CN102031304B - Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof - Google Patents
Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof Download PDFInfo
- Publication number
- CN102031304B CN102031304B CN2010105315546A CN201010531554A CN102031304B CN 102031304 B CN102031304 B CN 102031304B CN 2010105315546 A CN2010105315546 A CN 2010105315546A CN 201010531554 A CN201010531554 A CN 201010531554A CN 102031304 B CN102031304 B CN 102031304B
- Authority
- CN
- China
- Prior art keywords
- gene
- add1
- cattle
- sequence
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a method for detecting the single nucleotide polymorphism (SNP) of an ADD1 gene of cattle, which comprises the following steps: through taking a genomic DNA of cattle containing an ADD1 gene as a template and taking a primer mix P as a primer, the ADD1 gene of cattle is amplified through PCR (polymerase chain reaction), then the segment size of the obtained product is amplified through AGE (agarose gel electrophoresis) detection; and then, the detection on SSCP (single strand conformation polymorphism) is performed. The polymorphism of the gene comprises a base polymorphism that the 70027th bit in an ADD1 gene sequence table SEQID No.8 of cattle is G or A, and a base polymorphism that the 70051th bit in the ADD1 gene sequence table SEQID No.8 of cattle is G or A. The analysis on the correlation between the SSCP polymorphism and the production performance shows that: a certain correlation exits between the polymorphic site and the production performance, therefore, the weight of a Qinchuan cattle (genotype: BB) is significantly higher than that of a cattle (genotype: AA). The method is used for the auxiliary selection and molecular breeding of cattle through screening and detecting molecular genetic markers closely relating to the growth properties of cattle on a DNA level, therefore, the method plays a vital role in improving the production performance of cattle.
Description
Technical field
The invention belongs to biological technical field, relate to ox ADD1 gene SNP (SNP) examination and detection and be marked at the application in the ox breeding as assisted Selection.
Background technology
Gene pleiomorphism is meant the difference of genome sequence between different plant species or the interior Different Individual of same species; These differences are to cause that owing to Nucleotide in the DNA allelotrope in the karyomit(e) changes it comprises the variation of replacement, insertion, disappearance and the Tumor-necrosis factor glycoproteins copy number of base.
SNP refers in the genomic dna sequence polymorphum that the replacement owing to single Nucleotide (A/T/C/G) causes, mainly conversion or the transversion by single base causes.SNPs with conversion hysteria variation accounts for 2/3, and other several kinds of SNP are on similar level.The cytosine(Cyt) of CpG dinucletide is to be prone to the site of undergoing mutation in the genome most, and wherein great majority are methylated, spontaneously deaminize and form thymus pyrimidine.
According to influence to inherited character; Gene pleiomorphism can be divided into two kinds again: a kind of is the equivalent gene polymorphum; Be that the change of encoding sequence does not influence aminoacid sequence in its protein of translating due to the SNP, mutating alkali yl is identical with " implication " of mutating alkali yl not; Another kind is non-equivalent gene polymorphum, i.e. the change of base sequence will cause the change of coded amino acid, thereby produces the change of protein sequence, possibly finally have influence on proteinic function.Therefore, concerning the nonsynonymous mutation of coding region SNPs, they possibly have direct material impact to gene function; Especially for the nonsense codon sudden change, more may cause coded albumen generation significant change, thereby influence its function performance, the phenotype generation material impact of individuality.Moreover, in population genetic research, these SNPs are also significant in the research of population genetic and organic evolution as genetic marker.
In recent years, people have been developed many methods that are used to seek molecular genetic marker, and modal have single-strand conformation polymorphism technology (SSCP), PCR-RFLP and a direct sequencing technologies etc., and it can find the base mutation of unknown position in the target dna fragment SSCP.Takao, less than the single base mutation in the dna fragmentation of 300bp, 90% can be found by SSCP through the experiment proof, he thinks that most available these methods of all single sequence changes that it is now know that detect.In addition, the SSCP method can be separated through the sudden change single stranded DNA of polyacrylamide gel electrophoresis with different mobilities, and can further purify.Can finally differentiate the mutant DNA fragment in this way from the dna sequence dna level.This method is easy, quick, sensitive, does not need special instrument.
Adducin is a kind of new cytolemma skelemin, is a kind of heterodimer protein of being made up of α and two subunits of β (hetero dimeric protein), is positioned at the connection section of spectrin-actin.Adducin optionally combines with the spectrin-actin mixture, and binding site is positioned at the afterbody of its α and β subunit, and avidity is apparently higher than with arbitrary spectrin or actin is monomeric combines (J Biol Chem, 1996).Electronic Speculum confirms, adducin also has the spectrin of promotion molecule and combines with the spectrin-actin mixture and form polygon reticulated structure, and promotion actin fiber polymeric function (J Biol Chem, 1998).Discovery adducin such as Kuhlman still had the function that stops the quick growing end of actin fiber (fast growing end) to extend in 1996, played capping protein, and its result makes actin staple length homogeneous, more helps the polymerization of actin fiber.Actin (Actin muscle) is a kind of important contractile protein, not only participates in Muscle contraction motion (Holmes, 1998 of myosin mediation; Pollard, 1990), and can transform (Pollard et al., 1982) mediated cell motion separately through modulated polymerization kinetics process (Smith, 1988) or gel one solution.Adducin makes up and keeps the cancellated function of cytolemma skeleton except that having, and in cell signalling and cytolemma ion transport, also plays an important role.Tripodi equals the rat renal tubular epithelial cells of carrying out (NRK252E) transfection in 1996 test and further confirms; Compare with the cell of transfection MNScDNA; Carry the maximum transport faster of the transfectional cell sodium pump of sudden change cDNA; And the polymerization of actin and sudden change adducin obviously strengthens, and prompting adducin transgenation has significant changing function.Adducin participates in the chromosomal reduction division of oocyte of mouse, points out it in fetal development, possibly play a role.Research on pig shows that the gene of coding Actin muscle (Actin) and skin rate, the shoulder thickness of backfat, fat meat rate, lean ratio, the average thickness of backfat of buttocks, eye muscle height, biceps muscle of thigh pH and intramuscular fat have certain dependency.
At present, the research of ADD1 gene is focused on people and the mouse, and be the research with the relation of hypertension incidence.But the result of study to relevant ADD1 genovariation and hypertension incidence relation is quite inconsistent.Research about ADD1 gene and Growth Traits does not have report as yet, based on the achievement in research of Actin muscle, will further inquire into the function of adducin (cytolemma skelemin).
Summary of the invention
The problem that the present invention solves is to utilize the PCR product to mix the pleomorphism site of the method examination ox ADD1 gene of order-checking, and a kind of examination and detection method of ox ADD1 gene pleiomorphism is provided.Seek the SNP relevant as molecule marker through association analysis,, accelerate fine-variety breeding speed and improve the population quality with the mark of function SNP as ox molecular breeding and assisted Selection with the ox growth traits.
The present invention realizes through following technical scheme:
A kind of SNP of ox ADD1 gene, its gene mononucleotide polymorphism comprises:
The 70027th of the ADD1 of ox gene is the nucleotide polymorphisms of G or A;
The 70051st of the ADD1 of ox gene is the nucleotide polymorphisms of G or A.
The detection method of the SNP of said ox ADD1 gene may further comprise the steps:
Ox complete genome DNA to be measured to comprise the ADD1 gene is a template, is primer with primer to P, pcr amplification ox ADD1 gene; Described primer to P is:
Upstream primer: 5 ' ATAGTCATCTGACCTGCTTGA3 '
Downstream primer: 5 ' AGCGGTGACCACATTCTTA3 ';
Pcr amplification carries out agarose gel electrophoresis after accomplishing, and that carries out the PCR product then cuts glue recovery and purifying, order-checking;
Carrying out PCR-SSCP at last detects: at first the PCR product to purifying carries out denaturing treatment with denaturing agent respectively, judges its polymorphum according to the polyacrylamide gel electrophoresis result then, and said polymorphum comprises:
The 70027th of the ADD1 of ox gene is the nucleotide polymorphisms of G or A;
The 70051st of the ADD1 of ox gene is the nucleotide polymorphisms of G or A.
The detection method of the SNP of described ox ADD1 gene, the response procedures of described pcr amplification is: 95 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45s, 58 ℃ of annealing 50s, 72 ℃ are extended 1min, 32 circulations, last 72 ℃ are extended 10min, 4 ℃ of preservations.
The detection method of the SNP of described ox ADD1 gene, said polyacrylamide gel electrophoresis adopts 10% polyacrylamide gel.
The present invention utilizes the PCR-SSCP method possibly produce the SNP that the proteins encoded conformation changes to the missense mutation on ox ADD1 gene the 8th exon 7 0027 and 70051 sites and detects.
The present invention has carried out gene type and gene frequency analysis to 3 above-mentioned two SNP of ox kind, simultaneously also to having carried out association analysis between SSCP polymorphic site and the ox growth traits.
Compared with prior art; The present invention mixes order-checking examination SNP to the PCR product and PCR-SSCP combines the unstable that has solved SSCP; In case the omission in mutational site; Provide a kind of usefulness simple, fast, low-cost, tolerance range is high, examination on dna level easy to utilize and detection and the closely-related genetic marker of ox growth traits can be used for assisted Selection and the molecular breeding of ox.
Description of drawings
Fig. 1 is a techniqueflow synoptic diagram of the present invention;
Fig. 2 is that the PCR product mixes 70027 G-A sudden changes of ox ADD1 gene order sequencing result figure that the order-checking examination is arrived among the present invention;
Fig. 3 is that the PCR product mixes 70051 G-A sudden changes of ox ADD1 gene order sequencing result figure that the order-checking examination is arrived among the present invention;
Fig. 4 is the agarose gel electrophoresis that the present invention is used for detecting PCR product clip size;
Fig. 5 is the polyacrylamide gel electrophoresis that the present invention is used for detecting each sample sudden change situation.
Embodiment
The present invention is at first according to ADD1 gene conservative sequences Design primer, and the genomic dna with 3 kinds of ox kinds is a template respectively, carries out pcr amplification, mixes the PCR product and to its purifying, order-checking.Then, carry out the sequencer map analysis and the sequence alignment examination goes out the SNP site; Secondly, colony to be measured is carried out the PCR-SSCP detection of polymorphic site; At last,, carry out the association analysis of population genetic statistical study and growth traits, filter out and the closely-related molecule marker of ox growth traits according to detected genotype in colony.Elaborate in the face of the present invention down, said is to explanation of the present invention rather than qualification.
The clone of a, local ox kind ADD1 Gene Partial dna sequence dna
1, the collection of blood sample and processing
Blood sampling 10mL adds the EDTA 500 μ L anti-freezings of 0.5mol/L, puts into ice chest after slowly putting upside down 3 times, and-80 ℃ of preservations are subsequent use.
This institute is specially with 555 parts of ox blood sample sums:
1) 374 parts of blood samples of the red ox in Jiaxian County pick up from the red ox in Jiaxian County, Pingdingshan City, Henan Province and protect kind of a district;
2) ox blood appearance in Qin Chuan is picked up from Nanyang City, Henan Province ox seed stock breeding station for 116 parts;
3) western Shandong ox blood appearance is 65 parts, picks up from the cattle farm, Shandong.
2, the extraction of blood sample genomic dna
(1) freezing blood sample room temperature is thawed, transferase 45 00 μ L to 1.5mL Eppendorf pipe adds equal-volume PBS damping fluid, abundant mixing, and the centrifugal 10min of 12000r/min (4 ℃), abandoning supernatant, repetition above-mentioned steps to supernatant is transparent, deposition is faint yellow.
(2) in centrifuge tube, add DNA extraction buffer 500 μ L, shake, make the hemocyte deposition break away from centrifuge tube tube wall, 37 ℃ of water-bath 1h.The SDS of the Tris of the preparation of DNA extraction buffer: 0.6057g, the EDTA of 18.612g and 2.5g adds ultrapure water 500mL, sterilization, accent pH to 8.0, and 4 ℃ of preservations are subsequent use.
(3) add Proteinase K 3 μ L (20mg/mL) and mixings, 55 ℃ are spent the night to clarification, and defecator not can add 1 μ L Proteinase K mixing and continue digestion to clarification as yet.
(4) reaction solution is cooled to room temperature, adds the saturated phenol 500 μ L of Tris-, gentleness is shaken centrifuge tube 20min, makes its abundant mixing, and 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to, repeats once.
(5) add chloroform 500 μ L, abundant mixing 20min, 4 ℃, the centrifugal 10min of 12000r/min changes supernatant in another 1.5mL centrifuge tube over to.
(6) add the NaAc damping fluid of 0.1 times of volume and the ice-cold absolute ethyl alcohol of 2 times of volumes, mix the rotation centrifuge tube and separate out, preserve 30～60min for-20 ℃ until the flocks of white.
(7) 4 ℃, the centrifugal 10min of 12000r/min abandons supernatant, the ice-cold ethanol rinsing DNA deposition with 70% 2 times.
(8) 4 ℃, the centrifugal 10min of 12000r/min abandons supernatant, makes the ethanol volatilization clean under the room temperature.(9) dried DNA is dissolved in TE-damping fluid or the ultrapure water of 80～100 μ L, and 4 ℃ of preservations are dissolved until DNA fully, and 0.8% agarose gel electrophoresis detects its quality ,-80 ℃ of preservations.
3, amplimer design
GenBank accession number according to (http://www.ncbi.nlm.nih.gov/) ox in the ncbi database is: the exon 8DNA sequence of the ADD1 gene of NC_007304; With this gene order conserved regions sequence serves as right with reference to utilizing Primer 5.0 to design the PCR primers, and its primer is following to sequence:
Upstream primer: 5 ' ATAGTCATCTGACCTGCTTGA3 '
Downstream primer: 5 ' AGCGGTGACCACATTCTTA3 '
This primer amplification ox ADD1 gene the 8th exon region and a part of intron zone.
4, pcr amplification ADD1 gene extron 8
DNA with 3 ox kinds is a masterplate respectively, and to carrying out pcr amplification, PCR total reaction system is 15 μ L, sees table 1 with above-mentioned designed primer; The total return preface of PCR is seen table 2.
Table 1PCR reaction system
| The system composition | Volume (μ L) |
| The PCR damping fluid | 1.50 |
| dNTP(2mmol/L) | 0.30 |
| Upstream primer (10pmol/ μ L) | 0.30 |
| Downstream primer (10pmol/ μ L) | 0.30 |
| Taq archaeal dna polymerase (2.5U/ μ L) | 0.30 |
| Dna profiling (50ng/ μ L) | 1.00 |
| Sterilization ultrapure water (H 2O) | 11.30 |
| TV | 15.00 |
Table 2PCR response procedures
5, PCR product purification and order-checking
After accomplishing, pcr amplification carries out agarose gel electrophoresis; The glue of cutting that carries out the PCR product then reclaims and purifying: under uv lamp, contain the segmental gel of purpose from the sepharose cutting-out; Put into the 1.5mL centrifuge tube; Reclaim purification kit (sky, Beijing root biotech firm) purified pcr product with the PCR product then, according to the operation of test kit specification sheets, concrete steps are following:
1) at first in adsorption column, add 500 μ L balance liquid BL, the centrifugal 1min of 12000r/min outwells the waste liquid in the collection tube, adsorption column is relay reclaim in the collector.
2) single target DNA band is downcut from sepharose put into clean centrifuge tube, take by weighing weight.
3) in blob of viscose, add equal-volume solution PC, 60 ℃ of water-baths are placed about 10min, constantly leniently spin upside down centrifuge tube therebetween, fully dissolve to guarantee blob of viscose.
4) will go up a step gained solution and add in the adsorption column, the centrifugal 1min of 12000r/min outwells the waste liquid in the collection tube, and adsorption column is reentered in the collection tube.
5) in adsorption column, add 700 μ L rinsing liquids, the centrifugal 1min of 12000r/min outwells waste liquid, and adsorption column is reentered in the collection tube.
6) in adsorption column, add 500 μ L rinsing liquids, the centrifugal 1min of 12000r/min outwells waste liquid, and centrifugal adsorption column is put into collection tube, and the centrifugal 2min of 12000r/min removes rinsing liquid as far as possible.Adsorption column is placed room temperature or 50 ℃ of incubator numbers minute, thoroughly dry.
7) adsorption column is put in the clean centrifuge tube, to an amount of elution buffer of the unsettled dropping in adsorption film mid-way, room temperature is placed 2min.The centrifugal 1min of 12000r/min collects dna solution.
8) in order to improve the yield of DNA, can be with in the centrifugal solution that the obtains centrifugal adsorption column of add-back again, repeating step 7.
Serve marine life Engineering Co., Ltd to above 3 kind pcr amplification products mixing and carry out the forward order-checking.Peak figure analyzes to order-checking, and what wherein in same site two different peaks are arranged is that single nucleotide mutation has taken place; GA as among Fig. 2 GA bimodal, that Fig. 3 occurred is bimodal to be 2 SNP sites that ox ADD1 gene has been arrived in examination, lays respectively at the 70027th of ox ADD1 gene and the 70051st.
The PCR-SSCP of b, ox ADD1 gene pleiomorphism detects
1, PCR reaction conditions
PCR product amplification system and reaction conditions are of previous table 1 and table 2 respectively, and 1.0% agarose gel electrophoretogram of pcr amplification product is as shown in Figure 4, can see the band of 262bp clearly.
2, PCR-SSCP detects
Carry out denaturing treatment with denaturing agent at first respectively for the product behind the pcr amplification, judge its polymorphum according to the polyacrylamide gel electrophoresis result then.
130V voltage electrophoresis 17h, silver dyes the detection electrophoresis result, take a picture to analyze with Bio-RAD gel imaging analysis system, and declares type, writes down its genotype.
Because ox is the diploid animal, when undergoing mutation, can form the different gene type; Can differentiate through polyacrylamide gel electrophoresis figure; As shown in Figure 5, three kinds of genotype are distinguished, can judge according to the number of band whether point mutation has taken place; Three kinds of genotype are distinguished, thereby detect its SNP polymorphum.
The diagnostic use of the molecule marker of c, the present invention preparation in different ox colony polymorphum
1, the diagnosis in colony's polymorphum
Utilize above-mentioned SNP pleiomorphism detecting method that 65 parts of DNA samples of western Shandong ox, 116 parts of DNA samples of Qin Chuan ox, 374 parts of DNA sample gene of the red ox in Jiaxian County type are carried out acrylamide gel electrophoresis respectively.
2, the frequency statistics analysis in SNP site
Genotype frequency is meant that certain genotype number of individuals of a certain proterties in the colony accounts for the ratio of total individual number.P
AA=N
AA/ N, wherein P
AARepresent the AA genotype frequency in a certain site; N
AAHas the genotypic number of individuals of AA in the expression colony; N is for detecting the total quantity of colony.
Gene frequency is meant that a certain gene number is to the relative ratios of its allelotrope sum in the colony.The formula that calculates can be write as: P
A=(2N
AA+ N
Aa1+ N
Aa2+ ...+N
Aan)/2N.In the formula, P
AExpression allelotrope A frequency, N
AAHas the genotypic individual amount of AA, N in the expression colony
AaiHave Aai genotype individual amount in the expression colony, a1-an is n the different multiple allelomorphos of allelotrope A.Statistics is seen table 3.
The genotype and the gene frequency of two polymorphic sites of ADD1 gene in three ox kinds of table 3
3, the association analysis of genetic effect
Adopt SPSS (17.0) statistical software, to main characteristics record wherein than the different genotype of more comprehensive Qin Chuan ox individual with the body footage according to having carried out test of significance.(seeing table 4).
1) the main proterties of measuring comprises: height, and body is long, body weight, chest measurement, point of the buttocks is wide.
2) colony that measures: 116 altogether of Qin Chuan cows bodies, sample and data information are all from Nanyang City, Henan Province ox seed stock breeding station.
3) the general linear model of association analysis: call SPSS 17.0 software general linear model GLM (general linear models procedure) each genotype is carried out test of significance to the influence of growth traits.Its body situation according to this experiment is set up following statistical model:
Y
ijk＝μ+A
i+G
j+E
ijk，
Wherein: Y
Ijk: individual phenotype record; μ: population mean; A
i: age effect; G
j: the genotype effect; E
Ijk: error immediately.
The result sees table 4: can find out that from table 4 body weight of genotype BB is significantly higher than pure and mild frequency of genotypes AA (P＜0.05).
In these several indexs, the genotypic value of BB all is higher than the AA type, therefore, and the red ox ADD1 in Jiaxian County
The BB type of undergoing mutation in the transgenation polymorphic site is a preponderant genotype, and this possibly be actin and the polymerization of sudden change adducin obviously strengthens, and prompting adducin transgenation has the variation that significant changing function finally causes body weight and body chi proterties.Thus, in breeding work from now on, should select the individuality of ox ADD1 transgenation, accelerate to have the foundation of high-quality economic characters ox population.
The association analysis of table 4 Nanyang Cattle ADD1 transgenation polymorphum and growth traits
Annotate: have same letter and represent difference not remarkable (P＞0.05), alphabetical different table differential different significantly (P＜0.05).
Claims (4)
1. the SNP sequence of an ox ADD1 gene is characterized in that, its gene mononucleotide polymorphism sequence comprises:
The 70027th of the ADD1 of ox gene is the nucleotide polymorphisms sequence of G or A;
The 70051st of the ADDl of ox gene is the nucleotide polymorphisms sequence of G or A.
2. the detection method of the SNP sequence of the said ox ADD1 of claim 1 gene is characterized in that, may further comprise the steps:
Ox complete genome DNA to be measured to comprise the ADD1 gene is a template, is primer with primer to P, pcr amplification ox ADD1 gene; Described primer to P is:
Upstream primer: 5 ' ATAGTCATCTGACCTGCTTGA3 '
Downstream primer: 5 ' AGCGGTGACCACATTCTTA3 ';
Pcr amplification carries out agarose gel electrophoresis after accomplishing, and that carries out the PCR product then cuts glue recovery and purifying, order-checking;
Carrying out PCR-SSCP at last detects: at first the PCR product to purifying carries out denaturing treatment with denaturing agent respectively, judges its polymorphum according to the polyacrylamide gel electrophoresis result then, and said polymorphic sequence comprises:
The 70027th of the ADD1 of ox gene is the nucleotide polymorphisms sequence of G or A;
The 70051st of the ADDl of ox gene is the nucleotide polymorphisms sequence of G or A.
3. the detection method of the SNP sequence of ox ADD1 gene as claimed in claim 2 is characterized in that, the response procedures of described pcr amplification is: 95 ℃ of preparatory sex change 4min; 94 ℃ of sex change 45s, 58 ℃ of annealing 50s, 72 ℃ are extended 1min, 32 circulations, last 72 ℃ are extended 10min, 4 ℃ of preservations.
4. the detection method of the SNP sequence of ox ADD1 gene as claimed in claim 2 is characterized in that, said polyacrylamide gel electrophoresis adopts 10% polyacrylamide gel.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105315546A CN102031304B (en) | 2010-11-04 | 2010-11-04 | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010105315546A CN102031304B (en) | 2010-11-04 | 2010-11-04 | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102031304A CN102031304A (en) | 2011-04-27 |
| CN102031304B true CN102031304B (en) | 2012-07-04 |
Family
ID=43884756
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010105315546A Expired - Fee Related CN102031304B (en) | 2010-11-04 | 2010-11-04 | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102031304B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102363803A (en) * | 2011-05-09 | 2012-02-29 | 西北农林科技大学 | Method for detecting linked mutation of AMPD1 gene of Qinchuan cattle |
| CN102533774A (en) * | 2011-12-19 | 2012-07-04 | 西北农林科技大学 | Single nucleotide polymorphism sequence of dairy cattle FGF2 (Fibroblast Growth Factor 2) gene and detection method of single nucleotide polymorphism sequence |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1279167C (en) * | 2004-04-22 | 2006-10-11 | 上海交通大学 | Gene oder of directivity and differentiation factor 1 fat cell of pigs |
| WO2008060618A2 (en) * | 2006-11-15 | 2008-05-22 | University Of Florida Research Foundation | Use of genetic determinants in cardiovascular risk assessment |
-
2010
- 2010-11-04 CN CN2010105315546A patent/CN102031304B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1279167C (en) * | 2004-04-22 | 2006-10-11 | 上海交通大学 | Gene oder of directivity and differentiation factor 1 fat cell of pigs |
| WO2008060618A2 (en) * | 2006-11-15 | 2008-05-22 | University Of Florida Research Foundation | Use of genetic determinants in cardiovascular risk assessment |
Non-Patent Citations (1)
| Title |
|---|
| 李长龙.《猪脂肪细胞决定和分化因子1基因（ADD1）中一个新SNP的特性及其对肉质性状影响》.《农业生物技术学报》.2010,第18卷(第4期),725-731. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102031304A (en) | 2011-04-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112662788B (en) | SNP marker related to milk production traits of Holstein cows in south China and application thereof | |
| CN103290123B (en) | Detecting method and kit of cattle IGF2 (Insulin-like Growth Factor 2) gene mononucleotide polymorphism | |
| CN113789394B (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN101921857B (en) | PCR-RFLP test method for mononucleotide polymorphism of Chinese local cattle Pax7 gene | |
| CN101899526B (en) | Method for selecting molecular marker for goat yeaning traits | |
| CN102031304B (en) | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof | |
| CN102703440A (en) | Goat SH2B1 gene single nucleotide polymorphism loci and detection method thereof | |
| CN101906480B (en) | Molecular marking method of using neuroendocrine factor genes to select kidding characters | |
| US20220411882A1 (en) | Snp molecular marker for weight gain trait selection and genetic sex identification of ictalurus punctatus as well as screening method and application of snp molecular marker | |
| CN102816759A (en) | Detection method for single nucleotide polymorphism of STMN1 gene of Beijing duck and molecular markers thereof | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN104498610A (en) | RFLP method and kit for detecting SNP locus of MEF2C gene of cattle | |
| CN101899500B (en) | Method for detecting single nucleotide polymorphism of cattle krupple-like factor (KLF) 7 gene | |
| CN110438245B (en) | SNP (single nucleotide polymorphism) marker of clam and application thereof | |
| CN101962684B (en) | Single nucleotide polymorphism for cattle PCSK1 gene and detection method thereof | |
| CN100503839C (en) | Method for detecting CVM deleterious gene of oxen | |
| CN103725688A (en) | Molecular markers related with antibody level of newcastle disease virus as well as identification method and application of molecular markers | |
| CN103695416A (en) | Mononucleotide polymorphism detection method of Qinchuan cattle CFL2 gene and application thereof | |
| CN114262741A (en) | SNP molecular marker related to disease resistance traits of silurus meridionalis and application thereof | |
| CN104450934A (en) | Detection method and detection kit for goat LMCD1 gene mononucleotide polymorphism sites | |
| CN102839170A (en) | Single nucleotide polymorphism of microRNA-431 genes associated with lactation yield of dairy goats and detection and application thereof | |
| CN104450933A (en) | Detection method and kit for single nucleotide polymorphism site of goat LYRM1 (LYR motif-containing protein 1) gene | |
| CN102649957A (en) | Single nucleotide polymorphic locus of langshan chicken POU1F1 gene, and detection method for single nucleotide polymorphic locus | |
| CN101671725B (en) | Method for detecting inserting mutation polymorphism of ox NPM1 gene | |
| KR101584601B1 (en) | Genetic marker for prediction of marbling score in Hanwoo |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20120704 Termination date: 20121104 |