KR102336624B1 - Marker for predicting collagen content in pork and use thereof - Google Patents

Abstract

A gene marker of the present invention is a haplotype marker for predicting a collagen content in a pig, and can predict a collagen content in pork in a molecular biological level by analyzing vibration regions of MYH13, MYH1, and MYH3 genes of the pig, thereby being used for fostering and screening pigs having excellent collagen contents.

Description

Marker for predicting collagen content in pork and use thereof

The present invention relates to a composition for predicting the collagen content of pork and a method for predicting the collagen content of pork using the same.

Since they were bred in eastern India about 9000 years ago, pigs have been bred according to each era, situation, and people's preferences as the most basic livestock for human protein intake worldwide. In general, European breeds and Asian breeds are derived from wild boars on each continent, and about 200 breeds exist so far. This was reported to be about 33%. The differences in phenotype between these breeds include color, size, and body type.

Recently, in order to improve the quality of pork, pigs are raised and scientifically managed under a certain standard, and the resulting pork is branded, and various brands of pork are already commercially sold. However, since branded pork and unbranded pork are difficult to identify with the naked eye, incidents that disrupt the distribution of pork are frequent by exploiting this point to deceive and sell unbranded pork as branded pork. it is occurring In fact, since it is very difficult even for a professional level to distinguish branded pork from unbranded pork, research to establish an objective standard for judging genuine brand pork is being actively conducted.

Research to discover the causative genes involved in the meat quality or meat quality traits of pigs and to explore the genetic location is being actively conducted. In particular, for the discovery of trait-related gene markers, gene mutation regions such as single nucleotide polymorphism (SNP) and insertion deletion (insert/deletion, indel) are being actively explored and trait-related research is being actively conducted for functional genes. To date, various trait-related SNP and indel markers have been discovered.

In many cases, the existence of SNPs has been revealed according to the completion of the genome map, but there are still undiscovered SNPs, and there are still many cases where the effects of discovered SNPs on the phenotype have not been studied. When the SNP affects the phenotype and changes the meat quality or meat quantity-related traits of pork, it can be used as a marker having an effect on the pork meat quality or meat quantity-related traits.

Republic of Korea Patent No. 10-1418402

The problem to be solved by the present invention is to provide a haplotype marker for predicting the collagen content of pork, a composition comprising an agent capable of detecting or amplifying the marker, a kit comprising the composition, and a method for predicting the collagen content of pork using the same will be

In order to solve the above problems, the present invention provides (a) the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base Or its complementary polynucleotide, (b) MYH1 gene represented by SEQ ID NO: 2, the 1002th base is G or T, and the polynucleotide comprising 5 to 100 consecutive bases including the 1002th base or its complementary Pork collagen comprising a polynucleotide, and (c) a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3, or a polynucleotide complementary thereto A haplotype marker for content prediction is provided.

In addition, the present invention provides a composition for predicting collagen content of pork, comprising an agent capable of detecting or amplifying the haplotype marker.

The agent may be a primer or a probe.

In addition, the present invention provides a composition for predicting the collagen content of pork.

The agent comprises the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and SEQ ID NO: 10 capable of amplifying the MYH3 gene. and a polynucleotide represented by 11.

In addition, the present invention provides a kit for predicting the collagen content of pork, comprising the composition.

In addition, the present invention includes the steps of a) isolating DNA from a sample isolated from an individual, b) amplifying the haplotype marker from the DNA, and c) determining the haplotype by analyzing the genotype of the amplification product. To provide a method for predicting the collagen content of pork.

In step c), the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and the MYH3 gene represented by SEQ ID NO:3 When bases 1524 to 1527 are consecutive bases of ACGT, the haplotype is determined as QQ, base 1002 of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and the MYH1 gene represented by SEQ ID NO: 2 If the 1002th base is G/G and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype is determined as qq, and the rest of the haplotypes except for QQ and qq types It may be to determine the body type as Qq or qQ.

When determining the haplotype QQ, the collagen content may be predicted to be high compared to qq and QQ.

The haplotype marker for collagen content prediction according to the present invention can predict the collagen content of pork at the molecular biological level by analyzing the mutation regions of the MYH13, MYH1 and MYH3 genes of pigs. can

1 shows the gene region gene group of the meat trait (intramuscular fat content, red meat, etc.) within pig chromosome 12.
2 is a result of analyzing the MYH13 genotype pattern by pyro-sequencing (PYRO-SEQUENCER).
3 is a result of analyzing the MYH1 genotype pattern by pyro-sequencing (PYRO-SEQUENCER).
4 is a result of electrophoretic analysis of the MYH3 promoter region mutation region.

The present invention aims to develop a molecular marker capable of early selection of pigs with excellent meat quality by searching for mutations in pork genes and examining the relationship between these genetic mutations and the collagen content of pork.

The present invention relates to (a) a polynucleotide consisting of 5 to 100 consecutive bases including the 1002 base, or a complementary polynucleotide thereof, wherein the 1002 base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, (b) a polynucleotide comprising 5 to 100 consecutive bases including the 1002 base, or a complementary polynucleotide thereof, wherein the 1002 base of the MYH1 gene represented by SEQ ID NO: 2 is G or T, and (c) ) Haplotype marker for predicting collagen content of pork comprising a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3, or a complementary polynucleotide thereof provides

In the present invention, pig gene haplotypes QQ, Qq, and qq types were classified according to the MYH13 gene, MYH1 gene, and MYH3 gene mutation regions. .

In the present invention, "marker" refers to a short DNA sequence used to identify diversity caused by mutations or modifications in a locus.

For the purposes of the present invention, the marker may refer to a gene in which a base mutation (polymorphism or indel) appears depending on the collagen content in pork.

In the present invention, "haplotype marker" refers to a marker comprising a combination of alleles of each locus linked on the same chromosome when polymorphic loci are densely linked on one chromosome. . If the haplotype is used, a gene region can be identified, and a chain imbalance relationship can be formed between alleles forming the haplotype.

For the purpose of the present invention, the haplotype marker may be all or part of a polynucleotide including a single nucleotide polymorphism (SNP) site of MYH13, a gene of MYH1, and an indel site of MYH3, specifically SEQ ID NO: 1 All or part of a polynucleotide consisting of (MYH13 gene), all or part of a polynucleotide consisting of SEQ ID NO: 2 (MYH1 gene), all or part of a polynucleotide consisting of SEQ ID NO: 3 (MYH3 gene) polynucleotide may include, more specifically, the 1002th base of the MYH13 gene of SEQ ID NO: 1 is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof , the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is G or T, and a polynucleotide comprising 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof, and SEQ ID NO:3 It may include a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the indicated MYH3 gene, or a polynucleotide complementary thereto.

In the present invention, “MYH13 gene” refers to a gene encoding MYH13, which is myosin expressed in the extrinsic ocular muscle, and in the present invention, the MYH13 gene includes the polynucleotide represented by SEQ ID NO: 1.

In the present invention, "MYH1 gene" means a gene encoding myosin heavy chain 1, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal, and in the present invention, the MYH1 gene is a poly represented by SEQ ID NO: 2 contains nucleotides.

In the present invention, "MYH3 gene" means a gene encoding myosin heavy chain 3, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal, and in the present invention, the MYH3 gene is a poly represented by SEQ ID NO: 3 contains nucleotides.

In the present invention, "nucleotide" or "polynucleotide" refers to deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form, and unless otherwise specified, includes analogs of natural nucleotides.

As used herein, the term “polymorphism” refers to a case in which two or more alleles exist at one locus, and among polymorphic sites, only a single base differs from one person to another as a single base It is called single nucleotide polymorphism (SNP). Preferred polymorphic markers have two or more alleles with an incidence of at least 1%, more preferably at least 5% or 10% in a selected population.

In the present invention, an allele refers to several types of a gene present at the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

In an embodiment of the present invention, the haplotype of the pig gene was determined by analyzing the genotypes of the SNP sites of MYH13 and MYH1 and the 6bp indel mutation region of MYH3 in DNA isolated from pigs, and haplotypes (qq, Qq, QQ) Collagen content of each part (loin, half-mak, thigh, upper arm, and neck) was compared according to the results. Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and the 1524th to the 1524th to the MYH3 gene represented by SEQ ID NO:3 If the 1527th base is a continuous base of ACGT, the haplotype was defined as QQ, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G/G, and when the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype was defined as qq. In addition, the remaining haplotypes except for QQ and qq types were defined as Qq or qQ.

As a result of analysis of collagen content according to haplotype, the collagen content of the QQ genotype was measured to be 22.0%, 62.8%, 43.1%, 22.6%, and 16.3%, respectively, in sirloin, half-mak, thigh, upper arm, and loin compared to qq genotype pork. , it was confirmed that they were statistically significant. When the pig haplotype genotype was fixed as QQ type, it was confirmed that the collagen content was increased by 16.3% to 62.8% compared to the qq genotype.

That is, it was confirmed that pigs with QQ haplotype had superior collagen content in pork compared to pigs with qq and Qq (or qQ) haplotypes.

Therefore, the collagen content of pork can be predicted using the haplotype marker of the present invention.

The haplotype marker predicts the collagen content of pork through MYH13, MYH1 and MYH3 genotype analysis, and can be utilized for breeding and selection of pigs with excellent collagen content.

The present invention also provides a composition for predicting collagen content in pork, comprising an agent capable of detecting or amplifying the haplotype marker.

The composition for predicting collagen content of the present invention may be improved in statistical significance, reliability, accuracy, etc. compared to a single marker by analyzing a single haplotype marker.

Pork meat quality other than the single nucleotide polymorphism disclosed in the present invention may include other single nucleotide polymorphisms that have been statistically significant, and may be used in various combinations to improve the statistical significance, reliability and accuracy of predicting pork meat quality.

In the present invention, “agent capable of detecting or amplifying” refers to an agent capable of specifically binding to and recognizing or amplifying a marker of the present invention, and may be a primer or probe that specifically binds to the specific genetic marker. .

In the present invention, "primer" is a nucleotide sequence having a short free 3' hydroxyl group, which can form a complementary template and base pair, and serves as a starting point for template strand copying. A short sequence that functions. Primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures. In this case, PCR conditions, the length of the sense and antisense primers can be modified based on what is known in the art.

The primer can serve as a starting point for template-directed DNA synthesis under appropriate conditions (e.g., four different nucleoside triphosphates and a polymerase such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. It may be a single-stranded oligonucleotide with a single-stranded oligonucleotide, and the appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the marker sequence, but must be sufficiently complementary to hybridize with the marker sequence.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, “encapsulation”, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

In the present invention, the primers are the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and a sequence capable of amplifying the MYH3 gene It may include polynucleotides represented by numbers 10 and 11.

In the present invention, “probe” refers to a natural or modified monomer or a linear oligomer including deoxyribonucleotides and ribonucleotides capable of hybridizing to a specific nucleotide sequence. Preferably, the probe is single-stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

The present invention also provides a kit for predicting the collagen content of pork comprising the composition for predicting the collagen content of pork.

The kit of the present invention may be a PCR (Polymerase Chain Reaction) kit or a DNA chip kit.

The kit of the present invention can determine the collagen content level of pork by confirming the genotype of the haplotype marker for predicting the collagen content of pork through amplification. As a specific example, in the present invention, it may be a kit including essential elements necessary for performing PCR of a haplotype marker for predicting collagen content in pork. In addition to each primer pair specific for the gene of the haplotype, the PCR kit includes a test tube or other suitable container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs), and Taq-polymer. enzymes such as enzymes and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.

Also preferably, the kit of the present invention may be a kit including essential elements necessary for performing a DNA chip. A DNA chip kit is a method in which nucleic acid species are attached in a gridd array to a generally flat solid support plate, typically a glass surface no larger than a microscope slide, and the nucleic acids are uniformly arranged on the chip surface, and the DNA chip It is a tool that allows multiple hybridization reactions to occur between the nucleic acids on the chip surface and the complementary nucleic acids contained in the solution treated on the chip surface, enabling massively parallel analysis.

The present invention also includes the steps of a) isolating DNA from a sample isolated from an individual, b) amplifying the haplotype marker from the DNA, and c) determining the haplotype by analyzing the genotype of the amplified product. It provides a method for predicting the collagen content of pork.

In the present invention, “individual” refers to a pig for which the collagen content level is to be confirmed, and the genotype of the polymorphic site and indel (insertion) site of the SNP included in the haplotype marker using the sample obtained from the pig. By analysis, the level of collagen content in the pig can be determined.

The “isolated sample” of the present invention may be a sample isolated from a pig, specifically muscle, epidermis, blood, bone, isolated tissue, isolated cells, saliva, urine, various body fluids, and hair isolated from pigs. However, it is not particularly limited thereto.

The amplification of step b) of the present invention is to amplify the marker of the present invention from DNA, and any method known to those skilled in the art may be used. Specific examples, PCR, ligase chain reaction (LCR), transcription amplification (transcription amplification), self-maintaining sequence replication, nucleic acid-based sequence amplification (NASBA), etc. may be used, but is not limited thereto.

In the genotype analysis in step c), any method known to those skilled in the art may be used for the step of determining the base of the genetic marker included in the amplification product. Specific examples, sequencing, mini-sequencing, allele specific PCR (allele specific PCR), dynamic allele-specific hybridization (DASH), PCR extension analysis (eg, single base extension (SBE)), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg, Sequenom's MassARRAY system), Bio-Plex system (BioRad), restriction enzyme digestion, etc. can be used. .

In one embodiment of the present invention described above, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and represented by SEQ ID NO:3 If the 1524th 1527th base of the MYH3 gene is a continuous base of ACGT, the haplotype was defined as QQ, and the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and SEQ ID NO: 2 When the 1002th base of the MYH1 gene is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype was defined as qq. In addition, the remaining haplotypes except for QQ and qq types were defined as Qq or qQ.

Therefore, in the present invention, haplotype determination is to determine the haplotype as QQ, Qq or qq by synthesizing the genotype analysis results. Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, and SEQ ID NO: 2 When the 1002th base of the MYH1 gene represented by is T/T, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are consecutive bases of ACGT, the haplotype is determined as QQ, and SEQ ID NO: 1 The 1002th base of the MYH13 gene represented by is A/A, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO:3 are ACGT If it is different from the consecutive bases of , the haplotype may be determined as qq, and the haplotypes other than QQ and qq types may be determined as Qq or qQ.

In an embodiment of the present invention, primers specific for each gene were prepared to detect SNP mutations in the MYH13 or MYH1 gene, and then genotyping was performed by pyrosequencing.

In the present invention, "pyrosequencing" does not require a labeled primer and does not require a gel electrophoresis process, and performs a nucleotide sequence analysis of only about 30 to 40 base pairs (bp) of the DNA base sequence, thereby rapidly and accurately way to analyze it. Pyrosequencing is performed by sequential addition and merging of nucleotides one at a time in primer-directed PCR, and the pyrophosphate released as the nucleotides are merged is paired with ATP sulfurylase and luciferase enzymes to emit light. It emits light and detects this light. The emitted light shows a signal peak in the reaction order of each sequentially entered nucleotide, and this light is seen as a peak having a relative height in proportion to the number of merged nucleotides, and by looking at this, the sequence can be determined in real time. While the conventional direct DNA sequencing method has a disadvantage in that it requires a lot of time for sequencing, pyrosequencing reacts with a sequencing primer if only a PCR product to be sequenced is prepared, which is performed by a pyrosequencing device within about 10 minutes. It is possible to analyze the sequence, so that the analysis time can be shortened.

Therefore, the method of analyzing the genotype of the present invention may be to prepare a primer set specific for MYH13 or MYH1 and analyze the genotype using a Pyro-sequencer.

In a specific embodiment of the present invention, the 'A▼CGT' part of the nucleotide sequence of the nucleotide mutation was cut using the HpyCH4IV restriction enzyme in the MYH3 gene amplification product to confirm the 6bp indel genotype. Specifically, it was confirmed that when the mutation region of the MYH3 promoter was 6bp (+/+), the gene was not cut and appeared as one band, and in the case of 6bp (-/-), the gene was cut and displayed as two bands. In addition, in the case of 6bp (+/-), it was confirmed that three bands appeared.

Therefore, the method of analyzing the genotype of the present invention may be to cut the 'A▼CGT' part of the nucleotide sequence of the nucleotide mutation using the HpyCH4IV restriction enzyme in the MYH3 gene amplification product and analyze the cleavage pattern of the gene.

In addition, in the above-described embodiment, when the haplotype is QQ, it was confirmed that the collagen content of pork was higher than that of qq and Qq. In the prediction method of the present invention, when determining the haplotype of pig QQ, the collagen content is qq and It may be to predict that it will be high compared to Qq.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

1. Preparation of Pigs

Nanji Livestock Research Institute, National Institute of Livestock Science, Rural Development Administration, used black pigs raised in Nanji. In addition, animal experiments in this study were approved by the Animal Experiment Ethics Committee of the National Academy of Livestock Science and were performed in compliance with the committee regulations (No. 2017-241).

2. DNA Isolation

Genetic analysis was performed by extracting DNA from the jugular vein of pigs (test animals) or tails of piglets produced. DNA isolation was performed by modifying the sucrose-proteinase K method (Sambrook et al., 1989). After measuring the absorbance of the isolated DNA with a NanoDrop ND-1000 spectrophotometer (spectrophotometer, NanoDrop Technologies, USA), genomic DNA with an A260/A280 ratio of 1.8 or higher was used as a template for polymerase chain reaction (PCR). .

3. Genotyping of pork

The gene determining the pig meat quality is present in the 661 kb region of chromosome 12, and the gene present in the region was confirmed through LALD mapping. As a result, as shown in FIG. 1 , it was confirmed that nine genes, MYH3, MYH1, MYH2, MYH13, ADPRM, SCO1, TMEM220, ENSSSCG00000029441, and ENSSSCG0000008006, were present in the meat quality gene region (FIG. 1).

As a result of analyzing the phenotype by inserting the pig meat trait-related gene into the mouse, it was confirmed that a lot of red meat was deposited in the mice into which the pig MYH1 and MYH13 genes were inserted. In addition, in the MYH2 gene, a genetic marker related to meat quality was not detected. Therefore, the gene region with high association significance with meat quality is MYH13 to MYH3 gene.

Accordingly, in order to analyze the effect of the MYH13, MYH1, and MYH3 genotypes included in the gene region having high association with meat quality on the collagen content in pork, primers specific for each gene were prepared and these genotypes were analyzed.

3.1. Genotyping of the MYH13 gene

The SNP mutation of the MYH13 gene is located at bases 57,934,149 of chromosome 12, which is the promoter region of the myosin-13 gene, and is T or A. 2003 nucleotides were obtained based on the MYH13 gene SNP (SEQ ID NO: 1). To detect the SNP, primers were prepared as shown in Table 1, and genotyping was performed using Pyro-sequencer.

base sequence MYH13 gene
(SEQ ID NO: 1) [T/A] MYH13_5U_F
(SEQ ID NO: 4) TGA-GGG-GTC-TCT-TGA-GTG-TTG MYH13_5U_R
(SEQ ID NO: 5) biotin- CAT-GGT-TCC-TAG-TCG-GAT-TTG MYH13_MINI_seq
(SEQ ID NO: 6) AAA-GCC-AAG-CTG-AGC-CCA-AT MYH13 input seq
(SEQ ID NO: 12) [T/A] AAGGAGGCCTCGGAAAA

Among the primers, MYH13_5U_R was prepared in a form in which biotin was bound to its 5'-end. A mutated gene sample was obtained by performing PCR using the primer and genomic DNA obtained from a pig as a template.

Add 50 ng of DNA, 10 pmole primer, 10 × buffer 2 μl, dNTP 5 mM, 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) to make 20 μl, and use Nexus (Eppendorf, Germany) and PCR was performed. The PCR reaction conditions were repeated 35 times for 30 seconds at 94°C, 60 seconds at 62°C, and 60 seconds at 72°C after initial denaturation at 95°C for 3 minutes, followed by final extension at 72°C for 5 minutes. The amplified PCR product was confirmed on a 1.5% agarose gel.

Genotyping was performed using the Pyro-sequencer on the obtained mutated gene sample (FIG. 2). 2 is a graph showing the result of detecting the SNP mutation by performing genotyping of the MYH13 gene using a Pyro-sequencer. As shown in FIG. 2 , it was confirmed that the SNP mutations of the MYH13 gene, T/T genotype, T/A genotype, and A/A genotype, respectively showed different results.

3.2. Genotyping of the MYH1 gene

The SNP mutation of the MYH1 gene is located at base 57,964,336 of chromosome 12, which is the promoter region of the myosin-1 gene, and is either G or T. 2003 nucleotides were obtained based on the MYH1 gene SNP (SEQ ID NO: 2). To detect the SNP, primers were prepared as shown in Table 2, and genotyping was performed using Pyro-sequencer.

base sequence MYH1 gene
(SEQ ID NO:2) [G/T] MYH1_5U_F
(SEQ ID NO: 7) TGT-GTA-AAC-CAA-GGT-CAC-AAA-AA MYH1_5U_R
(SEQ ID NO:8) biotin-ATG-GCA-ATA-GAA-CAA-AAT-GCA-A MYH1_MINI_seq
(SEQ ID NO: 9) TAA-TTT-AAT-TTT-TTT-TTT-TTT MYH1 input seq
(SEQ ID NO: 13) [G/T]GAGACTGTGGCCTGTGTGGGTT

Among the primers, MYH1_R was prepared in a form in which biotin was bound to its 5'-end. A mutated gene sample was obtained by performing PCR using the primer and genomic DNA obtained from a pig as a template.

50 ng of DNA, 10 pmole primer, 10 × buffer 2 μl, dNTP 5 mM, 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) was added to make 20 μl, and Nexus (Eppendorf, Germany) was added. PCR was performed using The PCR reaction conditions were repeated 35 times for 30 seconds at 94°C, 60 seconds at 62°C, and 60 seconds at 72°C after initial denaturation at 95°C for 3 minutes, followed by final extension at 72°C for 5 minutes. The amplified PCR product was confirmed on a 1.5% agarose gel.

Genotype analysis using Pyro-sequencer was performed on the obtained mutated gene sample (FIG. 3). 3 is a graph showing the results of detecting SNP mutations by performing genotyping of the MYH1 gene using a Pyro-sequencer. As shown in FIG. 3 , it was confirmed that the G/G genotype, G/T genotype, and T/T genotype, which are SNP mutations of the MYH1 gene, each showed different results.

3.3. Genotyping of the MYH3 gene

To analyze the genotype of the MYH3 gene, 5'-UTR 3kb from the transcription start site (TSS) of the pig MYH3 gene and 3'-UTR 1kb from the stop codon were deciphered. .

As a result, a 6 bp indel mutation was confirmed in the promoter region of the MYH3 gene (SEQ ID NO: 3) affecting meat quality.

Porcine myh3 promoter region mutation region (6bp-nucleotide deletion)

6bp(-/-) :

GACGATCCTAATGAGACAGCAGGA------CGTGTGTTCCCCACACAAGTTGTACAATCAC

6bp(+/+) :

GACGATCCTAATGAGACAGCAGGAGGACTGCTGTTGTTCCCCCACAAGTTGTACAATCAC

In order to confirm the effect of the nucleotide mutation of the porcine MYH3 promoter region on the porcine collagen content, the portion including the nucleotide mutation was amplified using the primers (SEQ ID NOs: 10 and 11) in Table 3, and then using the HPyCH4IV restriction enzyme. The 'A▼CGT' part of the nucleotide sequence of the causative base mutation was cut. Thereafter, the cleavage pattern of the pig MYH3 gene by restriction enzymes was confirmed.

Specifically, for the PCR reaction, 50 ng of DNA, 10 pmole primer, 2 μl of 10x buffer, 5 mM dNTP, and 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) were added to make 20 μl, and Nexus (Eppendorf) , Germany) was used for PCR. PCR reaction conditions were initial denaturation at 95°C for 3 minutes, followed by 35 repetitions of 30 seconds at 94°C, 60 seconds at 64°C, and 60 seconds at 72°C, followed by final extension at 72°C for 5 minutes.

The PCR product was cleaved using restriction enzyme (HpyCH4IV), and the restriction enzyme reaction conditions were 37 μl of the PCR product, 1 μl of 10 × buffer, 0.3 μl of restriction enzyme, and 5.7 μl of distilled water (DW) according to the supplier's manual. The reaction was carried out at ℃ overnight. After the restriction enzyme cleavage pattern was electrophoresed on a 3% agarose gel containing ethidium bromide, it was confirmed whether the gene was amplified under UV.

As can be seen in Figure 4, when the mutant region of the pig MYH3 promoter is 6bp (+/+), the gene is not cut and appears as one band, and in the case of 6bp (-/-), the gene is cut and appears as two bands. Confirmed. In addition, in the case of 6bp (+/-), it was confirmed that three bands appeared.

3.4. Pig genetic haplotype analysis

Based on the genotype analysis results of MYH13, MYH1, and MYH3, pig haplotypes were classified into qq, Qq(qQ), and QQ types (Table 4).

Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and the 1524th base of the MYH3 gene represented by SEQ ID NO:3 When bases 1527 to 1527 are consecutive bases of ACGT, the haplotype is determined as QQ, base 1002 of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and base 1002 of the MYH1 gene represented by SEQ ID NO: 2 If the base is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype is determined as qq, and the other haplotypes except for QQ and qq types It was determined as Qq or qQ.

haplotype gene MYH13 MYH1 MYH3 QQ T/T T/T 6 bp (-/-) qq A/A G/G 6 bp (+/+)

4. Method of measuring pig collagen content

Collagen has 12.5% (when nitrogen and protein count is 6.25) or 14% hydroxyproline. Collagen content can be estimated by quantifying hydroxyproline. After hydrolysis of the sample with sulfuric acid solution, filtration and dilution, chloramine-T is added to oxidize hydroxyproline to pyrrole. After that, when 4-dimethylaminobenzaldehyde is added, it reacts with pyrrole to develop a reddish-purple color. The degree of color development was measured using a spectrophotometer, and the collagen content was measured compared to the standard solution.

4.1. Preparation of reagents

1) Preparation of sulfuric acid solution

750 ml of distilled water was added to a 2ℓ volumetric flask, and 375 ml of sulfuric acid was slowly added thereto while stirring. After cooling at room temperature, the final amount (2 L) was diluted with distilled water to prepare a 7 N sulfuric acid solution.

2) Preparation of Buffer Solution

Citric acid monohydrate (C6H8O7-H2O) 30g, NaOH 15g, sodium acetate trihydrate (CH3COONa-3H2O) 90g, and distilled water 500ml were mixed. After mixing 290 ml of 1-propanal with the solution, the pH was adjusted to 6.0, followed by 1 liter of distilled water. The prepared buffer was stored in a brown bottle and refrigerated at 4°C.

3) Preparation of oxidizing solution solution

1.41 g of chloramine-T was dissolved in 100 ml of the buffer solution prepared above, put in a brown bottle, and stored refrigerated at 4°C.

4) Preparation of color reagent

35 ml of perchloric acid (60% w/w) and 10 g of 4-methylaminobenzaldehyde are mixed, and 65 ml of 2-isopropyl alcohol (2-propanol) is added while stirring, and prepared on the same day was used.

5) H-proline standard solution (Hydroxyproline standard solution)

Stock solution: It was prepared by dissolving 60 mg of H-proline in 100 ml of distilled water, put in a brown bottle, and refrigerated at 4°C.

Intermediate solution: 5 ml of the stock solution was diluted to 500 ml to prepare to contain 6 μg H-proline per 1 ml.

Working solution: Take 10, 20, 30 or 40 ml of the intermediate solution and dilute it with distilled water to make a total volume of 100 ml. That is, a solution containing 0.6, 1.2, or 2.4 μg of H-proline per 1 ml was prepared.

4.2. Measurement of collagen content in pork

Specifically, 4 g of the ground pork sample was placed in an Erlenmeyer flask, 30 ml of 7N sulfuric acid solution was added, covered with a glass cover, and heated in a dryer for 16 hours. Thereafter, it was placed in a diaphragm flask of 500 ml, diluted with distilled water, and a portion of the flask was filtered with filter paper in an Erlenmeyer flask of 100 ml. Take 5 ml of the filtered solution and dilute to 100 ml of the solution to obtain a concentration of 0.5 to 2.4 μg/ml of hydroxyproline.

2ml of the final dilution was put into a 10ml test tube, 1ml of the oxidizing solution was added, and the mixture was shaken. At this time, the blank (blank) was prepared by adding 1 ml of an oxidizing solution to 2 ml of distilled water. Leave at room temperature for 20±2 minutes, add 1ml of color developer to the test tube, mix, cover, and immediately heat in a constant temperature water bath at 60±0.5°C for exactly 15 minutes, then cool in running tap water for at least 3 minutes. Thereafter, the absorbance of each sample was measured at a wavelength of 550 nm with a spectrophotometer. When preparing samples, they should be stored in a refrigerator at 5℃ or less, and if stored for 3 days or more, they should be stored at -18℃ or less. The samples stored frozen were immediately crushed after collection and used as samples for analysis.

The collagen content in pork was calculated using Equations 1 and 2.

H = hydroxyproline content in 100 g of sample

5. Collagen content of pork according to genetic haplotype

Table 5 shows the results of analyzing the collagen content of each pork part according to the pig genotype (QQ, Qq, qq).

Collagen content of each part (loin, half-mak, thigh, upper arm, and neck) was compared according to the gene haplotypes (qq, Qq, QQ) of pork. As a result of the analysis, the collagen content of the QQ genotype was measured to be 22.0%, 62.8%, 43.1%, 22.6%, and 16.3%, respectively, higher than that of the qq genotype pork in sirloin, half-mak, thigh, upper arm, and loin, respectively. confirmed to have. The portion of pork belly had the highest content in the QQ type, but did not show any significance.

That is, through the above results, when the haplotype genotype of pigs was fixed as QQ type, it was confirmed that the collagen content was increased by 16.3% to 62.8% compared to the qq genotype. predicts the collagen content, and through this, it can be usefully used for breeding and selection of pigs with excellent collagen content.

<110> CRONEX.CO.,LTD REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Marker for predicting collagen content in pork and use thereof <130> DP20200082 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 2003 <212> DNA <213> Artificial Sequence <220> <223> MYH13 gene <400> 1 acaggcactg agatttgctc ctatttgcaa agtgatggac actgttctgg acatggtggg 60 tgtccaggaa gcactgaact gaatagtaat tgctctgtaa ttctgggcat cacactagcc 120 attgcctctg gagcgtccta tgtaagtcag tctgcggccc ggcaagttct atttggtata 180 ttcacccatc tagcaggaat cagcgtcact ctctccttag gggagaggga gttcaacccc 240 ttccaccacc atcttcccct ttctctaaag caaacatcac aaaaacaaag cccaagccct 300 cggagaagga gacgggagca ggggtgtgga ccacggcagc tttcacccgc tgcgtcacta 360 cagagcagag cagagtcttg ttctgccttc aggttcccac ggagcagcat ccactttcta 420 acactccaaa ggaaagtgag gatgcccaag ctggcagggg catctgagct caacacttac 480 ccggtcatcg agggtcttga ctgtgacctt gtcgttctcc ctgctctgga tcataccctt 540 cacatacagt tccttatcgt ccaccgcaaa gcaggctttc ttggaatcga atgggcggtt 600 ctgagcctcg attctctcct tctctgattt ccgcaggtag ggagctgcct ctccaaagac 660 ggccatctct gcgtcagagc tcatggctgc aggggctggg gagacggggg gctgctcagt 720 ctgaagcctg gggagcgctc ccgaatctgg caggccctgc tctcttactt ccattcggac 780 aaggggctgg attcagaagc tcctgggatt aacctaggtc ttgaggactc taggaccagt 840 tctaggggtc tggcgtgggc aagcggggat gagctaaagg gaaaatttta ctctaagaaa 900 aacgtttgag gggtctcttg agtgttgact tggaaacatc ttagtccagc tccaggtatg 960 gaagccagaa gctgtgagag gaaagccaag ctgagcccaa twaaggaggc ctcggaaaag 1020 acttccttga ttacacgtca tgtttgagcc ccatggtcta tgtcactccc aaatcttaaa 1080 tgtgtcttgg gagttcccat catggctcag tggttgacaa atccgactag gaaccatgag 1140 gttgtgggtt cgatccctgg cctcgctccg tgggttaagg atccggtgtt gctgtgagct 1200 gcggtgtagg ttgcagacgt ggctcggatc ccacattgct gtggctctgc cataggccgg 1260 tggctacagc tccaattaga cccctagcct cggaccctcc atatatgcag caggtgcagc 1320 cccagaacag acaaaaagac agaaaaacaa acaaaaaaaa tcttaaagct gtctgaaaag 1380 aagtattgga atgttgataa ttcttagcag aaacttcagg cagtccagtg aaaagtgatg 1440 acttgagtta caggtagcaa ggtgatggga ggtgtgatgg tttagggcag tggttccaaa 1500 cttgaacatg ccccagaatg aactgcagag attgtcaaaa cacacatgtc tgggccctaa 1560 ctgcagagtt tctgaatctg tcggtgtggg atggagcgtg agaatataca tttctagcac 1620 gttcctggag atgctgatgg ggctggtcca gggaccacac cctgagaacg gctgggtgta 1680 gggcctgcct gctccaagtg cggtccttga acaggttgca tcaggagctt gttagacatt 1740 cagaatctca gacccaccca gattacaaaa gcagcatctg tattgtaaca agctctccag 1800 gtgatttctg ggcatatgat aaaattgaca agtactgggc tgaacgcaga ggtctctgaa 1860 cttcagttac tggcagcatc agggggtgac aaagagtgtc taattagatt aacgcctgcc 1920 taagaactcg ctgccaaatg tgtctgttgg atgtggtgtt tatgtgtctg tctgcctctc 1980 tttctctctc ccactccctt cta 2003 <210> 2 <211> 2003 <212> DNA <213> Artificial Sequence <220> <223> MYH1 gene <400> 2 tggatcttct ttaatttcct tgattaatgt tttatagttc tcagcatata tgtctttcac 60 ttctttggtc gagtttattc ctaggtattt aattttttga ggtgtgattt gaaaaggtgt 120 attgtatttt tatattccct ttctaatatt tcattgttag tatacagaaa tgcaaccaat 180 ttctgaatgt taatcttgta tcctgctact ttgctgaatg ctgatcagtt tgagtatttt 240 ttgtgtggag tccttaggat tttctgtata tagtgtcatg tcatctgcat acagtaacaa 300 ttttaccttt tctcttccag tttggatacc ttttattttt tttgttgtct gactgctatg 360 actaggactt ccaatactac gttgaataaa agtggtggga gtgggcatcc ttgtcttttt 420 ccagatttag taggaagact tttagctttt ctccattgag tattatattt gttctgggtt 480 tgtcataaat ggcttttatt atgttaaggt atattccctc tatacccact ttggtaagtg 540 tttttatcgt gaatggatgt tgactttgtc aaatgctttt tctggatcta ttgagatgat 600 tgtgtggctt tcagtataac tacttggcat tagttttttt tttttttaat atatatatat 660 gcaggaaaca agttctttat cagggatata atttgcaaat actttttctc agttggtggc 720 ttgttttttc cttctcttta acagtgtttc tcaaagctca gaaactctgg attttgatga 780 aatctaattt atcttttttt ttttctttct tggcttgtgc ttttggtgtt gctaagacat 840 ttttgtgtaa accaaggtca caaaaattta ctcttatgtt tacttctagg agtttttagg 900 attatgtttt tggtatcctc gtctatccaa aattttgttt aggagcgtgt tttgaatttt 960 ttgttttaaa ctgttgttag taatttaatt tttttttttt tkgagactgt ggcctgtgtg 1020 gtttatactg taaaggaatg aggctgatag gggtttgagg acaggagaga gtggatggta 1080 ggaggtggaa gagggacaca agtacacaaa atacatttat tgtctacatt gcattttgtt 1140 ctattgccat ctctctttct agaaacaaaa ctccttgtgt ttatactgca ttgaatcttg 1200 tcttgttctt cctcttttca taagttcttc ctcttcttcc tctctttctc tggcccactt 1260 atccatccaa tgtatcagaa aaccccatgt ggaattcctg ttgtggctca gagggttagg 1320 aaccctacta gtatccatga ggacgcaggt ttggtccctg gccttgctca gtgggttaag 1380 gagctggtgt tcctgcaagc tgtggtgtag ctcacagatg tggcttggat ctggtgttgc 1440 tgtggctgtg gtgtagatcc aattcgacct ctagcccaca aacgtctata tgccacagtt 1500 gcggccctaa aaagaaaaaa agaaaagaaa accccacgtg cactaccttc ccagtacatc 1560 tagaatccat ccagttctcg tcatctccca atgccatctc tctggtccaa gccacaggct 1620 tttttttttt tttaatcttt tattttgcag taaactccta actggtctcc tggtttccac 1680 ctctatcccc tttagtctgt tctcaacaca gcagtaagag tgattctttt taaaaatgtg 1740 ctaatatcac ttctctggtc aaaaccttct aaagatttca catctctttc tgagtaaaga 1800 caaaagtcct gaggtggcct caggccctac aggatctctg ggctccagat acctctcttt 1860 tgctgtaaca atcttgctca ttctcctcta accctgctag cctccttccc aacctaccaa 1920 actaatcctg cctcagggcc tttgcatttt ctgttgttcc ttcccttgga aaggctctgc 1980 cttgttaatc tcatggctta ccc 2003 <210> 3 <211> 3400 <212> DNA <213> Artificial Sequence <220> <223> MYH3 gene <400> 3 tggtggttat tgccgctgct tccaccctca gggttctcct ggcgagcgga gctccctgcc 60 tacctcggac cctcgttcca tggcccgggc aggcttcttc ccctcgtgcc ttccagcccc 120 tcatgtgcag aagcaggccg tcaggcagat gacccgagac ctcccagccg agcctctgtg 180 ctcgtggagg acgtgtgacg gagagaagga agacaggccg gctgacgggg gaaaagctgg 240 ggtgggaggc cgtcagcctt gagctcgcct tgggctcagg gatgcgacgt ggcttcacgc 300 ttgacaagaa gctcaaagaa atcctgtgtg gaaaacgtcc tctcggtgtc ccggaggtgg 360 gatggatgtg gttgtgcaga ggtgggtgaa ccggcgccaa ctaaaggtca aaagcaagcc 420 ggccccaacc gcggcccctg gtgtttaaga agggaccgcc agcacccttc ccctgaccac 480 ccagcacacg tcacagcctg agacgtagcc agggcccctg cactgtccct cagccccagg 540 gggcttgcta acacctctgc ttccaggtga catgcacctg tcctcaccag gcctcccagg 600 atggctggcc aatggcgcag agagtcaggc cggcgcgtcc ctgggcaggg agaccacgcc 660 ccttcaggac cggagggtcc ttgaggaggg tcgagctctc ttcttggacg aggaggattt 720 ctgggggagg gggtttcagt cccagcggcg gggggtgggc ggtggggcgt gcatgtagc 780 atggcaggtc catgcttcct gactttcctc ctgatggcca cttgcctacc tgctttgatc 840 taaaaatcac caaaatctca gacataatcg agtcaccatt tatccaagaa accatcgagg 900 gtaaagccgc agcttccatt tctttcgatt cttcttccag ggttctgcct tgggcccagc 960 atgcagtggg tgtttaatta atgcccctgc ccctcgggga ctgcagcccc actccccctg 1020 ccccaccccc agcccttaga gtggcctcct ggcccgcgct gcgtgtggct atgctgggag 1080 ggggccgttc ttattctcca gtggggacag ctgacaccag aatgaacgac aacgggttac 1140 ccacaggcca cgctcccaac ggtctgtcag ggaaaaaaag ggaaaaacag acataaagtg 1200 gaataagaat gggcaaacgc ttcagccata cccctctgtg ctcctaaggc tttatttttc 1260 taaccctgat ttagaaacag ccatgctcgt tagacgcccc ctcacccccc tttctctgca 1320 ggccctgcca tccccccacc cccgccccgg ccagcagctg gtctttccta attggtgaca 1380 tgtcttaata actacaggtc cttgagcagc tgtcactgtg gctcctggct ggtgggctac 1440 ctccctctca gtcatttact cgttggtcct actggcgctt aagacagagg tttagttaat 1500 gacgatccta atgagacagc aggacgtgtg ttccccacac aagttgtaca atcacacatt 1560 cctgccacaa ccctgtgttg taacaaaagc cttgctcaaa actccaagag ggtttaaact 1620 tttccgtcct tggcttcatc cctttgccca caggccgaga ttctaggtcc ccgctgtccc 1680 agagaccagg ctcatctcca gccgtgtggc gcctgtggga tggagcgagg gccccccggca 1740 aggctgtccc atcactgagc cgccggttca gagaaaggca tcccaaactt ccagctttct 1800 ccagctagga tcctgtcatt tctatatata cctctctctt ggcagcggca aaaaaaagcg 1860 aggaaggagc tggtcctcac ttgtggtgtc ggtcactctc tttccaaata tagagaagga 1920 atgagtggcg ggggttagca ggggctataa aagcccgcgg ggagcgcccc ttgtagctgc 1980 tctgtgggcg gaggagagtc acagtgcccc ttgtgcgggt ccttcccatc tgaggctcag 2040 aggctcgtgt ggccctgccc ggctttggta aggaccagac gtgcggctga ttctcagccc 2100 ctccccgcct ccagcatccc gcttccttca cctgttctcc cctgccctca tcctccagag 2160 ccttcccggg cagggtccct tcggatgctc tgtggaccac tgccgtcacc ccggcccatg 2220 aacgctgcca cctctctgac ttgtgcagag gccagtgggc ctggccgcct ccccacctgc 2280 gctgcgggcc tgcggtgtct gtcctctcaa ggccacgctg gctgtgcatc cgttggcttg 2340 tctgagactt cgccctgcct gccccacagaa gacagggggc ctggccctgg cttggaggca 2400 caggcttttc aaacagagct tctgtcctga ctgctcacat ctgaggagga ggcatggcag 2460 acagagggtg gtgccacccg ggcaggaggg agccaggtct ggggcggctg ggggctctcc 2520 tgccttcagg gctcacctgt gggccaggtc ccatttgctc ctccagcttg tctctgggcc 2580 aaggctcttt taaagttatt cgtcctttct cttcatttgg ttaattgatt aaggcccatt 2640 cagaactgaa ccagacactc ccacgtctcc tgaccttttg tgtatttatt gcaggtctga 2700 tttctcacgg ctgctgctgt ctgctgtcct cctgcgggtg tgactctcag gtgagaaagc 2760 aggtcaggtc ccctggctca gccatctcca gggtactggt tcccccccgg ccacggcctt 2820 gcggcgagca ggacaggtta ggctggagag gagccccagg gaaggctgcc aagcagatgc 2880 tgatgtgaga agccgcttgt ttgtagaagg gactgaagcc ggtttccagg tgggggatgg 2940 agccaccctg aatccgagcg gttccaaaac tccttagcta tttgcccttt aacacgctct 3000 ttgaagaatg tttgcttttg agagtgttta cctttacgtc ttccctcagc aacccctggc 3060 ttttacagaa gaggaaagcg gggtcccaag agctgcaccc acctctgggc gctctgcccg 3120 ccccagcccc ggctaacggg ggagcttgga ttgcgtgcat cccgtgtcct ctgcacagag 3180 gagctgctca atgaaatgca cccatttgat cccggggggc tggatggcgg cggccttgct 3240 cctgggctcc gcctggaggg cgcctgtggg gtcagggctg gagtctggcc cggggactca 3300 ctggggggtc ccttccagcc gacaccatga gcagcgacac tgaaatggaa gtgttcggca 3360 tagccgctcc cttcctccgc aagtcggaaa aggagaggat 3400 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH13_5U_F <400> 4 tgaggggtct cttgagtgtt g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH13_5U_R <400> 5 catggttcct agtcggattt g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MYH13_MINI_seq <400> 6 aaagccaagc tgagcccaat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH1_5U_F <400> 7 tgtgtaaacc aaggtcacaa aaa 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1_5U_R <400> 8 atggcaatag aacaaaatgc aa 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH1_MINI_seq <400> 9 taatttaatt ttttttttt t 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH3_F <400> 10 tgtgtaaacc aaggtcacaa aaa 23 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH3_R <400> 11 atggcaatag aacaaaatgc aa 22 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MYH13 input seq <400> 12 waaggaggcc tcggaaaa 18 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1 input seq <400> 13 kgagactgtg gcctgtgtgg tt 22

Claims (8)

(a) the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof;
(b) a polynucleotide comprising 5 to 100 consecutive bases including the 1002 base, or a complementary polynucleotide thereof, in which the 1002 base of the MYH1 gene represented by SEQ ID NO: 2 is G or T, and
(c) comprising a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3, or a polynucleotide complementary thereto,
Haplotype marker for prediction of collagen content in pork. Including an agent capable of detecting or amplifying the haplotype marker of claim 1,
A composition for predicting the collagen content of pork. delete 3. The method of claim 2,
The agent comprises the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and SEQ ID NO: 10 capable of amplifying the MYH3 gene and a polynucleotide represented by 11,
A composition for predicting the collagen content of pork. A kit for predicting collagen content of pork, comprising the composition of claim 2. a) isolating DNA from a sample isolated from a subject;
b) amplifying the haplotype marker of claim 1 in the DNA; and
c) analyzing the genotype of the amplification product to determine the haplotype,
A method for predicting collagen content in pork. 7. The method of claim 6,
In step c), the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and 1524 of the MYH3 gene represented by SEQ ID NO:3 If the th to 1527th bases are consecutive bases of ACGT, the haplotype is determined as QQ,
The 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is G/G, 1524th to 1527th of the MYH3 gene represented by SEQ ID NO:3 If the base is different from the consecutive bases of ACGT, the haplotype is determined as qq,
To determine the remaining haplotypes except for QQ and qq types as Qq,
A method for predicting collagen content in pork. 8. The method of claim 7,
When determining the haplotype QQ, the collagen content is predicted to be high compared to qq and Qq,
A method for predicting collagen content in pork.

Images