CN104450934A - Detection method and detection kit for goat LMCD1 gene mononucleotide polymorphism sites - Google Patents
Detection method and detection kit for goat LMCD1 gene mononucleotide polymorphism sites Download PDFInfo
- Publication number
- CN104450934A CN104450934A CN201410812130.5A CN201410812130A CN104450934A CN 104450934 A CN104450934 A CN 104450934A CN 201410812130 A CN201410812130 A CN 201410812130A CN 104450934 A CN104450934 A CN 104450934A
- Authority
- CN
- China
- Prior art keywords
- goat
- lmcd1
- gene
- primer
- site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection method and detection kit for goat LMCD1 gene mononucleotide polymorphism sites. The method comprises the following steps: by using to-be-detected goat genome DNA (deoxyribonucleic acid) of containing LMCD1 gene as a template, carrying out PCR (polymerase chain reaction) amplification on the goat LMCD1 gene, and carrying out SSCP (single strand conformation polymorphism) polymorphism detection. The gene polymorphism sites comprise the following base polymorphisms: the 681st site of the goat LMCD1 gene is A or G; and the 2825th site of the goat LMCD1 gene is C or T. The invention provides a simple quick low-cost high-precision detection method, which can be conveniently applied to screening and detecting of genetic markers closely related to goat growth traits at the DNA level and can be used for assisted selection and molecular breeding of goat.
Description
Technical field
The present invention relates to the detection of gene mononucleotide polymorphism (SNP), particularly the detection in goat LMCD1 gene mononucleotide polymorphism site.
Background technology
Single nucleotide polymorphism (SNP) refers to the polymorphism caused due to the replacement of single core thuja acid (A/T/C/G) in genomic dna sequence, caused by the conversion of single base or transversion.The SNPs with conversion hysteria variation accounts for 2/3, and other several SNP are in similar level.The cytosine(Cyt) of CpG dinucleotides is the site of the most easily undergoing mutation in genome, and wherein great majority are methylated, can spontaneously deaminize and form thymus pyrimidine.
According to the impact on inherited character, gene pleiomorphism can be divided into two kinds again: one is same sense mutation polymorphism, namely the change of encoding sequence caused by SNP does not affect its Amino Acids in Proteins sequence translated, and mutating alkali yl is identical with " implication " of non-mutating alkali yl; Another kind is nonsynonymous mutation polymorphism, and namely the change of base sequence will cause the change of coded amino acid, thus produces the change of protein sequence, finally may have influence on the function of protein.Therefore, concerning the nonsynonymous mutation of coding region SNPs, they may have direct material impact to gene function; Especially for nonsense codon sudden change, more may cause coded albumen generation significant change, thus affect its Function, material impact is produced to the phenotype of individuality.Moreover, in population genetic research, these SNPs are also significant in the research of population genetic and organic evolution as genetic marker.
In recent years, people have developed many methods for seeking molecular genetic marker, and modal have single-strand conformation polymorphism technology (SSCP), PCR-RFLP and direct Sequencing technology etc.SSCP can find the base mutation of unknown position in target dna fragment.Takao the experiment proved that the single base mutation be less than in the DNA fragmentation of 300bp, and 90% can be found by SSCP, and he thinks that most available the method for all single sequence change that it is now know that detects.In addition, the sudden change single stranded DNA of different mobility is separated by polyacrylamide gel electrophoresis by SSCP method, and can purify further.Finally can differentiate mutated DNA fragment from DNA sequence dna level in this way.The method is easy, quick, sensitive, does not need special instrument.
LIM domain protein is the main component of cell regulate and control structure, cell growth, cell fate determine, cytodifferentiation and cytoskeleton be formed with vital role.LIM structural domain is a zinc fingers, is present in polytype albumen, comprises homologous structure domain transcription factor, kinases and the albumen be made up of several LIM structural domain.The regulation and control of this domain protein to muscle genes involved are worked, and LIM transgenation or defect cause histiocytic differentiation and the dysplasia such as muscle, nerve, cardiovascular and hypophysis.LMCD1 gene belongs to LIM domain protein gene, and in skeletal muscle, abundance is expressed, and shows that this gene may participate in skeletal muscle protein and interact.LMCD1 gene is the key signaling molecule worked to cardiac hypertrophy and cystic fibrosis.LMCD1 makes neurocalcin activate, the neurocalcin of activation directly combines with the T cell nf (NFAT) of activation, cause NFAT dephosphorylation and nuclear translocation, calcineurin Function protein 1 (MCIP1) be cardiomyopathy calcineurin/NFAT signal transduction directly transcribe target, NFAT and MCIP1 combines, and promotes the genetic expression causing cardiac hypertrophy.
At present, on pathology, study the cardiac fibers disease of mainly cardiac hypertrophy and the excessive induction of pressure load about LMCD1 gene, and cell migration and tumor metastasis in the hepatocellular carcinoma that causes of this genovariation.Show the back fat of the variation of this gene and pig, lean ratio and fat meat rate significant correlation about the research of LMCD1 gene on domestic animal, be conducive to breeding selection.The research of goat LMCD1 gene pleiomorphism and growth traits dependency thereof is not reported so far.Need badly at present and provide a kind of detection method to be that the foundation of LMCD1 gene SNP and body measurement trait relation is laid a good foundation, for use in the marker assisted selection (MAS) of Chinese Goat growth traits, set up the goat population that genetic resources is excellent fast.
Summary of the invention
The object of the present invention is to provide a kind of detection method and detection kit of goat LMCD1 gene mononucleotide polymorphism site, to accelerate fine-variety breeding speed and to improve population quality.
For achieving the above object, present invention employs following technical scheme:
The detection method in goat LMCD1 gene mononucleotide polymorphism site, comprises the following steps:
(1) with goat complete genome DNA to be measured for template, with primer pair P1 or primer pair P2 for primer, correspondingly in pcr amplification goat LMCD1 gene comprise the partial sequence of the 681st or comprise the partial sequence of 2825;
Described primer pair P1 is:
Upstream primer P1a (SEQ.ID.NO.1): 5 ' CCTTCAGGAGCGTTTGGACT 3 '
Downstream primer P1b (SEQ.ID.NO.2): 5 ' GCACAACTGGGCTTTGGATT 3 '
Described primer pair P2 is:
Upstream primer P2a (SEQ.ID.NO.3): 5 ' GGTCCTCACCTCATCACAGC 3 '
Downstream primer P2b (SEQ.ID.NO.4): 5 ' ACTTCAGTCCTCACAACTCCCT 3 '
(2) carry out SSCP detection to pcr amplification product: pcr amplification product carries out polyacrylamide gel electrophoresis after denaturing agent denaturing treatment, then judge the genotype of pleomorphism site according to polyacrylamide gel electrophoresis result, described pleomorphism site is:
In the nucleotide polymorphisms site that the LMCD1 gene the 681st of goat is A or G, show as AA and AG two kinds of genotype;
In the nucleotide polymorphisms site that the LMCD1 gene the 2825th of goat is C or T, show as CC and CT two kinds of genotype.
The response procedures of described pcr amplification is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of annealing 40s, 72 DEG C extend 40-60s, 35 circulations; Last 72 DEG C extend 10min, 4 DEG C of preservations.
Described polyacrylamide gel electrophoresis adopts the polyacrylamide gel of 10%.
The test kit in goat LMCD1 gene mononucleotide polymorphism site, comprises primer pair P1 or primer pair P2, and described primer pair P1 is:
Upstream primer P1a (SEQ.ID.NO.1): 5 ' CCTTCAGGAGCGTTTGGACT 3 '
Downstream primer P1b (SEQ.ID.NO.2): 5 ' GCACAACTGGGCTTTGGATT 3 '
Described primer pair P2 is:
Upstream primer P2a (SEQ.ID.NO.3): 5 ' GGTCCTCACCTCATCACAGC 3 '
Downstream primer P2b (SEQ.ID.NO.4): 5 ' ACTTCAGTCCTCACAACTCCCT 3 '
Compared with prior art, the invention provides a kind of simple, fast, goat LMCD1 gene polymorphism sites detection method that low cost, tolerance range are high, examination on DNA level easy to utilize and detection and the closely-related genetic marker of goat growth trait, can be used for assisted Selection and the molecular breeding of goat, to accelerate fine-variety breeding speed and to improve population quality.
Accompanying drawing explanation
Fig. 1 is that primer P1 increases different goat individuality (goat LMCD1 gene the 681st polymorphic site) PCR primer agarose gel electrophoresis figure;
Fig. 2 is that primer P2 increases different goat individuality (goat LMCD1 gene the 2825th polymorphic site) PCR primer agarose gel electrophoresis figure;
Fig. 3 is goat LMCD1 gene order the 681st A-G sudden change sequencing result figure that in the present invention, PCR primer mixing order-checking examination is arrived;
Fig. 4 is goat LMCD1 gene order the 2825th C-T sudden change sequencing result figure that in the present invention, PCR primer mixing order-checking examination is arrived;
Fig. 5 is goat LMCD1 gene of the present invention 681st polymorphic site polyacrylamide gel electrophoresis figure;
Fig. 6 is goat LMCD1 gene of the present invention 2825th polymorphic site polyacrylamide gel electrophoresis figure.
Embodiment
Below in conjunction with drawings and Examples, the present invention is further illustrated.
The present invention first according to the conserved sequence of LMCD1 gene design primer, respectively with the genomic dna of 4 Goat Population in Yangtses for template, carry out pcr amplification, mixing PCR primer also to its purifying, order-checking.Then, sequencer map analysis is carried out and sequence alignment examination goes out SNP site; Secondly, colony to be measured is carried out to the PCR-SSCP detection of polymorphic site; Finally, according to the genotype detected in colony, carry out the association analysis of population genetic statistical study and body measurement trait, filter out molecule marker closely-related with goat body measurement trait.Elaborate to the present invention below, the explanation of the invention is not limited.
(1), the amplification of goat LMCD1 Gene Partial DNA sequence dna and the detection of polymorphism thereof
1, the sampling and processing of goat sample
Present invention employs 4 kinds of Goats Breeds and amount to 315 individualities, be specially: (1) boer goat blood sample 72 parts, pick up from Feng County, Xuzhou City of Jiangsu Province cooperation sheep stud; (2) XuHuai White Goat blood sample 81 parts, picks up from township of Tongshan County Lvliang City, Xuzhou City of Jiangsu Province; (3) Haimen goat blood sample 116 parts, picks up from Haimen, Nantong, Jiangsu Province; (4) boer goat × 46 parts, XuHuai White Goat ear tissue sample, picks up from Feng County, Xuzhou City of Jiangsu Province Liang Zhai cooperation sheep stud.Get goat blood sample 10mL, add the EDTA500 μ L anti-freezing of 0.5mol/L, put into ice chest after slowly putting upside down 3 times ,-80 DEG C save backup.Get ear tissue sample, preserve at 70% ethanol, ice chest low temperature takes back laboratory, and-80 DEG C save backup.
2, the extraction of genomic dna
(1) by freezing blood sample thaw at RT, transferase 45 00 μ L to 1.5mL Eppendorf manages, and adds equal-volume PBS damping fluid, abundant mixing, the centrifugal 10min of 12000r/min (4 DEG C), abandoning supernatant, repetition above-mentioned steps is transparent to supernatant liquor, precipitation is faint yellow.
(2) in centrifuge tube, add DNA extraction buffer 500 μ L, shake, hemocyte is precipitated and departs from centrifuge tube tube wall, 37 DEG C of water-bath 1h.The SDS of EDTA and 2.5g of Tris, 18.612g of the preparation of DNA extraction buffer: 0.6057g adds ultrapure water 500mL, and sterilizing, tune pH to 8.0,4 DEG C save backup.
(3) add Proteinase K 3 μ L (20mg/mL) and mix, 55 DEG C are spent the night to clarification, not yet defecator, can add 1 μ L Proteinase K mixing and continue digestion to clarification.
(4) reaction solution is cooled to room temperature, adds Tris-saturated phenol 500 μ L, gentle shake centrifuge tube 20min, make it fully mix, 4 DEG C, the centrifugal 10min of 12000r/min, proceeds to supernatant liquor in another 1.5mL centrifuge tube, repeats once.
(5) add chloroform 500 μ L, fully mix 20min, 4 DEG C, the centrifugal 10min of 12000r/min, supernatant liquor is proceeded in another 1.5mL centrifuge tube.
(6) add the NaAc damping fluid of 0.1 times of volume and the ice-cold dehydrated alcohol of 2 times of volumes, centrifuge tube is rotated in mixing until the flocks of white is separated out, and preserves 30 ~ 60min for-20 DEG C.
(7) 4 DEG C, the centrifugal 10min of 12000r/min, abandons supernatant, precipitates 2 times with the ice cold ethanol rinsing DNA of 70%.
(8) 4 DEG C, the centrifugal 10min of 12000r/min, abandons supernatant, makes ethanol volatilize clean under room temperature.
(9) dried DNA is dissolved in TE-damping fluid or the ultrapure water of 80 ~ 100 μ L, and preserve until DNA dissolves completely for 4 DEG C, 0.8% agarose gel electrophoresis detects its quality ,-80 DEG C of preservations.
Extraction reference Sambrock et al (2002) method of ear tissue DNA.
3, amplimer design
Owing to there is no goat LMCD1 gene order in GenBank, so, the present invention for reference with ox (GenBank:NC_007320.4) sequence, utilizes Primer 5.0 design to increase and comprises the PCR primer of goat LMCD1 gene the 5th intron and the 5th exon.
The primer of the 5th intron of increasing is:
Upstream primer: 5 ' CCTTCAGGAGCGTTTGGACT 3 '
Downstream primer: 5 ' GCACAACTGGGCTTTGGATT 3 '
The primer of the 5th exon of increasing is:
Upstream primer: 5 ' GGTCCTCACCTCATCACAGC 3 '
Downstream primer: 5 ' ACTTCAGTCCTCACAACTCCCT 3 '
Goat LMCD1 gene the 5th intron, the 5th exon subregion and a part of intron region with above-mentioned primer pair amplifies.
4, pcr amplification
Respectively with the DNA of 4 Goats Breeds for masterplate, carry out pcr amplification with the primer pair of above-mentioned design, PCR total reaction system is 15 μ L, in table 1; PCR total reaction program, in table 2.
Table 1 PCR reaction system of the present invention
| System composition | Volume (μ L) |
| 2×Buffer | 7.5 |
| Upstream primer (10pmol/L) | 0.6 |
| Downstream primer (10pmol/L) | 0.6 |
| Taq DNA polymerase (2.5U/ μ L) | 0.12 |
| Genomic dna (50ng/ μ L) | 0.6 |
| Sterilizing ultrapure water (H 2O) | 5.58 |
| Cumulative volume | 15.00 |
Table 2 PCR response procedures
5, PCR primer purifying and order-checking
Agarose gel electrophoresis is carried out after pcr amplification completes, as shown in Figure 1 and Figure 2, in Fig. 1, Fig. 2, M is Mark-D2000, then the glue of cutting carrying out PCR primer reclaims and purifying: under ultraviolet lamp, cut the gel containing object fragment from sepharose, gel containing object fragment is put into 1.5mL centrifuge tube, then reclaim purification kit (Beijing Tian Gen biotech firm) purified pcr product by PCR primer, according to the operation of test kit specification sheets, concrete steps are as follows:
1) in adsorption column, first add 500 μ L balance liquid BL, the centrifugal 1min of 12000r/min, outwells the waste liquid in collection tube, is placed back in collection tube by adsorption column.
2) single target DNA band is cut from sepharose put into clean centrifuge tube, take weight.
3) in blob of viscose, add equal-volume solution PC, about 10min is placed in 60 DEG C of water-baths, constantly leniently spins upside down centrifuge tube therebetween, to guarantee that blob of viscose fully dissolves.
4) add in an adsorption column by previous step gained solution, the centrifugal 1min of 12000r/min, outwells the waste liquid in collection tube, is reentered in collection tube by adsorption column.
5) in adsorption column, add 700 μ L rinsing liquids, the centrifugal 1min of 12000r/min, outwells waste liquid, is reentered in collection tube by adsorption column.
6) in adsorption column, add 500 μ L rinsing liquids, the centrifugal 1min of 12000r/min, outwells waste liquid, centrifugal adsorbing column is put into collection tube, and the centrifugal 2min of 12000r/min, removes rinsing liquid as far as possible.Adsorption column is placed in room temperature or 50 DEG C of incubator numbers minute, thoroughly dries.
7) be put into by adsorption column in a clean centrifuge tube, to the elution buffer that the unsettled dropping in adsorption film mid-way is appropriate, room temperature places 2min.The centrifugal 1min of 12000r/min collects DNA solution.
8) in order to improve the yield of DNA, can by the centrifugal solution obtained again add-back centrifugal adsorbing column, repeating step 7.
Marine life Engineering Co., Ltd is served in above 4 kind pcr amplification products mixing and carries out forward order-checking.Analyze order-checking peak figure, what wherein have two different peaks in same site is there occurs single nucleotide mutation; As bimodal in the AG in Fig. 3, Fig. 4 bimodal 2 SNP being examination and having arrived goat LMCD1 gene of CT that occur, lay respectively at: goat LMCD1 gene the 681st and the 2825th.
(2), the PCR-SSCP of goat LMCD1 gene pleiomorphism detects
1, PCR reaction conditions
PCR primer amplification system and reaction conditions are respectively as described in table 1 above and table 2, and as shown in Figure 1 and Figure 2, in figure, M is Mark-D2000 to 1.0% agarose gel electrophoretogram of pcr amplification product, and follow-up swimming lane can see the band of 460bp and 426bp clearly.
2, PCR-SSCP detects
First (getting 4 μ L PCR primer with 6 μ L SSCP denaturing agents mixes to use respectively denaturing agent (as blue or green in methane amide, 0.5mol/L EDTA (pH 8.0), glycerine, 0.025% dimethylbenzene or 0.025% tetrabromophenol sulfonphthalein etc.) to carry out denaturing treatment for the product after pcr amplification, 98 DEG C of sex change 10min, ice bath 5min again), then judge its polymorphism according to polyacrylamide gel electrophoresis result.
130V electrophoresis 15h, silver dye detects electrophoresis result, with Bio-RAD Labworks image acquisition and analysis software PHOTOGRAPHIC ANALYSIS, and sentences type, records its genotype.
Because goat is diploid animal, when undergoing mutation, three kinds of different genotype can be formed, can be differentiated by polyacrylamide gel electrophoresis figure, can determine whether to there occurs point mutation according to the number of band, different genotype is distinguished, thus detect its SNP polymorphism.Result shows, and in the genotype (AA, AG) that the 681st appearance two kinds is different, occurs two kinds of genotype (CC, CT), as shown in Figure 5 and Figure 6 at the 2825th.
(3), the diagnostic use of molecule marker in different Goat Population in Yangtse polymorphism prepared of the present invention
1, the diagnosis in colony's polymorphism
The DNA sample genotype of above-mentioned SNP pleiomorphism detecting method to boer goat 72 parts of DNA sample, XuHuai White Goat 81 parts of DNA sample, Haimen goat 116 parts of DNA sample, boer goat × XuHuai White Goat 46 parts is utilized to carry out acrylamide gel electrophoresis respectively.
2, the frequency statistics analysis of SNP site
Genotype frequency refers to that in a colony, certain genotype individuals number of a certain proterties accounts for the ratio of total individual number.P
aA=N
aA/ N, wherein P
aArepresent the AA genotype frequency in a certain site; N
aArepresent in colony that there is the genotypic number of individuals of AA; N is the total quantity detecting colony.
Gene frequency refers to that in a colony, a certain gene number is to the relative ratios of its allelotrope sum.The formula calculated can be write as: P
a=(2N
aA+ N
aa1+ N
aa2+ ... + N
aan)/2N.In formula, P
arepresent allelotrope A frequency, N
aArepresent in colony to there is the genotypic individual amount of AA, N
aairepresent in colony to have Aai genotype individuals quantity, a1-an is the multiple allelomorphos that n of allelotrope A is different.Statistics is in table 3.
The genotype of LMCD1 gene two polymorphic sites and gene frequency in table 3 four Goats Breeds
3, the association analysis of genetic effect
Adopt SPSS 17.0 (Statistical Product and Service Solutions, Version 17.0Edition) statistical software, to the different genotype of four Goats Breeds, individual and body measurement trait data have carried out test of significance (see table 4).
1) major traits measured comprises: height, and body is long, chest measurement, circumference of cannon bone.
2) colony measured: four Goats Breeds totally 315.
3) model of association analysis general linear: call SPSS 17.0 software general linear model GLM (general linear models procedure) and on the impact of body measurement trait, test of significance is carried out to each genotype.Particular case according to this experiment sets up following statistical model:
Y
ijk＝μ+A
i+G
j+E
ijk,
Wherein: Y
ijk: individual phenotype record; μ: population mean; A
i: age effect; G
j: genotype effects; E
ijk: error immediately.
The results are shown in Table 4: can boer goat colony from table 4, the individual height pole of LMCD1 gene the 681st genotype AG is significantly higher than homozygous genotype AA (P<0.05).Except bohr × XuHuai White Goat in four Goat Population in Yangtses, the individual height of the 2825th genotype CT is significantly higher than homozygous genotype CC (P<0.05 or P<0.01).
Therefore, in breeding work from now on, goat LMCD1 genotype should be selected to be the mutated individual of CT, accelerate the foundation with Quality and economy proterties goat population.
The association analysis of LMCD1 transgenation polymorphism and body measurement trait in table 4 four Goats Breeds
Claims (4)
1. the detection method in goat LMCD1 gene mononucleotide polymorphism site, is characterized in that: comprise the following steps:
(1) with goat complete genome DNA to be measured for template, with primer pair P1 or primer pair P2 for primer, correspondingly in pcr amplification goat LMCD1 gene comprise the partial sequence of the 681st or comprise the partial sequence of 2825;
Described primer pair P1 is:
Upstream primer P1a:5 ' CCTTCAGGAGCGTTTGGACT 3 '
Downstream primer P1b:5 ' GCACAACTGGGCTTTGGATT 3 '
Described primer pair P2 is:
Upstream primer P2a:5 ' GGTCCTCACCTCATCACAGC 3 '
Downstream primer P2b:5 ' ACTTCAGTCCTCACAACTCCCT 3 '
(2) carry out SSCP detection to pcr amplification product: pcr amplification product carries out polyacrylamide gel electrophoresis after denaturing agent denaturing treatment, then judge the genotype of pleomorphism site according to polyacrylamide gel electrophoresis result, described pleomorphism site is:
In the nucleotide polymorphisms site that the LMCD1 gene the 681st of goat is A or G, show as AA and AG two kinds of genotype;
In the nucleotide polymorphisms site that the LMCD1 gene the 2825th of goat is C or T, show as CC and CT two kinds of genotype.
2. the detection method in goat LMCD1 gene mononucleotide polymorphism site as claimed in claim 1, is characterized in that: the response procedures of described pcr amplification is: 94 DEG C of denaturation 5min; 94 DEG C of sex change 30s, 58 DEG C of annealing 40s, 72 DEG C extend 40-60s, 35 circulations; Last 72 DEG C extend 10min.
3. the detection method in goat LMCD1 gene mononucleotide polymorphism site as claimed in claim 1, is characterized in that: described polyacrylamide gel electrophoresis adopts the polyacrylamide gel of 10%.
4. the test kit in goat LMCD1 gene mononucleotide polymorphism site, is characterized in that: comprise primer pair P1 or primer pair P2, and described primer pair P1 is:
Upstream primer P1a:5 ' CCTTCAGGAGCGTTTGGACT 3 '
Downstream primer P1b:5 ' GCACAACTGGGCTTTGGATT 3 '
Described primer pair P2 is:
Upstream primer P2a:5 ' GGTCCTCACCTCATCACAGC 3 '
Downstream primer P2b:5 ' ACTTCAGTCCTCACAACTCCCT 3 '
。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410812130.5A CN104450934B (en) | 2014-12-22 | 2014-12-22 | The detection method and detection kit in goat LMCD1 gene mononucleotide polymorphisms site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410812130.5A CN104450934B (en) | 2014-12-22 | 2014-12-22 | The detection method and detection kit in goat LMCD1 gene mononucleotide polymorphisms site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104450934A true CN104450934A (en) | 2015-03-25 |
| CN104450934B CN104450934B (en) | 2018-08-17 |
Family
ID=52897679
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410812130.5A Expired - Fee Related CN104450934B (en) | 2014-12-22 | 2014-12-22 | The detection method and detection kit in goat LMCD1 gene mononucleotide polymorphisms site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104450934B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923332A (en) * | 2019-12-06 | 2020-03-27 | 江苏省农业科学院 | Molecular marker influencing early growth of sheep, detection method and application thereof |
| CN110938705A (en) * | 2019-12-12 | 2020-03-31 | 江苏省农业科学院 | Molecular marker influencing early weight of goat and primer and application thereof |
-
2014
- 2014-12-22 CN CN201410812130.5A patent/CN104450934B/en not_active Expired - Fee Related
Non-Patent Citations (5)
| Title |
|---|
| DONG,Y.等: "Capra hircus breed Yunnan black goat chromosome 22 genomic scaffold, CHIR_1.0, whole genome shotgun sequence", 《NCBI REFERENCE SEQUENCE: NW_005100910.1》 * |
| DONG,Y.等: "PREDICTED: Capra hircus LIM and cysteine-rich domains 1 (LMCD1), mRNA", 《NCBI REFERENCE SEQUENCE: XM_005695648.1》 * |
| WANG JUN 等: "Association of single nucleotide polymorphisms in exon 3 of porcine LMCD1 gene with meat quality and carcass traits", 《AGRICULTURAL SCIENCES IN CHINA》 * |
| 刘凯 等: "山羊重要基因的多态分析及与部分体尺性状的相关性", 《中国畜牧杂志》 * |
| 王军: "猪八个候选基因的分离、特征分析多态性及其与性状间的关联分析", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923332A (en) * | 2019-12-06 | 2020-03-27 | 江苏省农业科学院 | Molecular marker influencing early growth of sheep, detection method and application thereof |
| CN110938705A (en) * | 2019-12-12 | 2020-03-31 | 江苏省农业科学院 | Molecular marker influencing early weight of goat and primer and application thereof |
| CN110938705B (en) * | 2019-12-12 | 2022-07-05 | 江苏省农业科学院 | Molecular marker influencing early weight of goat and primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104450934B (en) | 2018-08-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106498078B (en) | A kind of method and its application for the single nucleotide polymorphism detecting sheep KITLG gene | |
| CN107815498B (en) | SNP molecular marker related to multiple economic traits of pig and application thereof | |
| CN103866032B (en) | A kind of method and application thereof detecting goat STAT3 gene mononucleotide polymorphism | |
| CN101705290B (en) | Single nucleotide polymorphism of SCD genes in dairy goat and detection method thereof | |
| CN106755371A (en) | Method and its application using PCR RFLP detection sheep PCNP gene mononucleotide polymorphisms | |
| CN101921852B (en) | Method for detecting single nucleotide polymorphism of cattle AdPLA gene | |
| CN104450934A (en) | Detection method and detection kit for goat LMCD1 gene mononucleotide polymorphism sites | |
| CN102703440B (en) | Goat SH2B1 gene mononucleotide polymorphisms site and its detection method | |
| CN103233001A (en) | Qinchuan cattle FoxO1 gene mononucleotide polymorphism molecular marker detection method and application | |
| CN101899500B (en) | Method for detecting single nucleotide polymorphism of cattle krupple-like factor (KLF) 7 gene | |
| CN104498610B (en) | RFLP method and kit for detecting SNP locus of MEF2C gene of cattle | |
| CN107937557B (en) | SNP (single nucleotide polymorphism) site related to economic traits of pigs and application thereof | |
| CN104450933A (en) | Detection method and kit for single nucleotide polymorphism site of goat LYRM1 (LYR motif-containing protein 1) gene | |
| Chang et al. | Genetic diversity of wild quail in China ascertained with microsatellite DNA markers | |
| CN107815499B (en) | SNP (single nucleotide polymorphism) locus related to 100kg body weight backfat thickness of pig and application thereof | |
| CN103695416B (en) | A kind of method and its application for the SNP for detecting Qinchuan Cattle CFL2 genes | |
| CN102031304B (en) | Single nucleotide polymorphism (SNP) of ADD1 gene of cattle and detection method thereof | |
| CN101955931A (en) | Molecular marker of gene Nudt6 related to pig leaf fat rate, lactone rate and leg breech meat-bone rate and application thereof | |
| CN101705289B (en) | Single nucleotide polymorphism of GHRHR genes in dairy goat and detection method thereof | |
| CN110438245B (en) | SNP (single nucleotide polymorphism) marker of clam and application thereof | |
| CN101962684B (en) | Single nucleotide polymorphism for cattle PCSK1 gene and detection method thereof | |
| CN101671725B (en) | Method for detecting inserting mutation polymorphism of ox NPM1 gene | |
| CN105838798A (en) | Chicken MHC B-G seat complete sequence determination and SNP detection method and kit | |
| CN101875977B (en) | Method for detecting mononucleotide polymorphism of scalper SREBP1c gene | |
| CN107937558B (en) | SNP (Single nucleotide polymorphism) locus related to average daily feed intake of pig and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180817 Termination date: 20191222 |