KR101929391B1 - Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof - Google Patents

Abstract

The present invention relates to a method for predicting the number of nipples of a pig, and comprises: an SNP marker which can be used to determine the number of nipples of the pig, which is one of economic traits which determine the number of pigs and a rate of breeding; a composition capable of detecting or amplifying the SNP marker; a kit for judging the number of nipples of the pig including the composition; and a step of determining a polymorphic site of the SNP marker. The novel SNP marker of the present invention and a Pyro-sequencing analysis method using the novel SNP marker can be used as an early means of determining the number of nipples the pig which is a reproductive trait. Therefore, it is possible to contribute to raising competitiveness of swine industry by constructing a system capable of enlarging and producing superior piglets.

Description

Gene markers for predicting the eutrophication of pigs and their uses < RTI ID = 0.0 > (Novel < / RTI > SNP markers for discriminating increased number of nipples of pigs and use thereof)

More particularly, the present invention relates to SNP markers capable of judging the number of pigs in the pig, which is one of the economic traits of determining the number of pigs and breeding rate of breeding pigs, A composition for judging the amount of SNP markers in a pig, comprising a preparation capable of detecting or amplifying SNP markers, a kit for determining the amount of SNP markers, and a method for determining the polymorphic site of the SNP markers And a method for manufacturing pigs in which the papillary water of the pig is relatively larger than that of the normal pig.

Pigs have ten or more litters at a time, have a relatively short pregnancy period of 114 days, and are able to conceive twice a year. The number of piglets that can be fed by mother pigs is closely related to the teat numbers of the mother pigs. In general, it is very rare that the number of piglets is greater than that of teat. Therefore, teat is one of the economic traits to consider when selecting a breed. Although there are reports that nipple numbers do not significantly affect the body weight of piglets, Smith et al. Reported a genetic correlation between teat water and growth rate, sample efficiency and backfat thickness. It has also been applied as a traditional selection factor in the swine industry because it has a close relationship with the number of embryos that the mother pigs can nurse and is an important trait related to reproductive ability to evaluate the mammalian ability of the sows. The number of papillomas ranges from 10 to 20, and the number of the left and right is not the same.

Almost all domestic pigs are using foreign seeds. In fact, more than 1,000 dogs are imported every year, which is causing concern about the influx of malicious infectious diseases as well as foreign currency outflows. Therefore, it is necessary to conduct an early research on domestic piglets. In the study of pig breeding, the use of molecular markers for superior traits makes it possible to identify better breeds more accurately than phenotypic selection methods, and it can reduce the time and cost of the later tests used in the existing methods . Already in developed countries, genetic improvement projects are being carried out on the basis of active use of molecular markers, and new species with superior ability in meat quality, reproductive traits and growth traits are being developed.

Due to recent advances in dielectric analysis technology, dielectric selection methods using dielectric information have become possible. Genome selection refers to identifying genetic traits associated with the economic traits of livestock and utilizing genomic information in screening superior breed axes. Typically, the genomic information used for genome selection is a molecular marker using single nucleotide polymorphism (SNP). Recently, a chip integrating more than 700,000 SNP information has been developed and used for genome analysis. The Genome-Wide Association Study (GWAS), which comprehensively analyzes genomic information related to a specific trait, is a useful tool for searching molecular markers used in genome selection. . In addition, the vertical axis selection method that combines GWAS analysis with SNP molecular markers provides many advantages in understanding and exploiting the complex genetic traits of a particular economic trait.

Under these circumstances, the inventors of the present invention have conducted intensive research to develop a method for judging pigs having excellent fertility based on the papillary water of pigs. As a result, it has been found that novel SNP markers involved in pork nutrition determination in BRMS1L gene The present inventors have confirmed that pigs having a good fertility can be selected by discriminating genetically determined papillary juice using the SNP markers, and completed the present invention.

It is an object of the present invention to provide a SNP marker capable of judging the number of eosinophils in a pig.

It is another object of the present invention to provide a composition for judging papillary water of a pig, which comprises a preparation capable of detecting or amplifying the SNP marker.

It is still another object of the present invention to provide a kit for judging the amount of papilled pork comprising the composition.

It is a further object of the present invention to provide a method for determining the number of pigs in a pig, comprising determining the polymorphic site of the SNP marker.

Another object of the present invention is to provide a method of manufacturing pigs in which the number of nipples is relatively larger than that of normal pigs.

In order to achieve the above object, the present invention provides a single nucleotide polymorphism (SNP) marker capable of judging the number of pigs in the pig.

The marker may preferably be all or some of the polynucleotides comprising the SNP region of the BRMS1L gene, more preferably the polynucleotide derived from the BRMS1L gene represented by SEQ ID NO: 1 from the initiation codon ATG in the region of exon 1 And a polynucleotide consisting of 5 to 100 consecutive bases including the SNP position in which the 1087th base is G or A in the " → 5 'direction, or a complementary polynucleotide thereof.

SEQ ID NO: 1 may be as follows.

CTCCGATCGAGTCTGGCAGCTTTCATGCCTTGTGGGACTTGAAGTCCAGAGAGGAGAAGCAAGCCGGGCCATTGAAGCTTGGAAGCCGGCTGCCCCTGCGGGTCTTGAACCACTAGGGACTACAACTCCCAACATACACCGCGAGGCCGCGCCGTAATTACTGGTAACCAACCGGACCCGAGCTACACAAGCCCCATCCCCCCGGCTAGGAGCACTGCCTCCACCAATGGCAGAGCTCCCAGCGCAGAGCCTGCGGGTTAGGTTGTGAGGCTCGGGCCGGGGGCGGGGAGGAGCCGAGGGGTTTCAGAACGAGCTCCGCCGCTGGGTGGGTCGGGGCGTTCCGCGCGCCCTTCACTGAAGCGGCGGTGGCCGGGCTGGGCACTGGGAGTGGGAAGCGACGGCGCGGCTGGAAAATGCCAGTCCATTCTCGAGGGGATAAGAAGGAGACGAACCATCACGATGAGATGGAGGTGGACTACGCCGAAAACGAGGGGAGCAGCTCTGAGGACGAGGACACCGAGAGCTCGTCGGTCTCTGAGGATGGAGATAGCTCAG

Among the nucleotide sequences of SEQ ID NO: 1, ATGCCAGTCCATTCAGGAGGGGATAAGAAGGAGACGAACCATCACGATGAGATGGAGGTGGACTACGCCGAAAACGAGGGGAGCAGCTCTGAGGACGAGGACACCGAGAGCTCGTCGGTCTCTGAGGATGGAGATAGCTCAG may be a region of exon 1. The initiation codon ATG in the exon 1 region of ATGCCAGTCCATTCAGGAGGGGATAAGAAGGAGACGAACCATCACGATGAGATGGAGGTGGACTACGCCGAAAACGAGGGGAGCAGCTCTGAGGGGAGCAGCTCTGAGGACGAGGACACCGAGAGCTCGTCGGTCTCTGAGGATGGAGATAGCTCAG in the sequence of the exon 3 may be a 140th to 142th nucleotide in the 3 'to 5' direction.

The term "BRMS1L (Brest cancer metastasis-suppressor 1 like) gene" of the present invention is known as a gene for inhibiting breast cancer metastasis in humans and is located on chromosome 7 of a pig as a gene. The 5'-UTR base sequence of the BRMS1L gene may comprise the polynucleotide of SEQ ID NO: 1.

The term "SNP marker" of the present invention means a single base polymorphism allele base pair on the DNA sequence used to identify an individual or species. Because SNPs are relatively frequent and stable and distributed throughout the genome, and because of the genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers generally involve phenotypic changes associated with single nucleotide polymorphisms but may or may not be. In the case of the SNP markers of the present invention, a difference in the phenotype of an individual such as a mutation in an amino acid sequence or the number of eosinophils in a pig can be indicated.

The term "polymorphism " of the present invention refers to a case where two or more alleles exist in one locus. Of the polymorphic sites, only a single base is different depending on the individual, Polymorphism. Preferred polymorphic markers have two or more alleles with a frequency of occurrence of 1% or more, more preferably 5% or 10% or more in the selected population.

The term "allele " of the present invention means various types of a gene existing at the same gene locus of a homologous chromosome. Alleles are also used to represent polymorphisms, for example, SNPs have two kinds of bialles.

The term "breeding pigs" of the present invention means a breed of pigs collectively referred to as foster pigs (fowl) and fowl pigs (sows) necessary for breeding in swine. In particular, the present invention refers to a pennywort having a phenotype of the breeding stock, which is an economic trait related to the ability to breed. On the other hand, expressive traits that judge excellence of breeding pigs include supine birth, age, number of live births, live births, birth weight, weaning weight, and teat.

The term " economic trait "of the present invention means a phenotypic characteristic of breeding pigs favoring breeding of piglets in breeding of pigs. The phenotypic traits include, but are not limited to, supper births, number of females, total females, , Birth weight, weaning weight, weaning weight, and so on. For the purpose of the present invention, the economic trait is influenced by the genotype of the SNP marker of the present invention. When the genotype of the SNP marker is A / A, the number of eutrophic populations (total eutrophy, And right-sided teat).

According to one embodiment of the present invention, QTL (quantitative trait locus) analysis of the papillary water of pigs using a large SNP chip was conducted for the cross reference group of Korean traditional black pig and land race pig, It was confirmed that the gene involved was present on the chromosome 7 (Fig. 1). In addition, a gene analysis for the locus of the papillomavirus regulatory gene using the statistical analysis method revealed that the gene group containing BRMS1L was present on the chromosome 7 (FIG. 2). In addition, sequencing analysis of the BRMS1L gene confirmed that a new mutation g.1087G > A was present on the 5'URL of the BRMS1L gene (Fig. 3). G / G genotype, G / A genotype, and A / A genotype were present in the new mutant, and the number of pigs was significantly increased as the number of A copies increased (Table 1). The number of ribs (THO) and length of the CBL were significantly increased as the number of A copies increased. In addition, the carcass weight (CW), intramuscular fat content (IMF) The thickness (BFT) was not correlated.

Therefore, when the genotype of the SNP marker of the present invention is amplified and the genotype of the SNP marker is detected by a pyro-sequencing method, it is expected that the number of pigs will be determined. The SNP markers were first identified by the present inventors.

"Pyrosequencing" does not require a labeled primer and does not require gel electrophoresis. It can be quickly and accurately analyzed by sequencing only about 30 to 40 base pairs (bp) of the DNA nucleotide sequence This is how you can. The pyrosequencing method is a sequencing method that is performed in real time, without electrophoresis. It is performed by adding sequential nucleotides one at a time in primer-directed PCR, and the pyrophosphate released when the nucleotides are combined is ATP It is paired with sulfurylase and luciferase enzymes to emit light, which is then detected. The emitted light represents a signal peak in the order of the reaction of each nucleotide sequentially entered, and this light appears as a peak having a relative height in proportion to the number of nucleotides merged, and the sequence can be determined in real time.

Since the pattern of the peaks is different between the homo and hetero-, wild-type and mutated samples, it is possible to identify and determine the type and exact position of the mutation by comparing the nucleotide sequence of the wild type with the analyzed nucleotide sequence, , It is advantageous to process a large amount of samples in a simple and economical manner

Although the conventional direct DNA sequencing method is currently performed by an automated sequencing analyzer, a DNA sample such as a PCR product to be subjected to sequencing is obtained, followed by performing a sequencing reaction. Thereafter, the DNA generated by the sequencing reaction Is loaded into an automated DNA sequencing instrument and the sequence is read, there is a disadvantage in that the time required for sequencing is much longer. On the other hand, pyrosequencing has a sequencing primer if only the PCR product to be sequenced is prepared , Which is capable of analyzing the base sequence within about 10 minutes by a pyrosequencing instrument.

In addition, since the nucleotide (ide dispensation order) can be designed, variations in the base sequence, which are determined by single nucleotides, result in distinct pyrographs that appear in different patterns at different peaks. Moreover, the use of a particular nucleotide distribution strategy can reduce the number of pyrosequencing cycles, thereby increasing the quality of the sequence and the read length.

A process which can be used as one embodiment of the present invention will be briefly described as follows. A gene containing a nucleotide sequence to be mutated or mutated through pyrosequencing was amplified by PCR using a pyro-PCR primer set (conjugate biotin at the 5 'end of one of the forward or reverse primers for separation and purification of one strand) The resulting amplified PCR product was reacted with avidin-conjugated beads, and only one strand of the DNA amplified by PCR using the affinity of avidin and biotin was separated from the beads by the RT-PCR and PCR. Fixed. After annealing with a pyrosequencing primer using a single stranded DNA template thus separated, the nucleotides dispensed in the order of nucleotide distribution in the pyro-sequencer reacted with the DNA template along with the substrate / Analyze the degree of variation of the base sequence using a pyrogram.

In another aspect, the present invention provides a composition for judging papillary water in a pig comprising an agent capable of amplifying and detecting the SNP marker.

The term "agent capable of amplifying and detecting the SNP marker" of the present invention means that the mutation site of the above-described gene, i.e. SNP marker, is detected by amplification and pyrosequencing to determine the number of pigs Refers to a composition, preferably a primer capable of specifically amplifying a polynucleotide including the SNP marker, a pyrosequencing primer, and an amplification composition used in a PCR method.

The primers used for the SNP marker amplification can be amplified by PCR using appropriate conditions (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) in a suitable buffer and template-directed DNA synthesis Stranded oligonucleotides that can function as a starting point of the primer. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 bp nucleotides. Short primer molecules generally require relatively low temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the polynucleotide sequence comprising the SNP marker, but should be sufficiently complementary to hybridise with the sequence, preferably to amplify the sequence of the BRMS1L gene comprising the SNP marker Gt; polynucleotide < / RTI > The sequence and length of the primers may be modified based on those known in the art. In addition, the primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkages (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In a specific embodiment of the present invention, a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3 can be used to amplify a base mutation portion related to teat water present in pigs.

In another aspect, the present invention provides a kit for judging the amount of papilled pork comprising the composition.

The kit of the present invention can determine the number of pigs in the pig by amplifying and detecting the genotype of the SNP marker, which is a marker for judging the pubic water of pigs. Specifically, the kit may be, but not limited to, a PCR (Polymerase Chain Reaction) kit or a DNA analysis kit (for example, a DNA chip).

The kit of the present invention can determine the number of papilla of a pig by amplifying a gene involved in the papillary water of a pig and then confirming the appearance of a band by cutting with a restriction enzyme. The PCR kit may comprise a test tube or other appropriate container, a reaction buffer (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), and the like, in addition to the respective primer pairs specific for the polynucleotide comprising the SNP marker or its complementary polynucleotide ), Enzymes such as Taq polymerase, DNase, RNAse inhibitor, DEPC-water, sterilized water and the like. Specifically, the PCR kit may be a kit for performing PCR-restriction fragment length polymorphism (PCR-RFLP).

In the present invention, the "PCR-RFLP" method is a technique for analyzing the restriction fragment length polymorphism (PCR) of gene fragments among various DNA analysis techniques for improving the genetic characteristics and capability of livestock. the presence of restriction enzyme recognition sites in the point mutation region allows the use of the fact that the lengths of the fragments generated by restriction enzymes vary according to the genotype difference of each individual, .

Specifically, the kit of the present invention may be a kit for judging the amount of papillomavirus which contains essential elements necessary for carrying out a DNA chip. DNA chip kits are those in which nucleic acid species are attached in a gridded array on a generally flat solid support plate, typically a glass surface not larger than a slide for a microscope, and nucleic acids are uniformly arranged on the chip surface, Hybridization reaction occurs between the nucleic acid on the surface of the chip and the complementary nucleic acid contained in the treated solution on the surface of the chip so that massive parallel analysis is possible,

In another aspect, the present invention provides a method for amplifying a polynucleotide comprising: (a) amplifying a polynucleotide comprising the SNP marker from DNA of a sample isolated from an individual; And (b) determining the base of the amplified polymorphic site of step (a). At this time, the SNP marker can be a 1087th base in the 3 'to 5' direction from the initiation codon ATG in the 5'-URT region of the BRMS1L gene in the region of exon 1, and the allele of the 1087th base is A , The number of pigs is relatively large.

The term "individual" of the present invention means a pig to which teat water is to be identified, and the SNP markers can be analyzed using the sample obtained from the pig to determine the teat number of the pig. Examples of the specimen include, but are not limited to, hair, urine, blood, various body fluids, separated tissues, separated cells or saliva, and the like.

The amplification of the polynucleotide containing the SNP marker from the DNA sample of step (a) can be carried out by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sequence amplification based on nucleic acids (NASBA) can be used as well as self-sustaining sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)).

Methods for detecting the amplified SNP markers in step (b) of the above method include sequencing, hybridization with a microarray, allele specific PCR, dynamic allele-specifichybridization , DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. MassenRAY system from Sequenom), mini- Can be performed using Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion probe array technology (e.g. Affymetrix GeneChip), and BeadArray Technologies (e.g. Illumina GoldenGate and Infinium analysis) , And is not particularly limited thereto. One or more alleles may be identified in the SNP markers by the methods described above or other methods available to those skilled in the art.

The TaqMan method comprises the steps of (1) designing and preparing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis results.

The sequencing analysis can be performed using a conventional method for nucleotide sequencing, and can be performed using an automated gene analyzer. In addition, allele-specific PCR means a PCR method in which a DNA fragment in which the mutation is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the mutation site is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, When the base at the mutation position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, 3 'terminus does not perform complementary binding so that the amplification reaction can not be performed properly. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single nucleotide polymorphism is located is amplified with a pair of primers, and all the nucleotides added to the reaction are deactivated by dephosphorylation, and a specific extension primer, dNTP And then performing a primer extension reaction by adding a mixture, a digoxinucleotide, a reaction buffer, and a DNA polymerase. At this time, the extension primer has the 3 'end immediately adjacent to the 5' direction of the base where the mutation site is located, and the nucleic acid having the same base as the didyoxynucleotide is excluded in the dNTP mixture, and the didyoxynucleotide has a mutation ≪ / RTI > For example, when dGTP, dCTP and TTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer is extended by the DNA polymerase in the base in which the substitution has occurred, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the kind of base showing the mutation by comparing the length of the extended primer.

At this time, as a detection method, when the extension primer or the didyxin nucleotide is fluorescently labeled, the mutation is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 manufactured by ABI Co., Ltd.) used for general nucleotide sequence determination And when the unlabeled extension primer and the dideoxy nucleotide are used, the mutation can be detected by measuring the molecular weight using a MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

In another aspect, the present invention provides a method for isolating a SNP trait of a porcine ectoparasitic strain, comprising the steps of: 3'- > 3 'from the initiation codon ATG in the region of exon 1 in the polynucleotide derived from the BRMS1L gene represented by SEQ ID NO: And fixing the allele of the 1087th base in the 5 'direction to the A / A type, wherein the number of teats is relatively larger than that of the normal pig. The step of immobilizing the SNP trait may be carried out by crossing an individual having all of the SNP traits and selecting an individual having the desired trait.

The novel SNP markers of the present invention and the pyrosequencing analysis method using the same can be used as early means of judging the eutrophic rate of the pig, which is a reproductive trait, You will be able to contribute to heightening the

FIG. 1 is a graph showing the QTL analysis results of piglet eutrophicia using a large-capacity SNP chip.
FIG. 2 is a graph showing the gene group found in the QTL region of the eutrophic number of chromosome 7.
Fig. 3 shows the results of g. 1087 > G > A mutation.
FIG. 4 shows that alleles of the A / A type, A / G type and G / G type, as the mutation of the 1087th base in the nucleotide sequence of SEQ ID NO: 1 including the 5'-UTR region of BRMS1L gene, As shown in Fig.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1: Analysis of GWAS (genome-wideassociation stduy) related to swine juice

QTL analysis was carried out on the juvenile female reproductive trait (Fig. 1) using a large-capacity SNP chip (Porcine 60K Beadchip, Illumina) for reference crosses between Korean traditional black pork and land lace pig. FIG. 1 is a graph showing a result of QTL analysis of piglet eutrophicia using a large-capacity SNP chip. As shown in FIG. 1, it was confirmed that the gene involved in the crystallization of the pig's milk was present on the chromosome 7. By using the IBD mapping method, the physical distance of the QTL was compressed in units of 100 kbp And genetic analysis was performed on the locus of the pituitary gland. FIG. 2 shows gene analysis results related to the control of swine juice trait. As can be seen from FIG. 2, it was confirmed that the gene group containing BRMS1L was present in the QTL related to swine juice on chromosome 7. The physical nucleotide sequence of the cDNA and genomic DNA of the candidate genes in the vicinity of the QTL located on chromosome 7 was determined, and the SNPs found here were evaluated. As a result, g of the 5'-UTR region of the BRMS1L gene was determined. 1087 G> A mutation showed the highest association with the eutrophic population of the pig group. FIG. 3 shows the results of sequencing of BRTL1L gene of QTL related to swine juice on chromosome 7. As shown in Fig. 3, the novel mutant g. 1087 G> A was present in the 5'-UTR region of the BRMS1L gene. Therefore, a novel mutation of the BRMS1L gene g. 1087 G> A in the pigs.

Example 2: Genotype analysis

Example 2-1: PCR amplification of 5'-UTR region of BRMS1L gene

A primer capable of detecting mutant traits of the BRMS1L gene was constructed as follows by carrying out genotyping analysis using a Pyro-sequencer:

BRMS1L_pyro F: 5'-AATGCAACCTTCTTGTTTTACC-3 '(SEQ ID NO: 2)

BRMS1L_pyro R: 5'-AAACTGAAGCGCCAAGTTAGA-3 '(SEQ ID NO: 3)

BRMS1L_mini: CCCCTGTAGCAAGTGCTTTC (SEQ ID NO: 4)

 As a result of the pyrosequencing analysis using the above primer, as shown in FIG. 4, the mutation of the 1087th base in the nucleotide sequence of SEQ ID NO: 1 appears as A or G, A / G type and G / G type, respectively.

Example 2-2: Analysis of the association between BRMS1L genotype and piglet eutrophy

Genotype analysis using Pyro-sequencing was performed on second-generation offspring obtained by crossing Jeju native black pig and lond race pig, and the technical statistics of the pig's teat with each genotype were analyzed using SAS® (V9.1 ) Software (Table 1). The SAS results in Table 1 are represented by the superscript A when the value is the most significant, and the superscript C when the value is the lowest. Also, the superscript alphabet is not indicated when there is no statistical significance.

Trait
BRMS1L g. 1087 G> A G / G (170) G / A (577) A / A (346) TTN 12.99 ± 0.16 ^c 13.63 ± 0.13 ^ba 13.66 + 0.14 ^a THO 15.02 0.08 ^c 15.19 ± 0.07 ^ba 15.26 ± 0.07 ^a CBL 101.64 ± 0.74 ^c 102.80 ± 0.63 ^ba 103.01 + 0.66 ^a CW 77.55 + 1.46 78.32 ± 1.20 78.98 ± 1.28 IMF 0.98 + 0.07 0.96 + 0.06 0.97 + 0.06 BFT 23.69 + - 0.66 23.08 + - 0.56 22.98 ± 0.59

(TTN: total teat number, THO: thoracic vertebrae number, CBL: carcass body length, CW: carcass weight, IMF: intramuscular fat content, BFT:

Table 1 shows the results of GLM analysis of the difference in teat water according to the genotype of g.1087G > A mutation of BRMS1L gene. As shown in Table 1, there is a highly significant association between the genotype and the eutrophic population of the pigs in individuals with genotypes of g.1087G> A mutations of the different BRMS1L genes. BRMS1Lg. It has been found that the teat of the 1087 AA genotype has an average total teat of 0.67 more than that of individuals with the GG genotype Thus BRMS1Lg.1087 G> A, including SNPs with A traits It was found that the individuals had more teats than those having SNPs with G-traits. The number of ribs (THO) and length of the CBL were significantly increased as the A copy number of the allele was increased. The CW, intramuscular fat content IMF) and backfill thickness (BFT) were not correlated. Furthermore, it was confirmed that by fixing specific bases, pigs with large nipples could be used for manufacturing and sorting pigs.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel SNP marker for discriminating increased the number of          nipples of pigs and use thereof <130> 1062292 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 2315 <212> DNA <213> Artificial Sequence <220> <223> The 5'-UTR reigon of BRMS1L gene <400> 1 gcaactcgag gtctgagttg tgtctgtgac ctacaccata gctcatggca acaccagatc 60 ccggacccac tgatcgaggc ctcagatcta acctgcatcc tcatggattc tagttggatt 120 cgtttccact gtgccaggaa gggaactcct gaccataagt aagcatgaat gaattaatgc 180 gaagtgagag gagctccttt tgtagctcag tggattaaga acccaacata gtgtatgtga 240 ggttgcggat ttgatccctg gcatggctca gtgggttagg gatcccatgt tgcctcaagc 300 tccagcgtag gttgcagatg cagctgggat ccggcagctg cagctcagat ttgactccta 360 gcttgggaat ttccatacgc tgcagctgtg accattataa agagagtgaa agaaaaagtg 420 agacttaaaa tggatctaaa gatagtgtaa gccctacaaa atgtaaagtg ctacattaat 480 ggaaggcatc attcctacct ttttactttt tttatttttt gtcatgcctt cggcctgtgg 540 aagatcaaac cagggatcaa acctgggcca cagcagtaat cagagccaaa gcagtgacaa 600 tgccagatcc ttaacccact gagccatcag ggaaatccca actcctacct tttaaaggct 660 agattgagga aacttcactc agctttcatg gtttgcttta tattaatttg tattttccaa 720 gctgacaata ttcttttcca gccttattca tttttcccct tatggtttct cttacatttg 780 ctacacatct ttttaaaaat ctatttgagg aggggagaga gaaactcctt ttaagcaaaa 840 caccaccctg taactctaat tgcgcaatct tatattattt tgtctgcctt aaacataaat 900 ataatgatga caggactttt agagctggaa gagaacttag caataacata atgcaacctt 960 cttgttttac cactgatgag atattatgtg atttgcccaa atgaattgcc tggttatcag 1020 tagaactagg gctagaatcc atacctcctc tccagcttcc ttctgttttt ctttaagcag 1080 cagaacagaa agcacttgct acaggggcac tgtgtgatgg tggttgggtg tgggctctga 1140 tgctggacta ctcaagttca aaccttagct ttgctactta ttagtggtgt gactttggcc 1200 aagtaatcta acttggcgct tcagtttcct catttacaaa acggaaggct aattatatgt 1260 agttcatgga gtttttataa ggattaagtg aattaatgta cttaaagcac ataacagtgc 1320 ttggcacata aagagtgacc agagtgtatt tttcattgaa aacttaagac cggtggcatt 1380 ttcacgttgc atatggtaaa aaacgaatgc aaaaaatact agctgaaagt gccatgataa 1440 aaattccttt ctttccatat ttttgattac aaaagtctca aaaaacaatt ggaagatttt 1500 tgtgcaacat agaaagtgca agttatcgtc agcagaaact aatttattaa tattagttta 1560 ttagtggtaa taaatatgct taggtaaaaa catttctcca gttccctcag cctcaaaggg 1620 gaggaaaaat cctcgggcaa aagacctttt cacatctgac agtaacattt tggatagctt 1680 gggcgctcag acaatcactt ggcgggaaaa gaataaataa agaccaaatt cgcacaatct 1740 gtttttgctt agtttacaaa ctccgatcga gtctggcagc tttcatgcct tgtgggactt 1800 gaagtccaga gaggagaagc aagccgggcc attgaagctt ggaagccggc tgcccctgcg 1860 ggtcttgaac cactagggac tacaactccc aacatacacc gcgaggccgc gccgtaatta 1920 ctggtaacca accggacccg agctacacaa gccccatccc cccggctagg agcactgcct 1980 ccaccaatgg cagagctccc agcgcagagc ctgcgggtta ggttgtgagg ctcgggccgg 2040 gggcggggag gagccgaggg gtttcagaac gagctccgcc gctgggtggg tcggggcgtt 2100 ccgcgcgccc ttcactgaag cggcggtggc cgggctgggc actgggagtg ggaagcgacg 2160 gcgcggctgg aaaatgccag tccattctcg aggggataag aaggagacga accatcacga 2220 tgagatggag gtggactacg ccgaaaacga ggggagcagc tctgaggacg aggacaccga 2280 gagctcgtcg gtctctgagg atggagatag ctcag 2315 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Foward primer for dection of BRMS1L <400> 2 aatgcaacct tcttgtttta cc 22 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for dection of BRMS1L <400> 3 aaactgaagc gccaagttag a 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BRMS1L_mini <400> 4 cccctgtagc aagtgctttc 20

Claims (9)

A polynucleotide derived from the BRMS1L gene represented by SEQ ID NO: 1 contains a single base polymorphism in which the 1087th base is G or A in the 3 'to 5' direction from the initiation codon ATG in the region of exon 1, and 5 to 1000 consecutive bases And a gene comprising a complementary polynucleotide of the polynucleotide or its complementary polynucleotide. A composition for judging papillary water of pigs, comprising a preparation capable of amplifying and detecting the gene of claim 1. 3. The method of claim 2,
Wherein said preparation is a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3 capable of amplifying a part of the polynucleotide represented by SEQ ID NO: 1. A kit for judging papillary water of pigs comprising the composition of claim 2 or 3. 5. The method of claim 4,
The kit is a PCR (Polymerase Chain Reaction) kit or a kit for DNA analysis. (a) amplifying a polynucleotide region comprising the gene of claim 1 or a polymorphic site of a complementary polynucleotide thereof from DNA of a sample isolated from the individual; And
(b) determining the base of the amplified polymorphic site of step (a). The method according to claim 6,
Wherein said gene is a polynucleotide of SEQ ID NO: 1, wherein when the allele of the 1087th base in the 3 'to 5' direction from the initiation codon ATG in the region of exon 1 is A, How to Determine the Eutrophy of. A step of immobilizing the trait of the gene involved in the juice of pigs, comprising the step of detecting the allele of the 1087th base in the 3 'to 5' direction from the initiation codon ATG in the region of exon 1 in the polynucleotide derived from the BRMS1L gene represented by SEQ ID NO: Wherein the number of nipples is relatively larger than that of normal pigs. 9. The method of claim 8,
Wherein the step of immobilizing the trait of the gene is carried out by crossing an individual having all the traits of the gene and selecting an individual having the desired trait.

Images