CN114350818B - Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof - Google Patents

Abstract

The invention discloses a prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof, belonging to the technical field of biology, wherein the molecular marker comprises: SNP5, SNP6, and/or SNP 7; wherein the SNP5 is located at the Chr2:48996109 site of the sequence shown as SEQ ID No.1, and the allele is C > A; the SNP6 is located at the Chr2:48996350 site of the sequence shown as SEQ ID No.1, and the allelic gene is T > C; the SNP7 is located at the Chr2:48996351 site of the sequence shown as SEQ ID No.1, and the allele is insertion/deletion; the method can accurately identify the egg laying characteristics of Muscovy ducks of different ages of weeks, and provides a new molecular marker for molecular marker-assisted selective breeding.

Description

Prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof.

Background

Muscovy duck (Cairina moschata) is a special waterfowl, and domestic ducks come from different genera, which has the advantages of strong heat resistance and high meat yield, but low egg laying performance. The egg laying peak period of the Muscovy ducks is 35-53 weeks, and most of the egg laying period is covered. Although Muscovy ducks are bred in large scale in China, the Muscovy ducks are poor in egg laying performance and lack of systematic breeding, so that the egg laying traits of the Muscovy ducks are uneven, and the productivity and economic benefit of enterprises are affected.

The egg laying character belongs to the low heritability character, and the breeding mode based on character selection has the characteristics of long period, slow breeding progress and difficulty in obtaining obvious effect, so that the improvement of the egg laying performance of the Muscovy ducks is very challenging work. By using the molecular marker related to quantitative traits and taking the marker information as auxiliary information, the genetic composition of an individual can be accurately and quickly analyzed from the molecular level, thereby realizing the selection of genotypes. Moreover, genetic markers, pedigrees and phenotype information are fully utilized, and compared with a conventional breeding method, the method is rich in information amount and high in selection accuracy. Single Nucleotide Polymorphism (SNP) refers to a genomic DNA Polymorphism caused by a Single base change such as insertion, deletion, transversion and conversion in a genomic DNA sequence, and has the characteristics of stable inheritance, easy detection and the like. The SNP can be used as Molecular marker information for Molecular marker-assisted Selection (MAS), and the seed Selection accuracy and the breeding effect are improved.

Prolactin (PRL), a polypeptide hormone secreted by the anterior pituitary gland, has been shown to possess a wide variety of biological activities and functions in all vertebrates. The development of hatching behavior in poultry is caused by increased secretion of prolactin, which often leads to ovarian degeneration, and therefore prolactin in birds plays a crucial role in egg production.

Disclosure of Invention

The invention aims to provide an SNP molecular marker of a prolactin gene related to egg-laying traits of Muscovy ducks and application thereof, and aims to solve the problems in the prior art.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks, which comprises the following steps: SNP5, SNP6, and/or SNP 7; wherein, the SNP5 is positioned at the Chr2:48996109 site of the sequence shown as SEQ ID No.1, and the allele is C > A; the SNP6 is located at the Chr2:48996350 site of the sequence shown as SEQ ID No.1, and the allelic gene is T > C; the SNP7 is located at the Chr2:48996351 site of the sequence shown as SEQ ID No.1, and the allele is insertion/deletion.

The invention also provides application of the detection reagent of the prolactin gene SNP molecular marker related to the egg-laying traits of the Muscovy ducks in detection of the egg-laying traits of the Muscovy ducks.

The invention also provides a primer for amplifying the prolactin gene SNP molecular marker related to the egg laying traits of Muscovy ducks, which comprises a primer with a sequence shown as SEQ ID No. 2-5.

The invention also provides application of the primer in identifying the egg laying traits of Muscovy ducks or preparing a kit for identifying the egg laying traits of Muscovy ducks.

The invention also provides a kit for identifying the egg laying traits of the Muscovy ducks, which comprises the primers.

The invention also provides a method for identifying the egg laying character of the Muscovy duck, which is used for identifying the genotype of the molecular marker in the Muscovy duck to be detected.

Further, the method comprises the steps of:

(1) extracting the genome DNA of the Muscovy duck to be detected;

(2) carrying out PCR amplification by using the primers to obtain amplification primers;

(3) sequencing the amplification product to obtain the genotype of the molecular marker;

(4) and judging the egg laying character of the muscovy duck to be detected according to the genotyping result.

Further, in step (2), the amplification system for PCR amplification comprises: 2xTaq MasterMix 15. mu.L, mixed primers each 1.2. mu.L, ultrapure water 10.6. mu.L and DNA 2. mu.L;

the reaction procedure of the PCR amplification is as follows: 94 ℃ for 2min, 94 ℃ for 30s, 53 ℃ for 30s, 72 ℃ for 30s, 30cycles, 72 ℃ for 2 min.

The invention also provides the prolactin gene SNP molecular marker related to the egg laying traits of Muscovy ducks, the primer and the application of the kit in Muscovy duck breeding.

The invention discloses the following technical effects:

according to the invention, by analyzing the prolactin gene, a plurality of SNP loci which are obviously related to the egg production traits of Muscovy ducks are found to exist in the gene, a new SNP molecular marker is provided for MAS, and through experimental verification, SNP5(C48996109A) is obviously related to the egg production of the Muscovy ducks at 41-58 weeks, the egg production of the Muscovy ducks at 300 days, qualified egg production and total egg production, SNP6(T48996350C) is obviously related to the egg production of the Muscovy ducks at 42-45 weeks and the egg production of the Muscovy ducks at 300 days, and SNP7(I48996351D) is obviously related to the egg production of the Muscovy ducks at 43-53 weeks. The association of other SNP loci with egg laying traits did not reach a significant level (P > 0.05). Therefore, the molecular marker provided by the invention can accurately identify the egg laying performance of the Muscovy ducks of different ages in week, so as to provide scientific data for the breeding of the Muscovy ducks.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a gel electrophoresis diagram of PCR products and a SNP peak diagram; PCR product gel electrophoresis picture, wherein M represents 2000 Marker, and the brightest band is 750 bp; sequencing peak maps of different genotypes of C-I.SNP1-SNP 7; SNP1 and SNP2 only found TT-type and tg (ta) -type individuals in the population;

fig. 2 is a white muscovy duck egg laying curve.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Examples

1 materials and methods

1.1 animal samples

387 female muscovy ducks (a Renma duck farm manufactured by southern poultry Breeding Co., Ltd., Guangdong Wen) were selected for 60 weeks. 2mL of subcutaneous venous blood was collected and stored at-80 ℃ and used as a DNA extraction sample. And recording the family information of the selected population and reproductive traits such as the age of the laying date, the daily egg yield, the total egg yield, the egg yield qualification number and the like.

1.2 Main Instrument

BIO-RAD T100 PCR instrument (brand: BIO-RAD; cat # 1861096; Berle, USA) and Hexagon DYCP-31DN nucleic acid electrophoresis instrument (brand: Hexagon, cat # 413: 1402; Hexagon Biotech Co., Ltd.).

1.3 Primary reagents

A rapid blood genome DNA extraction kit (brand: Novozan; product number: DC 111-01; Jiangsu Novozan Biotechnology Co., Ltd.), 2xTaq MasterMix (product number: CW 0682; Jiangsu Kangji century Biotechnology Co., Ltd.), DNA marker (brand: Novozan; product number: MD 101; Jiangsu Novozan Biotechnology Co., Ltd.), and high-purity low-agarose (product number: Tokyo; product number: TSJ 001; Beijing Kangke Biotechnology Co., Ltd.).

2 Experimental methods

2.1 primer design

Primer synthesis services were provided by Shanghai Biotechnology engineering, Inc. by designing primers using the Primer-BLAST tool of NCBI (national Center for Biotechnology Information Search database) according to Muscovy Duck (domesticated) genome (GCA _009194515.1) prolactin gene (ENSCMG 00000003520) published by Ensembl. The information on the primer sequences is shown in Table 1.

TABLE 1 PCR amplification primer sequences

2.2 extraction of blood genomic DNA

Blood genome DNA is extracted by referring to an operation manual of a rapid blood genome DNA extraction kit.

2.3 PCR amplification of prolactin Gene exon sequences

A PCR amplification reaction system (Table 2) was prepared using the genomic DNA of the blood of the 378 Muscovy duck half sibling individuals as a template. The reaction sequence is shown in table 3. After the reaction was complete, Sanger sequencing service was provided by Tianyihui Gene technology, Inc., Guangzhou.

TABLE 2 reaction System

TABLE 2 reaction procedure

2.4 determination of SNPs and genotyping

The Sanger sequencing results of the PCR amplification products are compared by using SnapGene 4.3.6 software, and genotyping is carried out through a base peak diagram.

2.5 correlation analysis of genotype and egg production traits

Association analysis was performed using the GLM program of the SAS 9.4 software. The model is as follows:

Y _ijk ＝μ+G _i +M _j +S _k +e _ijk

Y _ijk denotes the tabular value,. mu.denotes the mean value, G _i Indicating genotype effects, M _j Denotes the maternal effect, S _k Indicating the interaction between genotype and maternity, e _ijk Representing the residual error.

Haploview 4.2 software was used for Hadifenberg balance (HWE) calculation and haplotype analysis.

3 results

3.1 PCR amplification and SNP screening of the upstream untranslated region of the prolactin Gene

The upstream untranslated region (5' UTR) of prolactin gene and 1323bp (nucleotide sequence shown as SEQ ID No. 1) of intron 1 are obtained by amplifying 2 pairs of PCR primers shown in Table 1. Wherein the PCR product amplified by PRL-SNP-F1/R1 primer is 802bp (figure 1A), and the PCR product amplified by PRL-SNP-F2/R2 primer is 834bp (figure 1B). By comparing the "ab 1" files obtained by Sanger sequencing, a total of 7 SNP sites were obtained, all located in the upstream untranslated region of the prolactin gene (fig. 1C-I, table 4), which are: SNP1(T48995528G), SNP2(T48995550A), SNP3(a48995598T), SNP4(T48995958C), SNP5(C48996109A), SNP6(T48996350C), SNP7 (I48996351D). The hardy weinberg equilibrium calculations show that SNP3, SNP4, SNP6, and SNP7 fit hardy weinberg equilibrium (table 5).

TABLE 3 SNPs of the untranslated region upstream of prolactin

TABLE 4 genotype distribution of SNPs

HWE ═ hadenweiberg balance detect P values; i-insertion and D-deletion.

SEQ ID No.1 (prolactin PCR sequence):

AGGCTAGTTTGTGGATTACCACAGACACATCAGATGTGGAAACAAATCCCCCTGATTACGACAGCATGTGTTTTGAGTATGGTAGACAATGTACATCTTTTACGCAAAG

GTTTTCATGTATAGAAAATAATCTTATCATTTCTGATTTGTTT

TGTTCTTTAAATAATGCTGAT

TAATCATTAAACTTTATGATTAAATAGTAAACATGCAACTTCATCTT

GTTGTTATACATTATTACTTTTTTAATATAAGAACTGTCCCTGTTTCTCTAAACATACCTCATCCTGAGGACCAGTTATATCATGACAATGTAATCTCTTTCTTAACTGTATGAAGCTATATACTCACGATGTCATATCTATAATATTACATATAATGACCTGTCTTTCCACAAGCTGCCATTATCCTTCTCTAGACAATTTATGCTATTTCTTTTCCTGTGGATATTATATTGTTCCCCTTTCCCAAATAATCAGAATTTTAACATTGGAAGGCTGAACATTGGAAAGCTGAAGAGATGAGGATGGATGAAAAGACAGCTGTGGGAAGGGGGAACAATAGGCTATAAACATTGAGGA

ATCTGTCTCAGAATTGACAACTAGAGCTTTCTAGGAACAGTGGCATTTTCAGAGCAAAATTTTGGCATTCTCTTCATCAAACTATACTCAGGATCCCACAACTGAAATTCTAATGAAATTCCCTCTCACAGTTACAAATAATAAAAAAAAA

TGAATATGAATGTGGAAGAAAGGCAGTTTGATGTTTGTAATTATCGAGGTAAACTCCACGACCTGTTGAATGTATGCAAAATGGACCCCGGATGGTGTATATAAACCTGGTATGTGCAGAAAATAAAAGCAAGTATTGAGACTTCTTTCTGGTAGAGCAAGTCATCCTACAGGGTCTCTACCATGAGCACCAAGGGGGATTCGTTGAAAGGTAAGACTTTAGCCATTCACTTGTCGATAA

TTTATGTTTGTTTTTTGTTTGTTTGTTAGTTGTTGTTTTTTGTTGTTGTTGTTGTTGTTTGTTTTTTGTTTTACTTTAGATTGAATTTGGAAGTAACTGACAGGTAACAACTCCAGAAACTGAGGTCTTCCAAGACATCCAGTTTTCGAGTAATGGTGAAACTTGTCTCTGCTTCAAATGTTTAGTGTTCAAAATTTGGAATTAGCAGGCAGTTTGATCTCTTTTTTACTCAGTTTTTGATCTCTCAAGACTACCTTTGCACTGAGCAGTGTCACTGAAATTTGGCTTTCAGGTTATGACACCTGCACAAAAAAAGACTGGATCCAGACTGCTTTGCTACTCATGA

PRL-SNP-F1:AGGCTAGTTTGTGGATT

PRL-SNP-R1:TAAACTCCACGACCTGTT

PRL-SNP-F2:ATTGGAAGGCTGAACAT

PRL-SNP-R2:TGCTTTGCTACTCATGA

SNP site:

upstream non-coding region: GATTAAATAGTAAACA

An intron region: ACTCCAGAAAC

3.2 Association analysis of SNP loci and reproductive traits

As shown in table 6, by analysis, SNP5 was significantly correlated with muscovy duck egg production at 41-58 weeks of age, 300 days of age, qualifying egg production, and total egg production (P < 0.05); SNP6 is obviously related to the egg production of Muscovy ducks of 42-45 weeks old and 300 days old (P < 0.05); SNP7 was significantly associated with the production of eggs by Muscovy ducks 43-53 weeks old (P < 0.05).

TABLE 6 correlation of SNPs with reproductive traits

The phenotypic data for the different genotypes are shown in tables 7-9.

TABLE 5 SNP5 different genotype phenotype data

TABLE 8 SNP6 different genotype phenotype data

TABLE 9 SNP7 different genotype phenotype data

N is the number of individuals actually used in GLM analysis; all data are presented as "mean ± sem".

Discussion 4

After the white muscovy duck starts to produce, the egg yield rapidly rises to reach the maximum level at the age of 32 weeks, then slowly decreases after the maximum level is maintained for about 5 weeks until the 300-day-old (42-week-old) duck maintains a higher level (figure 2). SNP5 and SNP6 in SNPs obtained from an untranslated region on the upstream of prolactin are obviously related to the egg yield of Muscovy ducks aged 300 days. Before 51 weeks of age, SNP5 had less type CC egg production than type AA, less type AA production than type CA; while 52-58, AA type is more dominant in the week's age and CA type is the least, so AA type has the advantage of high yield. After 42 weeks of age, SNP6 genotype TT and SNP7 genotype II were more dominant than cc (tc) and dd (id). SNP6 and SNP7 have complete linkage and can be filled by detecting a single site.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> south China university of agriculture

<120> prolactin gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1323

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aggctagttt gtggattacc acagacacat cagatgtgga aacaaatccc cctgattacg 60

acagcatgtg ttttgagtat ggtagacaat gtacatcttt tacgcaaaga gttttcatgt 120

atagaaaata atcttatcat ttctgatttg tttttgttct ttaaataatg ctgatttaat 180

cattaaactt tatgattaaa tagtaaacat gcaacttcat cttagttgtt atacattatt 240

acttttttaa tataagaact gtccctgttt ctctaaacat acctcatcct gaggaccagt 300

tatatcatga caatgtaatc tctttcttaa ctgtatgaag ctatatactc acgatgtcat 360

atctataata ttacatataa tgacctgtct ttccacaagc tgccattatc cttctctaga 420

caatttatgc tatttctttt cctgtggata ttatattgtt cccctttccc aaataatcag 480

aattttaaca ttggaaggct gaacattgga aagctgaaga gatgaggatg gatgaaaaga 540

cagctgtggg aagggggaac aataggctat aaacattgag gatatctgtc tcagaattga 600

caactagagc tttctaggaa cagtggcatt ttcagagcaa aattttggca ttctcttcat 660

caaactatac tcaggatccc acaactgaaa ttctaatgaa attccctctc acagttacaa 720

ataataaaaa aaaactgaat atgaatgtgg aagaaaggca gtttgatgtt tgtaattatc 780

gaggtaaact ccacgacctg ttgaatgtat gcaaaatgga ccccggatgg tgtatataaa 840

cctggtatgt gcagaaaata aaagcaagta ttgagacttc tttctggtag agcaagtcat 900

cctacagggt ctctaccatg agcaccaagg gggattcgtt gaaaggtaag actttagcca 960

ttcacttgtc gataattttt atgtttgttt tttgtttgtt tgttagttgt tgttttttgt 1020

tgttgttgtt gttgtttgtt ttttgtttta ctttagattg aatttggaag taactgacag 1080

gtaacaactc cagaaactga ggtcttccaa gacatccagt tttcgagtaa tggtgaaact 1140

tgtctctgct tcaaatgttt agtgttcaaa atttggaatt agcaggcagt ttgatctctt 1200

ttttactcag tttttgatct ctcaagacta cctttgcact gagcagtgtc actgaaattt 1260

ggctttcagg ttatgacacc tgcacaaaaa aagactggat ccagactgct ttgctactca 1320

tga 1323

<210> 2

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aggctagttt gtggatt 17

<210> 3

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacaggtcgt ggagttta 18

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

attggaaggc tgaacat 17

<210> 5

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tcatgagtag caaagca 17

Claims (4)

1. The application of the SNP molecular marker of the prolactin gene related to the egg laying traits of Muscovy ducks in the detection of the egg laying traits of Muscovy ducks is characterized in that the SNP molecular marker is positioned in a domestic Muscovy duck genome GCA _009194515.1 prolactin gene ENSCMG 00000003520; the SNP molecular marker comprises mutation sites: SNP5, SNP6, and/or SNP 7; wherein the SNP5 is positioned at the Chr2:48996109 site of the prolactin gene ENSCMG 00000003520 sequence, and C > A mutation exists; the SNP6 is positioned at the Chr2:48996350 site of the prolactin gene ENSCMG 00000003520 sequence, and T & gtC mutation exists; the SNP7 is positioned at the Chr2:48996351 site of the prolactin gene ENSCMG 00000003520 sequence, and the allele of the site is T/deletion; the egg-laying trait is egg yield; the AA type of the SNP5 has the advantage of high yield, and the SNP6 genotype TT and the SNP7 genotype TT have the advantage of high yield.

2. A method for identifying the egg-laying traits of Muscovy ducks is characterized by identifying the genotype of an SNP molecular marker of a prolactin gene in a sample Muscovy duck to be detected; the molecular markers comprise mutation sites SNP5, SNP6 and/or SNP 7; the SNP5 is positioned at the Chr2:48996109 site of the prolactin gene ENSCMG 00000003520 sequence, and C > A mutation exists; the SNP6 is positioned at the Chr2:48996350 site of the prolactin gene ENSCMG 00000003520 sequence, and T > C mutation exists; the SNP7 is positioned at the Chr2:48996351 site of the prolactin gene ENSCMG 00000003520 sequence, and the allele of the site is T/deletion; the AA type of the SNP5 has the advantage of high yield, and the SNP6 genotype TT and the SNP7 genotype TT have the advantage of high yield.

3. The method according to claim 2, characterized in that it comprises the following steps:

(1) extracting the genome DNA of the Muscovy duck to be detected;

(2) carrying out PCR amplification by using the primers to obtain an amplification product; the primer is a primer of a prolactin gene SNP molecular marker related to the egg laying traits of Muscovy ducks and comprises a primer of a sequence shown as SEQ ID No. 2-5;

(3) sequencing the amplification product to obtain the genotype of the molecular marker;

(4) and judging the egg laying character of the muscovy duck to be detected according to the genotyping result.

4. The method according to claim 2, wherein in step (2), the amplification system for PCR amplification comprises: 2XTaq MasterMix 15. mu.L, mixed primers each 1.2. mu.L, ultrapure water 10.6. mu.L and DNA 2. mu.L;

the reaction procedure of the PCR amplification is as follows: 94 ℃ for 2min, 94 ℃ for 30s, 53 ℃ for 30s, 72 ℃ for 30s, 30cycles, 72 ℃ for 2 min.

Images