinese southern Holstein cow milk production traits and application thereof |
| CN202110120752.1A Active CN112662788B (en) | 2021-01-28 | 2021-01-28 | SNP marker related to milk production traits of Holstein cows in south China and application thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110120752.1A Active CN112662788B (en) | 2021-01-28 | 2021-01-28 | SNP marker related to milk production traits of Holstein cows in south China and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN115141889A (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113481307B (en) * | 2021-08-11 | 2022-12-06 | 广西壮族自治区水牛研究所 | Buffalo lactation related gene NTNG1 and application thereof as molecular marker |
| CN114480665B (en) * | 2021-12-10 | 2024-09-20 | 广东海洋大学 | Method for detecting and/or evaluating quality traits of Chinese Holstein cow milk |
| CN114277157A (en) * | 2021-12-21 | 2022-04-05 | 华南农业大学 | SNP molecular marker related to lactoprotein rate of southern Holstein cows and breeding method |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5374523A (en) * | 1992-08-10 | 1994-12-20 | Monsanto Company | Allelic variants of bovine somatotropin gene:genetic marker for superior milk production in bovine |
| CN101168777B (en) * | 2007-10-31 | 2010-08-11 | 中国农业大学 | Method and kit for detecting Chinese holstein cattle produced milk property |
-
2021
- 2021-01-28 CN CN202210686431.2A patent/CN115141889A/en active Pending
- 2021-01-28 CN CN202110120752.1A patent/CN112662788B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662788B (en) | 2022-08-19 |
| CN112662788A (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112662788B (en) | SNP marker related to milk production traits of Holstein cows in south China and application thereof | |
| CN112251518B (en) | Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof | |
| CN108103208B (en) | SNP marker influencing Hu sheep lambing traits and application thereof | |
| KR101929391B1 (en) | Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof | |
| CN114196765B (en) | Application of single nucleotide polymorphism markers of SLC7A5 gene of milk goat in early selection of milk production traits | |
| KR101595011B1 (en) | Novel SNP marker for discriminating number of nipple of Pig and use thereof | |
| CN118460737B (en) | LECT2 gene molecular marker related to pigeon fertility characteristics and application thereof | |
| CN112899373B (en) | SNP (Single nucleotide polymorphism) marker related to milk fat percentage of southern Holstein cows in China and application thereof | |
| CN106947826B (en) | Method for detecting single nucleotide polymorphism of cattle SERPINA3 gene and application thereof | |
| CN116377082B (en) | Application of sheep LCORL gene single nucleotide polymorphism marker in growth trait selection | |
| CN116751868B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| CN115820879B (en) | Molecular marker related to intramuscular fat traits of pigs in pig AOPEP gene and application thereof | |
| CN114350818B (en) | Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| CN116083598A (en) | SNP molecular marker related to intramuscular fat traits of pigs and application thereof | |
| CN102031304B (en) | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof | |
| CN117051128B (en) | NARS2 gene molecular marker related to pork quality traits and application thereof | |
| CN116103413B (en) | SNP (Single nucleotide polymorphism) marker related to laying characteristics of local chickens as well as detection method and application thereof | |
| CN116855613B (en) | Molecular marker, primer, kit, method and application of pig carcass traits | |
| CN112266968B (en) | Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application | |
| CN113801946B (en) | Molecular marker affecting reproductive performance of sow, detection method and application thereof | |
| CN118460739B (en) | CEPU-1 gene molecular marker related to pigeon fertility and application thereof | |
| CN116083604B (en) | SNP molecular marker affecting sheep weaning weight and application thereof | |
| CN112458183B (en) | Copy number variation molecular marker on pig No. 3 chromosome and related to daily gain and weight and age on market of pig and application thereof | |
| CN118480625A (en) | InDel molecular marker located on chromosome 3 and related to alfalfa yield and application | |
| CN118460741A (en) | USP37 gene molecular marker related to pigeon egg laying interval characters and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |