KR101929381B1 - Novel gene marker for discriminating the composition of fatty acid of pigs and use thereof - Google Patents

Abstract

The present invention relates to a gene marker for discriminating a fatty acid composition and uses thereof. More specifically, the present invention relates to a gene marker for discriminating a fatty acid composition of pigs, a composition for discriminating the fatty acid composition of pigs comprising a preparation capable of detecting or amplifying the gene marker, a kit for discriminating the fatty acid composition of pigs comprising the composition, a method for discriminating the fatty acid composition of pigs comprising a step of discriminating a polymorphic site of the gene marker, a composition for discriminating Korean native pigs comprising the preparation capable of amplifying and detecting the gene marker, and a method for discriminating Korean native pigs comprising a step of discriminating the polymorphic side of the gene marker.

Description

[0002] The present invention relates to a gene marker for determining the fatty acid composition of a pig,

The present invention relates to a gene marker for discriminating the fatty acid composition and a use thereof, and more particularly to a composition for discriminating the fatty acid composition of a pig, which comprises a gene marker for discriminating the fatty acid composition of a pig and an agent capable of detecting or amplifying the gene marker, A method for identifying a fatty acid composition of a pig, comprising a step of discriminating a polymorphic site of the genetic marker, a method for identifying a fatty acid composition of a porcine, and a method for amplifying and detecting the gene marker, A discriminating composition, and a step of discriminating a polymorphic site of the genetic marker.

Fatty acid composition in pork is one of the important economic traits related to taste such as flavor and year. In recent years, there has been a move to classify those in which the thickness of filet groin is finely distributed and oleic acid fatty acid ratio is more than 55% in premium category in Japan. When the proportion of saturated fatty acids such as palmitic acid and stearic acid in meat is high, meat becomes less soft and thick, while when unsaturated fatty acids such as oleic acid and linolenic acid are high, the meat becomes soft and smooth and sweet. Currently, meat researchers are studying the ratio of free amino acid to nucleic acid, richness and sweetness in meat according to breed, differences in genotype of fatty acid in meat, genetic characteristics and control method of ratio. The heritability of oleic acid and linoleic acid is about 60 to 70%.

Due to recent advances in dielectric analysis technology, dielectric selection methods using dielectric information have become possible. Genome selection refers to identifying genetic traits associated with the economic traits of livestock and utilizing genomic information in screening superior breed axes. Typically, the genomic information used for genome selection is a molecular marker using single nucleotide polymorphism (SNP). Recently, a chip integrating more than 700,000 SNP information has been developed and used for genome analysis. The Genome-Wide Association Study (GWAS), which comprehensively analyzes genomic information related to a specific trait, is a useful tool for searching molecular markers used in genome selection. . In addition, the vertical axis selection method that combines GWAS analysis with SNP molecular markers provides many advantages in understanding and exploiting the complex genetic traits of a particular economic trait.

Under these circumstances, the present inventors have made intensive researches to develop a method for determining the fatty acid composition of pigs, and as a result, they discovered a novel gene marker for determining the fatty acid composition of pigs from MYH3 gene. It is possible to discriminate the fatty acid composition and completed the present invention.

One object of the present invention is to provide a method for detecting a nucleotide sequence in a nucleotide sequence in which the 1806th to 1815th bases in the 3 'to 5' direction from the initiation codon ATG start codon in the exon 3 of the MYH3-derived polynucleotide represented by SEQ ID NO: 1 are 5 to 20 nucleotides including GACAGCAGGA or AGGAGGACTG. A polynucleotide consisting of 1000 consecutive bases, or a complementary polynucleotide thereof.

It is another object of the present invention to provide a composition for discriminating fatty acid composition of a pig, which comprises a preparation capable of amplifying and detecting the gene marker.

It is still another object of the present invention to provide a kit for determining fatty acid composition of a pig, which comprises the composition.

Yet another object of the present invention is to provide a method for determining the fatty acid composition of a pig, comprising the step of discriminating a polymorphic site of the gene marker.

It is another object of the present invention to provide a composition for discriminating Korean native pigs, which comprises a preparation capable of amplifying and detecting the gene marker.

It is still another object of the present invention to provide a method for discriminating Korean native pigs comprising the step of discriminating polymorphic sites of the genetic markers.

In one aspect of the present invention, there is provided a gene marker capable of discriminating fatty acid composition of a pig.

The marker may preferably be all or a part of the polynucleotides including the gene marker region of the MYH3 gene, more preferably 3 ' - > from the start codon ATG in the exon 3 at the MYH3-derived polynucleotide of SEQ ID NO: The nucleotides 1806 to 1815 in the 5 'direction are GACAGCAGGA or AGGAGGACTG, and may comprise a polynucleotide consisting of 5 to 1000 consecutive bases including the SNP position, or a complementary polynucleotide thereof.

A ▼ The CGT position is located 1805th before the start codon for the initiation codon in exon 3. The base sequence containing the 6-bp deletion is as follows

KNP AGACAGAGGTTTAGTTAATGACGATCCTAATGAGACAGCAGGA ------ CGTGTGTTCCC

LAND AGACAGAGGTTTAGTTAATGACGATCCTAATAATACAGCAGGAGGACTGCTGTTGTTCCC

KNP: Korean native pig; LAND: Landrace (Land Race)

SEQ ID NO: 1 may be as follows.

GGGGAGCTTGGATTGCGTGCATCCCGTGTCCTCTGCACAGAGGAGCTGCTCAATGAAATGCACCCATTTGATCCCGGGGGGCTGGATGGCGGCGGCCTTGCTCCTGGGCTCCGCCTGGAGGGCGCCTGTGGGGTCAGGGCTGGAGTCTGGCCCGGGGACTCACTGGGGGGTCCCTTCCAGCCGACACCATG (start codon) AGCAGCGACACTGAAATGGAAGTGTTCGGCATAGCCGCTCCCTTCCTCCGCAAGTCGGAAAAGGAGAGGAT (exon 3)

Among the nucleotide sequences of SEQ ID NO: 1, CCGACACCATGAGCAGCGACACTGAAATGGAAGTGTTCGGCATAGCCGCTCCCTTCCTCCGCAAGTCGGAAAAGGAGAGGAT may be a region of exon 3. The initiation codon ATG in the exon 3 region of the exon 3 sequence of CCGACACCATGAGCAGCGACACTGAAATGGAAGTGTTCGGCATAGCCGCTCCCTTCCTCCGCAAGTCGGAAAAGGAGAGGAT can be 72 to 74 in the 3 'to 5' direction.

The term " polynucleotide represented by SEQ ID NO: 1 " of the present invention means the MYH3 gene. The term 'MYH3 gene' refers to a gene encoding myosin heavy chain 3, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal. The nucleotide sequence thereof is obtained from a known database such as NCBI's GenBank (GenBank Accession No. KX549311 (LAND), KX549312 (KNP)). As a specific example, the gene may be a gene derived from a pig, but is not limited thereto.

The term " genetic marker " of the present invention means a short DNA sequence which is used to discriminate a variety caused by a mutation or modification at a gene locus. For the purposes of the present invention, the genetic marker may refer to a gene in which a base mutation occurs among the varieties of pigs. As a specific example, the gene may be a gene derived from a pig, but is not limited thereto. The gene markers of the present invention include, but are not limited to, GACAGCAGGA or AGGAGGACTG corresponding to the 1806th to 1815th bases in the 3 'to 5' direction from the initiation codon ATG in the polynucleotide of SEQ ID NO: 1 in the exon 3 Can be a continuous base. Also, the genetic marker can be, but is not limited to, a polynucleotide consisting of 5 to 1000, particularly 5 to 300, more specifically 5 to 260 consecutive bases comprising the base or a polynucleotide complementary thereto But is not limited thereto.

The term " fatty acid " of the present invention refers to a monovalent carboxylic acid chain-like chain with a carboxylic acid chain having a single carboxy group (-COOH). The fatty acids which can be identified in the present invention are capric acid (C10: 0), lauric acid (C12: 0), margaric acid (C17: 0), margar oleic (C18: 1), linoleic acid (18: 2), alpha-linoleic acid (18: 3), gadoleic acid ), And arachidonic acid (C20: 4).

In the present invention, the content of capric acid, lauric acid, oleic acid, and valoleic acid in the case of AGGAGGACTG when the marker is GACAGCAGGA contains the content of margaric acid, magar oleic acid, linoleic acid, alpha-linoleic acid and arachidonic acid Can be judged to be more.

In a specific embodiment of the present invention, QTL (quantitative trait locus) analysis and linkage and linkage disequilibrium (LALD) mapping were performed on the meat quality of pigs in offspring obtained by crossing Jeju native pigs and land lace, It was confirmed that the gene discriminating the meat quality of the pig was the MYH3 gene present on the chromosome 12 (FIGS. 1 to 3). In addition, the genotype analysis of the MYH3 gene revealed that the base mutation (QTN: ie, MYH3-1806_-1811delGGACTG) was present between the land race, which is an exotic animal with poor meat quality, and the native Korean pig, which has good meat quality 2). As a result of cleavage of the causative base mutation using the restriction enzyme HpyCH4IV, it was confirmed that the cutting patterns of the two pigs were different (FIG. 5). This suggests that the gene markers of the present invention can discriminate not only foreign pigs and native pigs but also meat quality traits according to species distinction. Therefore, the use of the gene marker of the present invention is expected to accurately discriminate the level of the meat quality trait, and the gene marker was first identified by the present inventors.

Another aspect provides a composition for determining the fatty acid composition of a pig, comprising a preparation capable of amplifying and detecting the gene marker.

The term " agent capable of amplifying and detecting a genetic marker " of the present invention means that a mutation site of the above-described gene, i.e., a genetic marker is amplified and detected by PCR-RFLP or pyrosequencing, Refers to a composition capable of discriminating the fatty acid composition of the gene marker, preferably a primer capable of specifically amplifying a polynucleotide comprising the gene marker; And restriction enzymes or pyrosequencing primers used in the PCR method.

The primers used for amplification of the gene markers can be amplified by PCR using appropriate conditions (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) and a template-directed DNA synthesis Stranded oligonucleotides that can function as a starting point of the primer. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 bp nucleotides. Short primer molecules generally require relatively low temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the polynucleotide sequence comprising the genetic marker but should be sufficiently complementary to hybridize with the sequence and preferably amplify the sequence of the MYH3 gene comprising the gene marker Gt; polynucleotide < / RTI > The sequence and length of the primers may be modified based on those known in the art. In addition, the primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, " capping ", substitution of one or more natural nucleotides into homologues, and modifications between nucleotides, such as uncharged linkages (e.g., methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In a specific embodiment of the present invention, a base mutation portion existing between foreign and native pigs is amplified using a primer set composed of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3, As a result of cutting the 'ACGT' part in the base sequence of the base mutation with the HpyCH4IV restriction enzyme, restriction enzyme cleavage patterns of the landrace, which is a poor quality exotic animal, and Jeju native pig, which is a good meat quality, are clearly distinguished (Fig. 5). This suggests that the composition for discriminating fatty acid composition of pigs of the present invention can be used not only for distinguishing pigs from other pigs and pigs but also for discriminating meat quality traits according to species distinction.

Another embodiment provides a kit for determining fatty acid composition of a pig, comprising the composition. The kit of the present invention can determine the level of meat quality of a pig by confirming the gene marker of the present invention through amplification or by checking the level of mRNA expression of the gene marker. As a specific example, the kit may be an RT-PCR kit or a DNA chip kit, but is not limited thereto.

As a more specific example, the kit may be a kit containing the necessary elements necessary for performing RT-PCR. For example, an RT-PCR kit can contain a test tube or other appropriate container, a reaction buffer (pH and magnesium concentrations vary), as well as a respective primer pair specific for the polynucleotide comprising the SNP marker or its complementary polynucleotide, Enzymes such as deoxynucleotides (dNTPs), Taq polymerase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like. Specifically, the PCR kit may be a kit for performing PCR-restriction fragment length polymorphism (PCR-RFLP).

In the present invention, the "PCR-RFLP" method is a technique for analyzing the restriction fragment length polymorphism (PCR) of gene fragments among various DNA analysis techniques for improving the genetic characteristics and capability of livestock. the presence of restriction enzyme recognition sites in the point mutation region allows the use of the fact that the lengths of the fragments generated by restriction enzymes vary according to the genotype difference of each individual, .

In another specific example, the kit of the present invention may be a DNA chip kit including essential elements necessary for performing a DNA chip. The term " DNA chip " of the present invention means one of DNA microarrays capable of identifying each base of hundreds of thousands of DNAs at a time. The DNA chip kit is formed by attaching nucleic acid species to a glass surface, which is generally not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface, It is a tool that enables multiple parallel hybridization reactions between the nucleic acid on the chip and the complementary nucleic acid contained in the treated solution on the chip surface.

Another aspect of the present invention provides a microarray for determining the fatty acid composition of a swine comprising the gene marker.

The microarray may comprise DNA or RNA polynucleotides. The microarray may consist of a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide. Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can be used for detecting the alleles and determining the meat quality of pigs. Such discrimination methods include detection methods based on hybridization of nucleic acids such as Southern blots, and may be provided in a form preliminarily bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher. The process of immobilizing the probe polynucleotide on the substrate in connection with the determination of the fatty acid composition of the pig of the present invention can also be easily carried out using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection can be accomplished, for example, by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent material, such as Cy3 and Cy5, and then hybridizing on the microarray and generating The hybridization result can be detected.

(A) amplifying a polynucleotide containing the gene marker from DNA of a sample separated from an individual; And (b) determining the base of the amplified polymorphic site of step (a). In the 3 'to 5' direction from the initiation codon ATG in the exon 3 of the MYH3-derived polynucleotide, and when the allele of the 1806th to 1815th bases is GACAGCAGGA, Wherein the content of at least one fatty acid selected from the group consisting of capric acid, lauric acid, oleic acid and valoleic acid is at least one selected from the group consisting of margaric acid, magar oleic acid, linoleic acid, alpha-linoleic acid and arachidonic acid Or more fatty acid.

In the present invention, when the allele of the 1806th to 1815th base in the 3 'to 5' direction from the initiation codon ATG in the exon 3 of the MYH3-derived polynucleotide is GACAGCAGGA, The content of any one or more fatty acids selected from the group consisting of acid, lauric acid, oleic acid and valoleic acid is at least one selected from the group consisting of margaric acid, magar oleic acid, linoleic acid, alpha-linoleic acid and arachidonic acid (C) to determine that the number of the first and second images is larger than the first image size.

The term " individual " of the present invention means a pig to which a level of meat quality traits is to be confirmed. By analyzing the genotype included in the genetic marker using the sample obtained from the pig, the meat quality of the pig can be determined have. The specimen may be a hair, urine, blood, various body fluids, a separated tissue, a sample such as a separated cell or saliva, but is not particularly limited as long as the gene can be detected.

The amplification of the polynucleotide containing the gene marker from the DNA sample of step (a) can be carried out by any method known to those skilled in the art. For example, the target nucleic acid can be obtained by PCR amplification and purification thereof. Other ligase chain reaction (LCR) (Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sequence amplification based on nucleic acids (NASBA) can be used as well as self-sustaining sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87, 1874 (1990)).

The method for detecting the amplified gene markers in step (b) of the above method may be selected from the group consisting of sequence analysis, microarray hybridization, allele specific PCR, dynamic allele-specifichybridization , DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g. MassenRAY system from Sequenom), mini- Using Bio-Plex system (BioRad), CEQ and SNPstream system (Beckman), Molecular Inversion probe array technology (eg Affymetrix GeneChip), BeadArray Technologies (eg Illumina GoldenGate and Infinium analysis) However, the present invention is not limited thereto. One or more alleles in the genetic marker can be identified by the methods described above or other methods available to those skilled in the art to which the invention pertains.

The TaqMan method comprises the steps of (1) designing and preparing a primer and a TaqMan probe to amplify a desired DNA fragment; (2) labeling probes of different alleles with FAM dyes and VIC dyes (Applied Biosystems); (3) performing PCR using the DNA as a template and using the primer and the probe; (4) after completion of the PCR reaction, analyzing and confirming the TaqMan assay plate with a nucleic acid analyzer; And (5) determining the genotype of the polynucleotides of step (1) from the analysis result.

The sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer. In addition, allele-specific PCR means a PCR method in which a DNA fragment in which the mutation is located is amplified with a primer set including a primer designed with the base at the 3 'end at which the mutation site is located. The principle of the above method is that, for example, when a specific base is substituted by A to G, an opposite primer capable of amplifying a primer containing the A as a 3 'terminal base and a DNA fragment of an appropriate size is designed, When the base at the mutation position is A, the amplification reaction is normally performed and a band at a desired position is observed. When the base is substituted with G, the primer can be complementarily bound to the template DNA, And the amplification reaction is not performed properly due to the inability of complementary binding at the terminal. DASH can be performed by a conventional method, preferably by a method such as Prince et al.

On the other hand, in the PCR extension analysis, first, a DNA fragment containing a base in which a single nucleotide polymorphism is located is amplified with a pair of primers, and all the nucleotides added to the reaction are deactivated by dephosphorylation, and a specific extension primer, dNTP And then performing a primer extension reaction by adding a mixture, a digoxinucleotide, a reaction buffer and a DNA polymerase. At this time, the extension primer has the 3 'end immediately adjacent to the 5' direction of the base where the mutation site is located, and the nucleic acid having the same base as the didyoxynucleotide is excluded in the dNTP mixture, and the didyoxynucleotide has a mutation ≪ / RTI > For example, when dGTP, dCTP and TTP mixture and ddATP are added to the reaction in the presence of substitution from A to G, the primer is extended by the DNA polymerase in the base in which the substitution has occurred, The primer extension reaction is terminated by ddATP at the position where the base first appears. If the substitution has not occurred, the extension reaction is terminated at the position, so that it is possible to discriminate the kind of base showing the mutation by comparing the length of the extended primer.

At this time, as a detection method, when the extension primer or the didyxin nucleotide is fluorescently labeled, the mutation is detected by detecting fluorescence using a gene analyzer (for example, Model 3700 of ABI Co., Ltd.) And when the unlabeled extension primer and the dideoxy nucleotide are used, the mutation can be detected by measuring the molecular weight using a MALDI-TOF (matrix assisted laser desorption ionization-time of flight) technique.

"Pyrosequencing" does not require a labeled primer and does not require gel electrophoresis. It can be quickly and accurately analyzed by sequencing only about 30 to 40 base pairs (bp) of the DNA nucleotide sequence This is how you can. The pyrosequencing method is a sequencing method that is performed in real time, without electrophoresis. It is performed by adding sequential nucleotides one at a time in primer-directed PCR, and the pyrophosphate released when the nucleotides are combined is ATP It is paired with sulfurylase and luciferase enzymes to emit light, which is then detected. The emitted light represents a signal peak in the order of the reaction of each nucleotide sequentially entered, and this light appears as a peak having a relative height in proportion to the number of nucleotides merged, and the sequence can be determined in real time. Since the pattern of the peaks is different between the homo and hetero-, wild-type and mutated samples, it is possible to identify and determine the type and exact position of the mutation by comparing the nucleotide sequence of the wild type with the analyzed nucleotide sequence, , There is an advantage in that a large amount of sample can be processed in a simple and economical manner. Although the conventional direct DNA sequencing method is currently performed by an automated sequencing analyzer, a DNA sample such as a PCR product to be subjected to sequencing is obtained, followed by performing a sequencing reaction. Thereafter, the DNA generated by the sequencing reaction Is loaded into an automated DNA sequencing instrument and the sequence is read, there is a disadvantage in that the time required for sequencing is much longer. On the other hand, pyrosequencing has a sequencing primer if only the PCR product to be sequenced is prepared , Which is capable of analyzing the base sequence within about 10 minutes by a pyrosequencing instrument. In addition, because the nucleotide dispensing order can be designed, variations in the base sequence, which are determined by single nucleotides, result in distinct pyrographs that appear in different patterns at different peaks. Moreover, the use of specific nucleotide distribution strategies can reduce the number of pyrosequencing cycles, thereby increasing sequence quality and detection length. A process which can be used as one embodiment of the present invention will be briefly described as follows. A gene containing a nucleotide sequence to be mutated or mutated through pyrosequencing was amplified by PCR using a pyro-PCR primer set (conjugate biotin at the 5 'end of one of the forward or reverse primers for separation and purification of one strand) The resulting amplified PCR product was reacted with avidin-conjugated beads, and only one strand of the DNA amplified by PCR using the affinity of avidin and biotin was separated from the beads by the RT-PCR and PCR. Fixed. After annealing with a pyrosequencing primer using a single stranded DNA template thus separated, the nucleotides dispensed in the order of nucleotide distribution in the pyro-sequencer reacted with the DNA template along with the substrate / Analyze the degree of variation of the base sequence using a pyrogram.

In the present invention, the step of amplifying the gene marker of the present invention from the DNA of step (a) may be carried out by any method known to those skilled in the art. Specific examples include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like. Also, the step of discriminating the base of the genetic marker contained in the amplification product of step (b) may be any method known to a person skilled in the art. Specific examples include sequencing, mini-sequencing, allele specific PCR, dynamic allele-specifichybridization (DASH), PCR extension analysis (eg, single base extension (SBE) PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., MassenRAY system of Sequenom), Bio-Plex system (BioRad), restriction enzyme digestion , But is not limited thereto, as long as it can detect a continuous base of ACGT contained in the amplification product.

In a specific embodiment of the present invention, a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3 is used to amplify a base mutation portion present between a wild and a conventional pig, As a result of cleavage of the ACGT region in the amplified nucleotide sequence with the restriction enzyme HpyCH4IV, it was confirmed that the cut-off patterns of the landrace, which is a foreign meat having poor meat quality, and the Jeju native pig, which is a good meat quality native fish, are clearly distinguished 5). This suggests that the method of determining the meat quality traits of pigs of the present invention not only can distinguish species of exotic pigs and native pigs, but also distinguishes meat quality traits according to species distinction.

Another embodiment provides a composition for discriminating Korean native pigs, which comprises an agent capable of amplifying and detecting the gene marker. At this time, the definition of the " preparation capable of amplifying and detecting the gene marker " is as described above.

The term " Korean native pig " of the present invention is a concept opposite to an exotic pig, and traditionally refers to a pig breed raised in Korea. In general, Korean native pigs are more resistant to diseases than foreign pigs, and are known to have excellent meat quality such as intramuscular fat, juiciness, and flesh. Specific examples include Jeju dumplings, Jeju native pigs from Gangwon province, Jeju native black pork, Jeju native pigs and so on, and more specifically, Jeju native pigs, but the present invention is not limited thereto. In this specification, the Korean native pig may be named in combination with 'native pig', 'Korean native pig' or 'native pig'. In the present invention, when the marker is detected, when the marker is not detected, it can be determined that it is Korean native pig.

(A) amplifying the polynucleotide region containing the gene marker from the DNA of the sample separated from the individual; And (b) treating the amplified polynucleotide of step (a) with a restriction enzyme and detecting.

In the present invention, the gene marker is a Korean native pig when it is GACAGCAGGA in alleles of 1806th to 1815th bases in the 3 'to 5' direction from the initiation codon ATG in exon 3 in MYH3-derived polynucleotide step c).

The novel gene markers of the present invention and the RFLP analysis method using the same are specific markers for discriminating the composition of fatty acids of pigs which are economical traits. In addition to objectively evaluating the pig meat quality traits not visually distinguishable, they discriminate foreign pigs and Korean native pigs It can contribute to the establishment of the distribution order of pork meat.

FIG. 1 is a graph showing the QTL analysis results on the fatty acid composition of pigs using a large-capacity SNP chip.
FIG. 2 is a graph showing the gene groups found in the QTL region related to the fatty acid composition of chromosome 12. FIG.
3 is a graph comparing mRNA expression levels of genes present in the QTL region.
Fig. 4 is an image showing the structure and QTN (quantitative trait nucleotide) of the porcine MYH3 gene.
FIG. 5 is an image showing a pattern in which a causative base mutation affecting meat quality is cut using a HpyCH4IV restriction enzyme.

Hereinafter, the present invention will be described in more detail with reference to examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1: Analysis of GWAS (genome-wideassociationstudy) analysis on fatty acid composition of pigs

QTL analysis of the fatty acid composition of the pigs breeding trait was performed using a large-capacity SNP chip (Porcine 60K Beadchip, Illumina) for the cross-breeding reference line of Jeju native black pork and land lace pig (Fig. 1). FIG. 1 is a graph showing the results of QTL analysis of the fatty acid composition of pigs using a large-capacity SNP chip. As shown in FIG. 1, it was confirmed that the gene determining the fatty acid composition of pigs was present on the chromosome 12.

On the other hand, confirming that the gene for identifying the fatty acid composition exists in the chromosome 12, the gene in the region was confirmed by LALD mapping. As a result, as shown in FIG. 2, it was confirmed that nine genes of MYH3, MYH1, MYH2, MYH13, ADPRM, SCO1, TMEM220, ENSSSCG00000029441 and ENSSSCG00000018006 exist in the region of the gene that discriminates the fatty acid composition. Among the above genes, genes that are most relevant to discrimination of meat quality traits were selected. The relative mRNA expression levels of the nine genes were analyzed by real-time RT-PCR, which quantitatively showed the products as a result of the chain polymerization reaction in real time. As a result, as shown in Fig. 3, mRNA expression of MYH3 gene was significantly higher in the sirloin and fuji of native pig than in landrace. From the above results, it was found that the MYH3 gene is a major gene for determining fatty acid composition.

To analyze the genotype of the MYH3 gene, the 5'-UTR 3kb from the transcription start site (TSS) of the porcine MYH3 gene and the 3'-UTR 1kb from the stop codon were decoded . As a result, QTN (i.e., MYH3-1806_-1811delGGACTG) was identified (indicated by a red dot) in the MYH3 gene that affects meat quality, as shown in Fig. Also, it was confirmed that a base mutation exists between LANDLACE and KNP, which is located at 5'-UTR from the initiation codon (ATG) in exon 3. In the case of Jeju native pig, it was confirmed that the region of -1806 bp to -1811 bp was defective and it was confirmed that it is a binding site of myogenesis regulatory factor (MRF).

Example 2: Genotype analysis

Example 2-1: PCR amplification for MYH3

A primer capable of detecting mutant traits of the MYH3 gene was constructed as follows by performing genotyping analysis using PCR-RFLP.

forward: 5'-TGG TCT TTC CTA ATT GGT GAC AT-3 '(SEQ ID NO: 2)

reverse: 5'-AGT TTT GAG CAA GGC TTT TGT T-3 '(SEQ ID NO: 3)

PCR was carried out using the above primers and genomic DNA obtained from pigs as a template to obtain amplified MYH3 gene samples (PCR amplification conditions: 96 ° C → 30s, 60 ° C → 30s, 72 ° C → 30s 30cycles).

Example 2-2: Detection of MYH3 genotype using PCR-RFLP

The amplified gene was digested with the HpyCH4IV restriction enzyme to delete the 'A ▼ CGT' portion of the base sequence of the causative base mutation. Thereafter, the landrace by the restriction enzyme and the cleavage pattern of the Korean native pig MYH3 gene were confirmed. As a result, as shown in FIG. 5, it was confirmed that LANDLACE pigs having poor meat quality did not cleave their genes, resulting in one band at 250 bp (1/1; non-cleaved type) The Korean traditional pig (KNP) was confirmed to have two bands at 167 and 77 bp by cleavage of the gene (2/2; truncated form). In addition, it was confirmed that the hybrid cultivars of Landrace and Jeju native pigs were represented by two bands at 250 and 167 bp (1/2, cut type). From the above results, it was confirmed that the pigs can be distinguished from the pigs by distinguishing the pigs from the native pigs by confirming the mutation of MYH3, which is a gene that discriminates the meat quality of pigs.

Example 2-3: Analysis of the relationship between MYH genotype and composition of pig fatty acid

Genetic analysis using PCR-RELP was performed on the second-generation offspring obtained by raising Jeju native black pork and lond race pigs, and technical data on the composition of fatty acids in pigs with each genotype were analyzed using SAS® (V9.1) software (Table 1). The SAS results in Table 1 are represented by the superscript A when the value is the most significant, and the superscript C when the value is the lowest. Also, the superscript alphabet is not indicated when there is no statistical significance.

Table 1 shows the results of analysis of differences in fatty acid composition according to genotype of MYH3-1806_MYH3-1811delGGACTG mutation of MYH3 gene. As shown in Table 1, there is a highly significant association between the genotype and the fatty acid composition of the pigs in individuals with the genotype MYH3-1806_MYH3-1811delGGACTG mutation of the different MYH3 gene. MYH3 MYH3-1806_MYH3-1811 The fatty acid composition of Jeju native pig (2/2 (truncated form) with genotype MYH3-1811delGGACTG was higher than that of land race (1/1; non-truncated type) with MYH3-1806_MYH3-1811GGACTG genotype The contents of capric acid, lauric acid, oleic acid and valoleic acid were found to be higher than those of margaric acid, magar oleic acid, linoleic acid, alpha-linoleic acid and arachidonic acid. Thus, it was found that an individual comprising a SNP having a MYH3-1806_MYH3-1811delGGACTG trait in MYH3 MYH3-1806_MYH3-1811delGGACTG had more capric acid, lauric acid, oleic acid and valoleic acid fatty acid than an SNP having MYH3-1806_MYH3-1811GGACTG trait .

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel gene marker for discriminating the composition of fatty          acid of pigs and use thereof <130> 1062770 <160> 3 <170> KoPatentin 3.0 <210> 1 <211> 3400 <212> DNA <213> Artificial Sequence <220> <223> KNP 5u myH3 <400> 1 tggtggttat tgccgctgct tccaccctca gggttctcct ggcgagcgga gctccctgcc 60 tacctcggac cctcgttcca tggcccgggc aggcttcttc ccctcgtgcc ttccagcccc 120 tcatgtgcag aagcaggccg tcaggcagat gacccgagac ctcccagccg agcctctgtg 180 ctcgtggagg acgtgtgacg gagagaagga agacaggccg gctgacgggg gaaaagctgg 240 ggtgggaggc cgtcagcctt gagctcgcct tgggctcagg gatgcgacgt ggcttcacgc 300 ttgacaagaa gctcaaagaa atcctgtgtg gaaaacgtcc tctcggtgtc ccggaggtgg 360 gatggatgtg gttgtgcaga ggtgggtgaa ccggcgccaa ctaaaggtca aaagcaagcc 420 ggccccaacc gcggcccctg gtgtttaaga agggaccgcc agcacccttc ccctgaccac 480 ccagcacacg tcacagcctg agacgtagcc agggcccctg cactgtccct cagccccagg 540 gggcttgcta acacctctgc ttccaggtga catgcacctg tcctcaccag gcctcccagg 600 atggctggcc aatggcgcag agagtcaggc cggcgcgtcc ctgggcaggg agaccacgcc 660 ccttcaggac cggagggtcc ttgaggaggg tcgagctctc ttcttggacg aggaggattt 720 ctgggggagg gggtttcagt cccagcggcg gggggtgggc ggtggggcgt gacatgtagc 780 atggcaggtc catgcttcct gactttcctc ctgatggcca cttgcctacc tgctttgatc 840 taaaaatcac caaaatctca gacataatcg agtcaccatt tatccaagaa accatcgagg 900 gtaaagccgc agcttccatt tctttcgatt cttcttccag ggttctgcct tgggcccagc 960 atgcagtggg tgtttaatta atgcccctgc ccctcgggga ctgcagcccc actccccctg 1020 ccccaccccc agcccttaga gtggcctcct ggcccgcgct gcgtgtggct atgctgggag 1080 ggggccgttc ttattctcca gtggggacag ctgacaccag aatgaacgac aacgggttac 1140 ccacaggcca cgctcccaac ggtctgtcag ggaaaaaaag ggaaaaacag acataaagtg 1200 gaataagaat gggcaaacgc ttcagccata cccctctgtg ctcctaaggc tttatttttc 1260 taaccctgat ttagaaacag ccatgctcgt tagacgcccc ctcacccccc tttctctgca 1320 ggccctgcca tccccccacc cccgccccgg ccagcagctg gtctttccta attggtgaca 1380 tgtcttaata actacaggtc cttgagcagc tgtcactgtg gctcctggct ggtgggctac 1440 ctccctctca gtcatttact cgttggtcct actggcgctt aagacagagg tttagttaat 1500 gacgatccta atgagacagc aggacgtgtg ttccccacac aagttgtaca atcacacatt 1560 cctgccacaa ccctgtgttg taacaaaagc cttgctcaaa actccaagag ggtttaaact 1620 tttccgtcct tggcttcatc cctttgccca caggccgaga ttctaggtcc ccgctgtccc 1680 agagaccagg ctcatctcca gccgtgtggc gcctgtggga tggagcgagg gcccccggca 1740 aggctgtccc atcactgagc cgccggttca gagaaaggca tcccaaactt ccagctttct 1800 ccagctagga tcctgtcatt tctatatata cctctctctt ggcagcggca aaaaaaagcg 1860 aggaaggagc tggtcctcac ttgtggtgtc ggtcactctc tttccaaata tagagaagga 1920 atgagtggcg ggggttagca ggggctataa aagcccgcgg ggagcgcccc ttgtagctgc 1980 tctgtgggcg gaggagagtc acagtgcccc ttgtgcgggt ccttcccatc tgaggctcag 2040 aggctcgtgt ggccctgccc ggctttggta aggaccagac gtgcggctga ttctcagccc 2100 ctccccgcct ccagcatccc gcttccttca cctgttctcc cctgccctca tcctccagag 2160 ccttcccggg cagggtccct tcggatgctc tgtggaccac tgccgtcacc ccggcccatg 2220 aacgctgcca cctctctgac ttgtgcagag gccagtgggc ctggccgcct ccccacctgc 2280 gt; tctgagactt cgccctgcct gcccacagaa gacagggggc ctggccctgg cttggaggca 2400 caggcttttc aaacagagct tctgtcctga ctgctcacat ctgaggagga ggcatggcag 2460 acagagggtg gtgccacccg ggcaggaggg agccaggtct ggggcggctg ggggctctcc 2520 tgccttcagg gctcacctgt gggccaggtc ccatttgctc ctccagcttg tctctgggcc 2580 aaggctcttt taaagttatt cgtcctttct cttcatttgg ttaattgatt aaggcccatt 2640 cagaactgaa ccagacactc ccacgtctcc tgaccttttg tgtatttatt gcaggtctga 2700 tttctcacgg ctgctgctgt ctgctgtcct cctgcgggtg tgactctcag gtgagaaagc 2760 aggtcaggtc ccctggctca gccatctcca gggtactggt tcccccccgg ccacggcctt 2820 gcggcgagca ggacaggtta ggctggagag gagccccagg gaaggctgcc aagcagatgc 2880 tgatgtgaga agccgcttgt ttgtagaagg gactgaagcc ggtttccagg tgggggatgg 2940 agccaccctg aatccgagcg gttccaaaac tccttagcta tttgcccttt aacacgctct 3000 ttgaagaatg tttgcttttg agagtgttta cctttacgtc ttccctcagc aacccctggc 3060 ttttacagaa gaggaaagcg gggtcccaag agctgcaccc acctctgggc gctctgcccg 3120 ccccagcccc ggctaacggg ggagcttgga ttgcgtgcat cccgtgtcct ctgcacagag 3180 gagctgctca atgaaatgca cccatttgat cccggggggc tggatggcgg cggccttgct 3240 cctgggctcc gcctggaggg cgcctgtggg gtcagggctg gagtctggcc cggggactca 3300 ctggggggtc ccttccagcc gacaccatga gcagcgacac tgaaatggaa gtgttcggca 3360 tagccgctcc cttcctccgc aagtcggaaa aggagaggat 3400 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH3 forward <400> 2 tggtctttcc taattggtga cat 23 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH3 reverse <400> 3 agttttgagc aaggcttttg tt 22

Claims (10)

The nucleotides 1806 to 1815 in the 3 'to 5' direction from the initiation codon ATG start codon in exon 3 in the MYH3-derived polynucleotide shown in SEQ ID NO: 1 are composed of 5 to 1000 consecutive bases including GACAGCAGGA or AGGAGGACTG Or a complementary polynucleotide of the polynucleotide, or a complementary polynucleotide thereof. A composition for determining fatty acid composition of a swine comprising a preparation capable of amplifying and detecting the gene of claim 1. 3. The method of claim 2,
Wherein the preparation is a primer set consisting of a forward primer represented by SEQ ID NO: 2 and a reverse primer represented by SEQ ID NO: 3 capable of amplifying a part of the polynucleotide represented by SEQ ID NO: 1. A kit for determining fatty acid composition of pigs comprising the composition of claim 2 or 3. 5. The method of claim 4,
Wherein the kit is a PCR (Polymerase Chain Reaction) kit or a kit for DNA analysis. (a) amplifying a polynucleotide region containing the gene of claim 1 from a DNA of a sample separated from the individual;
(b) treating and detecting the amplified polynucleotide of step (a) with a restriction enzyme; And
(c) when the allele of the 1806th to 1815th base in the 3 'to 5' direction from the initiation codon ATG in the polynucleotide of SEQ ID NO: 1 in the polynucleotide of SEQ ID NO: 1 is GACAGCAGGA, The content of any one or more fatty acids selected from the group consisting of acid, lauric acid, oleic acid and valoleic acid is at least one selected from the group consisting of margaric acid, magar oleic acid, linoleic acid, alpha-linoleic acid and arachidonic acid Determining that there is more;
/ RTI &gt; wherein the fatty acid composition of the pig is determined. delete A composition for the identification of Korean native pigs comprising a preparation capable of amplifying and detecting the gene of claim 1. (a) amplifying a polynucleotide region comprising the gene marker of claim 1 from DNA of a sample isolated from the individual;
(b) treating and reading the amplified polynucleotide of step (a) with a restriction enzyme; And
(c) the gene is a Korean native pig when the allele of nucleotides 1806 to 1815 in the 3 'to 5' direction from the initiation codon ATG in exon 3 of the polynucleotide of SEQ ID NO: 1 is GACAGCAGGA ;
And the method for distinguishing Korean native pigs. delete

Images