KR102387425B1 - Marker for predicting meat color of pork and use thereof - Google Patents

Abstract

The genetic marker of the present invention is a haplotype marker for predicting the color of pork in pigs, and it is possible to predict the color of pork at the molecular biological level by analyzing the mutated regions of the MYH13, MYH1 and MYH3 genes of pigs. It can be utilized for this excellent pig breeding and selection.

Description

Marker for predicting meat color of pork and use thereof

The present invention relates to a marker for predicting pork color and a method for predicting pork color using the same.

The swine industry has focused primarily on improving productivity related to meat quantity and distribution of fresh meat, which has been accompanied by a decrease in pork quality. In order to overcome this problem, the industry has developed a meat quality improvement system that satisfies the consumer's demand for the best quality of pork.

Recently, in order to improve the quality of pork, pigs are raised and scientifically managed under a certain standard, and the resulting pork is branded, and various brands of pork are already commercially sold. However, since branded pork and unbranded pork are difficult to identify with the naked eye, incidents that disrupt the distribution of pork by exploiting this point to deceive and sell unbranded pork as branded pork occurs frequently.

Research to discover the causative genes involved in the meat quality or meat quality traits of pigs and to explore the genetic location is being actively conducted. In particular, for the discovery of trait-related gene markers, gene mutation regions such as single nucleotide polymorphism (SNP) and insertion deletion (insert/deletion, indel) are being actively explored and trait-related research is being actively conducted for functional genes. To date, various trait-related SNP and indel markers have been discovered.

In many cases, the existence of SNPs has been revealed according to the completion of the genome map, but there are still undiscovered SNPs, and there are still many cases where the effects of discovered SNPs on the phenotype have not been studied.

Republic of Korea Patent Registration No. 10-1816605

The problem to be solved by the present invention is to provide a haplotype marker for predicting the color of pork, a composition including an agent capable of detecting or amplifying the marker, a kit including the composition, and a method for predicting the color of pork using the same .

In order to solve the above problems, the present invention provides (a) the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base Or a complementary polynucleotide thereof, (b) a polynucleotide comprising 5 to 100 consecutive bases including the 1002 base in which the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G or T, or its complement Pork meat color comprising a polynucleotide comprising a specific polynucleotide and (c) a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3, or a polynucleotide complementary thereto A haplotype marker for prediction is provided.

The haplotype marker can further predict the protein content of pork or the meat pigment content of pork.

The present invention also provides a composition for predicting the color of pork, comprising an agent capable of detecting or amplifying the haplotype marker.

The agent may be a primer or a probe.

The agent comprises the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and SEQ ID NO: 10 capable of amplifying the MYH3 gene. It may include a polynucleotide represented by to 11.

The composition can further predict the protein content of pork or the meat pigment content of pork.

The present invention also provides a kit for predicting the color of pork, comprising the composition.

In addition, the present invention comprises the steps of a) isolating DNA from a sample isolated from an individual, b) amplifying the DNA with the haplotype marker, and c) analyzing the genotype of the amplification product to determine the haplotype , provides a method for predicting the color of pork.

In step c), the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and the MYH3 gene represented by SEQ ID NO:3 If the 1524th to 1527th bases are consecutive bases of ACGT, the haplotype is determined as QQ, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and the MYH1 gene represented by SEQ ID NO: 2 If the 1002th base is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype is determined as qq, and the remaining haplotypes except for QQ and qq types It may be to determine the body type as Qq or qQ.

When the haplotype is determined as QQ, it may be predicted that the redness and yellowness values of pork are high compared to qq and Qq.

The haplotype marker according to the present invention can predict the color of pork meat at the molecular biological level by analyzing the mutated regions of the MYH13, MYH1 and MYH3 genes of pigs. Through this, it is possible to cultivate and produce pigs with excellent meat color due to the high red and yellowness of the pork, which can improve consumers' purchasing desire and promote pork consumption.

1 shows the gene region gene group of the meat trait (intramuscular fat content, red meat, etc.) within pig chromosome 12.
2 is a result of analyzing the MYH13 genotype pattern by pyro-sequencing (PYRO-SEQUENCER).
3 is a result of analyzing the MYH1 genotype pattern by pyro-sequencing (PYRO-SEQUENCER).
4 is a result of electrophoretic analysis of the MYH3 promoter region mutation region.

The present invention is a molecular marker capable of early selection of high-quality pigs by searching for mutations in pork genes, and examining the relationship between these genetic mutations and the meat color of pork, protein content of pork, and meat pigment content of pork. was intended to develop.

The present invention provides (a) a polynucleotide consisting of 5 to 100 consecutive bases including the 1002 base, or a complementary polynucleotide thereof, in which the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, (b) a polynucleotide comprising 5 to 100 consecutive bases including the 1002 base, or a complementary polynucleotide thereof, wherein the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G or T, and (c) ) A polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3, or a haplotype marker for predicting pork color comprising a polynucleotide complementary thereto to provide.

In the present invention, pig gene haplotypes QQ, Qq, and qq types were classified according to the MYH13 gene, MYH1 gene, and MYH3 gene mutation regions.

In the present invention, “marker” refers to a short DNA sequence used to identify diversity caused by mutations or modifications at a locus.

For the purpose of the present invention, the marker may refer to a gene in which a base mutation (polymorphism or indel) appears according to the color of pork in pork.

In the present invention, "haplotype marker" refers to a marker comprising a combination of alleles of each locus linked on the same chromosome when polymorphic loci are densely linked on one chromosome. . If the haplotype is used, a gene region can be identified, and a chain imbalance relationship can be formed between alleles forming the haplotype.

For the purpose of the present invention, the haplotype marker may be all or part of a polynucleotide including a single nucleotide polymorphism (SNP) site of MYH13, a gene of MYH1, and an indel site of MYH3, specifically SEQ ID NO: 1 All or part of a polynucleotide consisting of (MYH13 gene), all or part of a polynucleotide consisting of SEQ ID NO: 2 (MYH1 gene), all or part of a polynucleotide consisting of SEQ ID NO: 3 (MYH3 gene) It may include, more specifically, the 1002th base of the MYH13 gene is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof, SEQ ID NO:2 The 1002th base of the MYH1 gene represented by is G or T, and a polynucleotide comprising 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof, and MYH3 gene represented by SEQ ID NO:3 It may include a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of , or a complementary polynucleotide thereof.

In the present invention, “MYH13 gene” refers to a gene encoding MYH13, which is myosin expressed in the extrinsic eye muscle, and in the present invention, the MYH13 gene includes the polynucleotide of SEQ ID NO: 1.

In the present invention, "MYH1 gene" means a gene encoding myosin heavy chain 1, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal, and in the present invention, the MYH1 gene is a poly represented by SEQ ID NO: 2 contains nucleotides.

In the present invention, "MYH3 gene" means a gene encoding myosin heavy chain 3, which is one of the heavy chain proteins contained in myosin constituting the muscle of an animal, and in the present invention, the MYH3 gene is a polynucleotide of SEQ ID NO: 3 include

In the present invention, "nucleotide" or "polynucleotide" refers to deoxyribonucleotides or ribonucleotides that exist in single-stranded or double-stranded form, and unless otherwise specified, includes analogs of natural nucleotides.

As used herein, the term “polymorphism” refers to a case in which two or more alleles exist at one locus, and among polymorphic sites, only a single base differs from one person to another as a single base It is called single nucleotide polymorphism (SNP). Preferred polymorphic markers have two or more alleles with an incidence of at least 1%, more preferably at least 5% or 10% in a selected population.

In the present invention, an allele refers to several types of a gene present at the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles.

In an embodiment of the present invention, the haplotype of the pig gene was determined by analyzing the genotypes of the SNP sites of MYH13 and MYH1 and the 6bp indel mutation region of MYH3 in DNA isolated from pigs, and haplotypes (qq, Qq, QQ) Pig meat color, protein content, and pork pigment were compared for each part (loin, half-mak, thigh, upper arm, loin). Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and the 1524th to the 1524th to the MYH3 gene represented by SEQ ID NO:3 When the 1527th base is a continuous base of ACGT, the haplotype was defined as QQ, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G/G, and when the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the consecutive bases of ACGT, the haplotype was defined as qq. In addition, the remaining haplotypes except for QQ and qq types were defined as Qq or qQ.

As a result of analyzing the meat color of pork according to the haplotype in the embodiment of the present invention, the redness (a) and yellowness (b) of the QQ genotype pork were higher than that of the qq genotype pork in sirloin, half-mak, thigh, and upper arm. It was confirmed that the pork color was excellent (Example 1).

Therefore, the color of pork can be predicted using the haplotype marker of the present invention. The haplotype marker predicts the color of pork through MYH13, MYH1 and MYH3 genotype analysis, and can be used for breeding and selecting pigs with excellent pork color through this.

As a result of analyzing the protein content of pork according to haplotypes in another embodiment of the present invention, in sirloin, half-mak, thigh, upper arm, neck, and samgyeopsal, QQ genotype pork had a lower protein content and increased intramuscular fat content than qq genotype pork. was confirmed (Example 2).

Therefore, the protein content or intramuscular fat content of pork can be predicted using the haplotype marker of the present invention. The haplotype marker predicts the protein content of pork through MYH13, MYH1, and MYH3 genotyping, and through this, it is possible to increase the consumption of non-preferred parts by controlling the protein content of the pork.

As a result of analyzing the meat pigment content of pork according to haplotypes in another embodiment of the present invention, in sirloin, half-mak, thigh, upper arm, and loin, QQ genotype pork increased oxymyoglobin content than qq genotype pork, but myoglobin and myoglobin It was confirmed that the metmioglobin content was reduced (Example 3).

Therefore, the meat pigment content of pork can be predicted using the haplotype marker of the present invention. The haplotype marker predicts the meat pigment content of pork through MYH13, MYH1, and MYH3 genotype analysis, and can be usefully used for excellent breeding and selection of pigs.

In the present invention, "myoglobin" is one of the heme proteins present in the muscle cells of vertebrates, and is an important pigment protein involved in the color of meat products or the color of meat products during processing. It has a molecular weight of 17,000 and is composed of heme and globin protein like hemoglobin, a blood bovine, and contains one heme per molecule. The color of meat is mainly myoglobin itself, and the color of fresh raw meat is the color of reduced myoglobin. When raw meat is exposed to air for a long time, it turns grayish-brown because myoglobin on the meat surface is oxidized and converted to metmyoglobin. In this way, the oxidation of heme ferric iron to trivalent ferrous iron is called metation, but brown heated meat produced when meat is heated is also met, and myoglobin is changed to metmyochromogen. The beautiful red color of salt growth is the color of nitrosomyoglobin combined with myoglobin and nitric oxide.

In the present invention, "oxymyoglobin" is a kind of myoglobin derivative, and one molecule of oxygen is bonded to the 6th coordination site of heme iron (Fe+2), and has a bright red color. The fact that myoglobin contained in muscle has a physiological function as an oxygen storage is based on the property of reversibly binding oxygen in the form of oxymyoglobin. The red color on the surface of fresh meat is due to the presence of oxymyoglobin. The inside of meat is dark red due to red-purple reduced myoglobin, but when sliced, the surface is exposed to air, and reduced myoglobin and oxygen combine to form oxymyoglobin, resulting in a vivid red color. This phenomenon is called blooming. Oxymyoglobin has a very stable property that the surface of meat keeps red for a relatively long time.

In the present invention, "metmyoglobin" refers to a state in which one water molecule is bonded to a coordination site where an iron atom located at the center of the heme of myoglobin is oxidized from divalent to trivalent. The fresh growth surface is bright red by oxymyoglobin, but it is gradually oxidized by long-term storage to produce metmyoglobin, which turns brown. When the amount of metmyoglobin produced reaches about 60% of the total amount of myoglobin, browning of meat occurs clearly. Various factors such as pH, oxygen partial pressure, salt concentration, light, and temperature are involved in the production of metmyoglobin on the surface of meat. Meat that has turned brown due to the production of metmyoglobin loses its commercial value because it does not return to red even when placed in the air again after that.

The present invention also provides a composition for predicting the color of pork, comprising an agent capable of detecting or amplifying the haplotype marker.

The composition for predicting pork color of the present invention may be improved in statistical significance, reliability, accuracy, etc. compared to a single marker by analyzing a single haplotype marker.

Pork meat quality other than the single nucleotide polymorphism disclosed in the present invention may include other single nucleotide polymorphisms that have been statistically significant, and may be used in various combinations to improve the statistical significance, reliability and accuracy of predicting pork meat quality.

In the present invention, “agent capable of detecting or amplifying” refers to an agent capable of specifically binding to and recognizing or amplifying a marker of the present invention, and is a primer or probe that specifically binds to the specific genetic marker. can

In the present invention, "primer" is a nucleotide sequence having a short free 3' hydroxyl group, which can form a complementary template and base pair, and serves as a starting point for template strand copying. A short sequence that functions. Primers are capable of initiating DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in appropriate buffers and temperatures. In this case, PCR conditions, the length of the sense and antisense primers can be modified based on what is known in the art.

The primer can serve as a starting point for template-directed DNA synthesis under appropriate conditions (e.g., four different nucleoside triphosphates and a polymerase such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. It may be a single-stranded oligonucleotide with a single-stranded oligonucleotide, and the appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be completely complementary to the marker sequence, but must be sufficiently complementary to hybridize with the marker sequence.

The primers of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, “encapsulation”, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methyl phosphonates, phosphotriesters, phosphoroamidates, carbamates, etc.) or charged linkages (eg phosphorothioates, phosphorodithioates, etc.).

In the present invention, the primers are the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and the MYH3 gene capable of amplifying It may include a polynucleotide represented by SEQ ID NOs: 10 to 11.

In the present invention, “probe” refers to a natural or modified monomer or a linear oligomer including deoxyribonucleotides and ribonucleotides capable of hybridizing to a specific nucleotide sequence. Preferably, the probe is single-stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

The present invention also provides a kit for predicting the color of pork, comprising the composition for predicting the color of pork.

The kit of the present invention may be a PCR (Polymerase Chain Reaction) kit or a DNA chip kit.

The kit of the present invention can determine the meat color level of pork by confirming the genotype of a haplotype marker for predicting pork color through amplification. As a specific example, in the present invention, it may be a kit including essential elements necessary to perform PCR of a haplotype marker for predicting the color of pork. In addition to each primer pair specific for the gene of the haplotype, the PCR kit includes a test tube or other suitable container, reaction buffer (pH and magnesium concentration vary), deoxynucleotides (dNTPs), and Taq-polymer. enzymes such as enzymes and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, and the like.

Also preferably, the kit of the present invention may be a kit including essential elements necessary for performing a DNA chip. A DNA chip kit is a method in which nucleic acid species are attached in a gridd array to a generally flat solid support plate, typically a glass surface no larger than a microscope slide, and the nucleic acids are uniformly arranged on the chip surface, and the DNA chip It is a tool that allows multiple hybridization reactions to occur between the nucleic acids on the chip surface and the complementary nucleic acids contained in the solution treated on the chip surface, enabling massively parallel analysis.

The present invention also includes the steps of a) isolating DNA from a sample isolated from an individual, b) amplifying the DNA using the composition, and c) determining the haplotype by analyzing the genotype of the amplification product It provides a method for predicting the color of pork meat.

In the present invention, “individual” refers to a pig, a target for checking the level of meat color of pork, and by analyzing the genotype of the polymorphic site and indel site of the SNP included in the haplotype marker using the sample obtained from the pig, the You can judge the color level of pork.

The "isolated sample" of the present invention may be a sample isolated from a pig, specifically, muscle, epidermis, blood, bone, isolated tissue, isolated cells, saliva, urine, various body fluids, and hair isolated from a pig. However, it is not particularly limited thereto.

The amplification of step b) of the present invention is to amplify the marker of the present invention from DNA, and any method known to those skilled in the art can be used. Specific examples, PCR, ligase chain reaction (LCR), transcription amplification (transcription amplification), self-maintaining sequence replication, nucleic acid-based sequence amplification (NASBA), etc. may be used, but is not limited thereto.

In the genotype analysis in step c), any method known to those skilled in the art may be used for determining the base of the genetic marker included in the amplification product. Specific examples, sequencing, mini-sequencing, allele specific PCR (allele specific PCR), dynamic allele-specific hybridization (DASH), PCR extension analysis (eg, single base extension (SBE)), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (e.g., Sequenom's MassARRAY system), Bio-Plex system (BioRad), restriction enzyme digestion, etc. may be used. .

In an embodiment of the present invention described above, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is T/T, and represented by SEQ ID NO:3 If the 1524th to 1527th bases of the MYH3 gene are continuous bases of ACGT, the haplotype was defined as QQ, and the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and is represented by SEQ ID NO:2 When the 1002th base of the MYH1 gene is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are different from the continuous bases of ACGT, the haplotype was defined as qq. In addition, the remaining haplotypes except for QQ and qq types were defined as Qq or qQ.

Therefore, in the present invention, haplotype determination is to determine the haplotype as QQ, Qq or qq by synthesizing the genotype analysis results. Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, and SEQ ID NO: 2 When the 1002th base of the MYH1 gene represented by is T/T, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO: 3 are consecutive bases of ACGT, the haplotype is determined as QQ, and SEQ ID NO: 1 The 1002th base of the MYH13 gene represented by is A/A, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is G/G, and the 1524th to 1527th bases of the MYH3 gene represented by SEQ ID NO:3 are ACGT If it is different from the consecutive bases of , the haplotype may be determined as qq, and the haplotypes other than QQ and qq types may be determined as Qq or qQ.

In an embodiment of the present invention, primers specific for each gene were prepared to detect SNP mutations in the MYH13 or MYH1 gene, and then genotyping was performed by pyrosequencing.

In the present invention, "pyrosequencing" does not require a labeled primer and does not require a gel electrophoresis process, and performs a nucleotide sequence analysis of only about 30 to 40 base pairs (bp) of the DNA base sequence, thereby rapidly and accurately way to analyze it. Pyrosequencing is performed by sequential addition and merging of nucleotides one at a time in primer-directed PCR, and the pyrophosphate released as the nucleotides are merged is coupled with ATP sulfurylase and luciferase enzymes to emit light. It emits light and detects this light. The emitted light shows a signal peak in the reaction order of each sequentially entered nucleotide, and this light is seen as a peak having a relative height in proportion to the number of merged nucleotides, and by looking at this, the sequence can be determined in real time. While the conventional direct DNA sequencing method has a disadvantage in that it requires a lot of time for sequencing, pyrosequencing reacts with a sequencing primer if only a PCR product to be sequenced is prepared, which is performed by a pyrosequencing device within about 10 minutes. It is possible to analyze the sequence, so that the analysis time can be shortened.

Therefore, the method of analyzing the genotype of the present invention may be to prepare a primer set specific for MYH13 or MYH1 and analyze the genotype using a Pyro-sequencer.

In a specific embodiment of the present invention, the 'A▼CGT' part of the nucleotide sequence of the nucleotide mutation was cut using the HpyCH4IV restriction enzyme in the MYH3 gene amplification product to confirm the 6bp indel genotype. Specifically, it was confirmed that when the mutation region of the MYH3 promoter was 6bp (+/+), the gene was not cut and appeared as one band, and in the case of 6bp (-/-), the gene was cut and displayed as two bands. In addition, in the case of 6bp (+/-), it was confirmed that three bands appeared.

Therefore, the method of analyzing the genotype of the present invention may be to cut the ' A▼CGT ' part of the nucleotide sequence of the nucleotide mutation using the HpyCH4IV restriction enzyme in the MYH3 gene amplification product and analyze the cleavage pattern of the gene.

In addition, in the above-described embodiment, when the haplotype is QQ, it was confirmed that the redness and yellowness values of pork were higher than those of qq and Qq. It may be to predict that pork will have better color compared to Qq.

Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

1. Preparation of Pigs

Nanji Livestock Research Institute, National Institute of Livestock Science, Rural Development Administration, used black pigs raised in Nanji. In addition, animal experiments in this study were approved by the Animal Experiment Ethics Committee of the National Academy of Livestock Science and were performed in compliance with the committee regulations (No. 2017-241).

2. DNA Isolation

Genetic analysis was performed by extracting DNA from the jugular vein of pigs (test animals) or tails of piglets produced. DNA isolation was performed by modifying the sucrose-proteinase K method (Sambrook et al., 1989). After measuring the absorbance of the isolated DNA with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, USA), genomic DNA with an A ₂₆₀ /A ₂₈₀ ratio of 1.8 or higher is used as a template for polymerase chain reaction (PCR). was used.

3. Genotyping of pork

The gene determining the pig meat quality is present in the 661kb region of chromosome 12, and the gene present in the region was confirmed through LALD mapping. As a result, as shown in FIG. 1 , it was confirmed that 9 genes, MYH3, MYH1, MYH2, MYH13, ADPRM, SCO1, TMEM220, ENSSSCG00000029441, and ENSSSCG0000008006, were present in the meat quality gene region (FIG. 1).

As a result of analyzing the phenotype by inserting the pig meat trait-related gene into the mouse, it was confirmed that a lot of red meat was deposited in the mice into which the pig MYH1 and MYH13 genes were inserted. In addition, in the MYH2 gene, a genetic marker related to meat quality was not detected. Therefore, the gene region with high association significance with meat quality is MYH13 to MYH3 gene.

Accordingly, to analyze the effect of the MYH13, MYH1, and MYH3 genotypes included in the gene region with high association with meat quality on the color of pork in pork, primers specific for each gene were prepared and these genotypes were analyzed.

3.1. Genotyping of the MYH13 gene

The SNP mutation of the MYH13 gene is located at bases 57,934,149 of chromosome 12, which is the promoter region of the myosin-13 gene, and is T or A. 2004 nucleotides were obtained based on the MYH13 gene SNP (SEQ ID NO: 1). To detect the SNP, primers were prepared as shown in Table 1, and genotyping was performed using Pyro-sequencer.

base sequence MYH13 gene
(SEQ ID NO: 1) [T/A] MYH13_5U_F
(SEQ ID NO: 4) TGA-GGG-GTC-TCT-TGA-GTG-TTG MYH13_5U_R
(SEQ ID NO: 5) biotin -CAT-GGT-TCC-TAG-TCG-GAT-TTG MYH13_MINI_seq1
(SEQ ID NO: 6) AAA-GCC-AAG-CTG-AGC-CCA-AT MYH13 INPUT seq
(SEQ ID NO: 12) [T/A]AAGGAGGCCTCGGAAAA

Among the primers, MYH13_5U_R was prepared in a form in which biotin was bound to its 5'-end. A mutated gene sample was obtained by performing PCR using the primer and genomic DNA obtained from a pig as a template. Genotyping was performed using the Pyro-sequencer on the obtained mutated gene sample (FIG. 2).

For PCR reaction, 50 ng of DNA, 10 pmole primer, 10x buffer 2ul, dNTP 5 mM, 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) was added to make 20ul, and Nexus (Eppendorf, Germany) PCR was performed using The PCR reaction conditions were initial denaturation at 95˚C for 3 minutes, then the reaction was repeated 35 times at 94˚C for 30 seconds, 62˚C for 60 seconds, and 72˚C for 60 seconds, and finally at 72˚C for 5 minutes. elongated. The amplified PCR product was confirmed on a 1.5% agarose gel.

2 is a graph showing a result of detecting the SNP mutation by performing genotyping of the MYH13 gene using a Pyro-sequencer. As shown in FIG. 2 , it was confirmed that the SNP mutations of the MYH13 gene, T/T genotype, T/A genotype, and A/A genotype, respectively showed different results.

3.2. Genotyping of the MYH1 gene

The SNP mutation of the MYH1 gene is located at base 57,964,336 of chromosome 12, which is the promoter region of the myosin-1 gene, and is either G or T. 2004 nucleotides were obtained based on the MYH1 gene SNP (SEQ ID NO: 2). To detect the SNP, primers were prepared as shown in Table 2, and genotyping was performed using Pyro-sequencer.

base sequence MYH1 gene
(SEQ ID NO:2) [G/T] MYH1_5U_F
(SEQ ID NO: 7) TGT-GTA-AAC-CAA-GGT-CAC-AAA-AA MYH1_5U_R
(SEQ ID NO:8) biotin-ATG-GCA-ATA-GAA-CAA-AAT-GCA-A MYH1_MINI_seq1
(SEQ ID NO: 9) TAA-TTT-AAT-TTT-TTT-TTT-TTT MYH1 INPUT seq
(SEQ ID NO: 13) [G/T]GAGACTGTGGCCTGTGTGGGTT

Among the primers, MYH1_R was prepared in a form in which biotin was bound to its 5'-end. A mutated gene sample was obtained by performing PCR using the primer and genomic DNA obtained from a pig as a template. Genotype analysis using Pyro-sequencer was performed on the obtained mutated gene sample (FIG. 3).

For PCR reaction, 50 ng of DNA, 10 pmole primer, 10x buffer 2ul, dNTP 5 mM, 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) was added to make 20ul, and Nexus (Eppendorf, Germany) PCR was performed using The PCR reaction conditions were: After initial denaturation at 95˚C for 3 minutes, the reaction was repeated 35 times at 94˚C for 30 seconds, 62˚C for 60 seconds, and at 72˚C for 60 seconds, and finally at 72˚C for 5 minutes. elongated. The amplified PCR product was confirmed on a 1.5% agarose gel.

3 is a graph showing the results of detecting SNP mutations by performing genotyping of the MYH1 gene using a Pyro-sequencer. As shown in FIG. 3 , it was confirmed that the G/G genotype, G/T genotype, and T/T genotype, which are SNP mutations of the MYH1 gene, each showed different results.

3.3. Genotyping of the MYH3 gene

To analyze the genotype of the MYH3 gene, 5'-UTR 3kb from the transcription start site (TSS) of the pig MYH3 gene and 3'-UTR 1kb from the stop codon were deciphered. . As a result, a 6 bp indel mutation was confirmed in the promoter region of the MYH3 gene affecting meat quality.

Porcine myh3 promoter region mutation region (6bp-nucleotide deletion)

6 bp (-/-)

GACGATCCTAATGAGACAGCAGGA------CGTGTGTTCCCCACACAAGTTGTACAATCAC

6 bp (+/+)

GACGATCCTAATGAGACAGCAGGAGGACTGCTGTTGTTCCCCCACAAGTTGTACAATCAC

base sequence MYH3 gene
gene
(SEQ ID NO:3) tggtggttat tgccgctgct tccaccctca gggttctcct ggcgagcgga gctccctgcc 60
tacctcggac cctcgttcca tggcccgggc aggcttcttc ccctcgtgcc ttccagcccc 120
tcatgtgcag aagcaggccg tcaggcagat gacccgagac ctcccagccg agcctctgtg 180
ctcgtggagg acgtgtgacg gagagaagga agacaggccg gctgacgggg gaaaagctgg 240
ggtgggaggc cgtcagcctt gagctcgcct tgggctcagg gatgcgacgt ggcttcacgc 300
ttgacaagaa gctcaaagaa atcctgtgtg gaaaacgtcc tctcggtgtc ccggaggtgg 360
gatggatgtg gttgtgcaga ggtgggtgaa ccggcgccaa ctaaaggtca aaagcaagcc 420
ggccccaacc gcggcccctg gtgtttaaga agggaccgcc agcacccttc ccctgaccac 480
ccagcacacg tcacagcctg agacgtagcc agggcccctg cactgtccct cagccccagg 540
gggcttgcta acacctctgc ttccaggtga catgcacctg tcctcaccag gcctcccagg 600
atggctggcc aatggcgcag agagtcaggc cggcgcgtcc ctgggcaggg agaccacgcc 660
ccttcaggac cggagggtcc ttgaggaggg tcgagctctc ttcttggacg aggaggattt 720
ctgggggagg gggtttcagt cccagcggcg gggggtgggc ggtggggcgt gcatgtagc 780
atggcaggtc catgcttcct gactttcctc ctgatggcca cttgcctacc tgctttgatc 840
taaaaatcac caaaatctca gacataatcg agtcaccatt tatccaagaa accatcgagg 900
gtaaagccgc agcttccatt tctttcgatt cttcttccag ggttctgcct tgggcccagc 960
atgcagtggg tgtttaatta atgcccctgc ccctcgggga ctgcagcccc actccccctg 1020
ccccaccccc agcccttaga gtggcctcct ggcccgcgct gcgtgtggct atgctgggag 1080
ggggccgttc ttattctcca gtggggacag ctgacaccag aatgaacgac aacgggttac 1140
ccacaggcca cgctcccaac ggtctgtcag ggaaaaaaag ggaaaaacag acataaagtg 1200
gaataagaat gggcaaacgc ttcagccata cccctctgtg ctcctaaggc tttatttttc 1260
taaccctgat ttagaaacag ccatgctcgt tagacgcccc ctcacccccc tttctctgca 1320
ggccctgcca tccccccacc cccgccccgg ccagcagctg gtctttccta attggtgaca 1380
tgtcttaata actacaggtc cttgagcagc tgtcactgtg gctcctggct ggtgggctac 1440
ctccctctca gtcatttact cgttggtcct actggcgctt aagacagagg tttagttaat 1500
gacgatccta atgagacagc aggacgtgtg ttccccacac aagttgtaca atcacacatt 1560
cctgccacaa ccctgtgttg taacaaaagc cttgctcaaa actccaagag ggtttaaact 1620
tttccgtcct tggcttcatc cctttgccca caggccgaga ttctaggtcc ccgctgtccc 1680
agagaccagg ctcatctcca gccgtgtggc gcctgtggga tggagcgagg gccccccggca 1740
aggctgtccc atcactgagc cgccggttca gagaaaggca tcccaaactt ccagctttct 1800
ccagctagga tcctgtcatt tctatatata cctctctctt ggcagcggca aaaaaaagcg 1860
aggaaggagc tggtcctcac ttgtggtgtc ggtcactctc tttccaaata tagagaagga 1920
atgagtggcg ggggttagca ggggctataa aagcccgcgg ggagcgcccc ttgtagctgc 1980
tctgtgggcg gaggagagtc acagtgcccc ttgtgcgggt ccttcccatc tgaggctcag 2040
aggctcgtgt ggccctgccc ggctttggta aggaccagac gtgcggctga ttctcagccc 2100
ctccccgcct ccagcatccc gcttccttca cctgttctcc cctgccctca tcctccagag 2160
ccttcccggg cagggtccct tcggatgctc tgtggaccac tgccgtcacc ccggcccatg 2220
aacgctgcca cctctctgac ttgtgcagag gccagtgggc ctggccgcct ccccacctgc 2280
gctgcgggcc tgcggtgtct gtcctctcaa ggccacgctg gctgtgcatc cgttggcttg 2340
tctgagactt cgccctgcct gccccacagaa gacagggggc ctggccctgg cttggaggca 2400
caggcttttc aaacagagct tctgtcctga ctgctcacat ctgaggagga ggcatggcag 2460
acagagggtg gtgccacccg ggcaggaggg agccaggtct ggggcggctg ggggctctcc 2520
tgccttcagg gctcacctgt gggccaggtc ccatttgctc ctccagcttg tctctgggcc 2580
aaggctcttt taaagttatt cgtcctttct cttcatttgg ttaattgatt aaggcccatt 2640
cagaactgaa ccagacactc ccacgtctcc tgaccttttg tgtatttatt gcaggtctga 2700
tttctcacgg ctgctgctgt ctgctgtcct cctgcgggtg tgactctcag gtgagaaagc 2760
aggtcaggtc ccctggctca gccatctcca gggtactggt tcccccccgg ccacggcctt 2820
gcggcgagca ggacaggtta ggctggagag gagccccagg gaaggctgcc aagcagatgc 2880
tgatgtgaga agccgcttgt ttgtagaagg gactgaagcc ggtttccagg tgggggatgg 2940
agccaccctg aatccgagcg gttccaaaac tccttagcta tttgcccttt aacacgctct 3000
ttgaagaatg tttgcttttg agagtgttta cctttacgtc ttccctcagc aacccctggc 3060
ttttacagaa gaggaaagcg gggtcccaag agctgcaccc acctctgggc gctctgcccg 3120
ccccagcccc ggctaacggg ggagcttgga ttgcgtgcat cccgtgtcct ctgcacagag 3180
gagctgctca atgaaatgca cccatttgat cccggggggc tggatggcgg cggccttgct 3240
cctgggctcc gcctggaggg cgcctgtggg gtcagggctg gagtctggcc cggggactca 3300
ctggggggtc ccttccagcc gacaccatga gcagcgacac tgaaatggaa gtgttcggca 3360
tagccgctcc cttcctccgc aagtcggaaa aggagaggat 3400 MYH3_F
(SEQ ID NO:10) TGT-GTA-AAC-CAA-GGT-CAC-AAA-AA MYH3_R
(SEQ ID NO: 11) biotin-ATG-GCA-ATA-GAA-CAA-AAT-GCA-A

In order to confirm the effect of base mutation in the porcine MYH3 promoter region on the color of pork, primers (SEQ ID NO: 10 forward: 5'-TGG TCT TTC CTA ATT GGT GAC AT-3', SEQ ID NO: 11 reverse: 5'-AGT TTT GAG CAA GGC TTT TGT T-3') was used to amplify the part including the nucleotide mutation, and then, the ' A▼CGT ' part was cut from the nucleotide sequence of the causative nucleotide mutation using HpyCH4IV restriction enzyme. Then, the cleavage pattern of the pig MYH3 gene by restriction enzymes was confirmed.

For PCR reaction, 50 ng of DNA, 10 pmole primer, 10x buffer 2ul, dNTP 5 mM, 2.5 units of i-Taq DNA polymerase (Intron Biotechnology, South Korea) was added to make 20ul, and Nexus (Eppendorf, Germany) PCR was performed using The PCR reaction conditions were: After initial denaturation at 95˚C for 3 minutes, the reaction was repeated 35 times at 94˚C for 30 seconds, 62˚C for 60 seconds, and at 72˚C for 60 seconds, and finally at 72˚C for 5 minutes. elongated. The amplified PCR product was confirmed on a 1.5% agarose gel.

The PCR product was cut using a restriction enzyme (HpyCH4IV), and the restriction enzyme reaction conditions were 37 μl of the PCR product, 1 μl of the 10× buffer, 0.3 μl of the restriction enzyme, and 5.7 μl of distilled water (DW) according to the supplier's manual. The reaction was carried out at ℃ overnight. Restriction enzyme cleavage pattern was electrophoresed on a 3% agarose gel containing ethidium bromide, and then, it was confirmed whether the gene was amplified under UV.

As can be seen in Figure 4, if the mutant region of the pig MYH3 promoter is 6bp (+/+), the gene is not cut and appears as one band, and in the case of 6bp(-/-), the gene is cut and appears as two bands. Confirmed. In addition, in the case of 6bp (+/-), it was confirmed that three bands appeared.

3.4. Pig genotype haplotype analysis

Based on the genotype analysis results of MYH13, MYH1, and MYH3, pig haplotypes were classified into qq, Qq(qQ), and QQ types.

Specifically, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is T/T, and the 1524th to the 1524th to the MYH3 gene represented by SEQ ID NO:3 If the 1527th base is a continuous base of ACGT, the haplotype is determined as QQ, the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, and the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G/G, and when bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3 are different from the continuous bases of ACGT, the haplotype is determined as qq, and the haplotypes other than QQ and qq are Qq or qQ.

haplotype
(haplotype) gene MYH13 MYH1 MYH3 QQ T/T T/T 6 bp (-/-) qq A/A G/G 6 bp (+/+)

4. How to measure pork color

Chroma meter (Minolta Co, CR 301) was used to measure color intensity (L), redness (a), and yellowness (b) by CIE values for each of the 4 parts (loin, half-mak, thigh, and upper arm).

5. How to Measure Pork Protein Content

Pork protein was analyzed using a Kjeltec System (Kjeltec Auto 2400/2460, Foss Tecator AB, Hoganas, Sweden) in accordance with AOAC (2006). After decomposition of the sample by adding sulfuric acid and Kjeltab (decomposition catalyst), it was liberated with ammonia, which was collected with Boric acid containing a mixing indicator and titrated with 0.1N hydrochloric acid. The nitrogen content (%) was calculated by Equation 1 below, and this was multiplied by a nitrogen coefficient of 6.25 and expressed as protein content (%).

6. Method of measuring the meat pigment content of pork

6.1. Measuring principle of meat pigment content in pork

In the case of fresh meat, there are reduced myoglobin (purple red, deoxymyoglobin), oxygenated myoglobin (bright red, oxymyoglobin), and oxidized myoglobin (brown, metmyoglobin). can do. Since these states exist simultaneously in fresh meat, the total myoglobin content is measured at the isobestic point of myoglobin. The isobaric point is the point where two or more spectra intersect when given the same value at the same wavelength. The isobaric point of reduced myoglobin, oxygenated myoglobin, and oxide myoglobin has a wavelength of 525 nm. The color of fresh meat is developed, the whole meat pigment is extracted, the absorbance is measured at 572, 565, 545, and 525 nm, and the relative ratios of reduced myoglobin, oxygenated myoglobin, and oxidized myoglobin are shown.

6.2. reagent manufacturing

Sodium phosphate buffer (pH 6.8, ionic strength 0.04) was prepared in the following steps. Na ₂ HPO ₄ (MW 142.0) 5.68g was prepared by mixing 1ℓ of tertiary distilled water, and then refrigerated for about 10 days. Na ₂ HPO ₄ (MW 120.0) 4.80g was prepared by mixing 1ℓ of tertiary distilled water and stored in the refrigerator for about 10 days. To the stored Na ₂ HPO ₄ (MW 142.0) 40mM, Na ₂ HPO ₄ (MW 120.0) 40mM was added little by little to adjust the pH to 6.8, and stored in a refrigerator at 4°C.

6.3. How to measure the meat pigment content of pork

1) The ground meat was spread well in a sample container and allowed to develop color for 1 hour. It was placed in a container with ice while the color development was taking place.

2) 4 g of colored ground meat was taken in a centrifuge tube, 20 ml of 4 ℃ phosphate buffer (pH 6.8, ionic strength 0.04) stored in a refrigerator was added, and then homogenized at 13,000 rpm for 20 seconds (1 part: 8 samples).

3) The homogenate was wrapped in foil to block light and left in a cool and dark place (4°C) for 1 hour.

4) After grinding 2 parts (8 samples), it was left in a cool and dark place for 1 hour as above.

5) One part was centrifuged at 5,000g for 30 minutes.

6) After grinding 3 parts (8 samples), it was left in a cool and dark place for 1 hour as in 3).

7) 2 parts were centrifuged at 5,000g for 30 minutes.

8) After filtering the supernatant of 1 part with filter paper, absorbance was measured with a spectrophotometer. The spectrophotometer was turned on in advance 30 minutes before absorbance measurement, a blank was taken with tertiary distilled water, and absorbance was measured at 572, 565, 545, and 525 nm.

9) 3 part was centrifuged at 5000g for 30 minutes.

10) After filtering 2 parts, absorbance was measured in the same manner as in 8).

11) After filtering 3 parts, absorbance was measured in the same manner as in 8).

6.4. Calculation of meat pigment content in pork

The meat pigment content of pork was calculated using Equations 2 to 7.

[Example 　1] Pork color according to the genetic haplotype

Tables 5 and 6 show the results of comparing the color of pork by parts (loin, half-mak, thigh, and upper arm) according to the genetic haplotypes (qq, Qq, QQ) of pork. Table 5 shows the results of analysis in the black pig ovum maddon group, and Table 6 shows the analysis results in the conventional pig group. As the redness (a) and yellowness (b) values increase, the meat color shows a pale red color, and the consumer's preference increases. In the case of the degree of yellowness (b), the higher the numerical value, the darker the yellow color.

part meat
part CIE Genotype p-value qq
(17) Qq
(103) QQ
(67) sirloin L 47.47 ± 3.83 46.95 ± 4.29 48.40 ± 4.06 n.s. a 7.13 ± 1.11a 9.60 ± 1.26b 10.82 ± 1.99c 2.87E-15 b 3.37 ± 0.88a 4.53 ± 1.28b 5.56 ± 1.18c 4.02E-11 half-screen L 41.25 ± 2.57 40.19 ± 3.62 40.98 ± 3.69 n.s. a 9.33 ± 1.20a 11.33 ± 1.53b 13.17 ± 2.04c 4.33E-16 b 2.83 ± 0.73a 3.62 ± 1.25b 4.88 ± 1.29c 5.06E-12 thigh L 37.51 ± 2.73a 38.89 ± 4.14a 40.67 ± 3.24b 0.001153 a 10.67 ± 1.34a 13.03 ± 1.48b 14.39 ± 1.73c 9.97E-16 b 3.13 ± 0.82a 4.24 ± 1.24b 5.30 ± 1.14c 7.6E-12 upper arm L 35.76 ± 1.83a 37.64 ± 2.96b 39.39 ± 2.84c 4.28E-06 a 11.68 ± 1.70a 14.08 ± 1.52bc 14.24 ± 1.54c 1.42E-08 b 2.64 ± 0.69a 3.89 ± 1.18bc 4.23 ± 1.14c 3.53E-06

Looking at Table 5, it can be seen that, in the case of the black pig ovum maddon group, the redness (a) and yellowness (b) of pork increased in the order of qq genotype, Qq genotype, and QQ genotype in sirloin, half-mak, thigh, and upper arm. .

genotype analysis
head number Sirloin (longest bae) half-screen thigh upper arm L a b L a b L a b L a b Qq 8 47.81±
2.72 9.91
±
1.62 4.39
±
1.06 40.13±
2.79 12.10±
1.56 3.30
±
0.94 39.33±
3.02 14.13±
1.27 4.16
±
0.93 39.23±
2.11 14.17±
1.94 3.94
±
0.99 QQ 10 47.67±
3.08 11.69±
1.50 4.44
±
1.24 39.65±
2.71 14.51±
1.22 4.12
±
0.69 38.61±
1.86 15.45±
1.29 4.64
±
0.66 38.72±
3.16 14.49±
1.46 3.6
2±
0.62

Looking at Table 6, it can be seen that the redness (a) and yellowness (b) of pork are higher in the QQ genotype than the Qq genotype in the sirloin, half-mak, thigh, and upper arm even in the conventional pig group.

That is, through these results, it was confirmed that when the haplotype genotype of pigs was fixed to the QQ type, the redness and yellowness of pork were increased compared to the qq genotype. Therefore, it is possible to predict the color of pork through MYH13, MYH1, and MYH3 genotype analysis, which can be usefully used for breeding and selecting pigs with excellent pork color.

[Example 2] Protein content of pork according to gene haplotype

Tables 7 and 8 show the results of comparing the protein content and the intramuscular fat content for each part (loin, half-mak, thigh, upper arm, pork loin, pork belly) according to the gene haplotypes (qq, Qq, QQ) of pork. Table 7 shows the protein content of part meat of black pig oocyte according to the gene haplotypes (qq, Qq, QQ), and Table 8 shows the intramuscular fat content of the part meat of black pig ovum madon according to the gene haplotype (qq, Qq, QQ). it has been shown

part meat
part Genotype p -value qq
(17) Qq
(103) QQ
(67) sirloin 21.49 ± 0.96 ^a 20.74 ± 1.18 ^b 19.90 ± 1.17 ^c 1.338E-07 half-screen 22.40 ± 0.58 ^a 20.96 ± 0.99 ^b 19.42 ± 1.51 ^c 3.261E-20 thigh 21.89 ± 0.54 ^a 20.37 ± 0.72 ^b 19.29 ± 0.93 ^c 7.782E-27 upper arm 21.17 ± 0.52 ^a 20.22 ± 0.55 ^b 19.75 ± 0.62 ^c 2.212E-16 Moksim 15.23 ± 1.07 15.51 ± 1.36 15.56 ± 2.16 n.s. Pork belly (top) 12.41 ± 1.30 ^a 11.57 ± 1.44 ^ab 11.09 ± 1.88 ^b 0.007 Pork belly (medium) 11.45 ± 1.00 ^a 10.74 ± 1.23 ^ab 10.43 ± 1.50 ^b 0.016 Pork belly (bottom) 12.38 ± 1.43 ^a 12.13 ± 1.51 ^ab 11.48 ± 1.69 ^b 0.014

Referring to Table 7, it can be seen that the meat protein content is lowered in the order of qq genotype, Qq genotype, and QQ genotype in sirloin, half-mak, thigh, upper arm, pork loin, and pork belly.

intramuscular fat content Genotype p -value qq Qq QQ sirloin 6.34 ± 2.42 ^a 8.27 ± 4.05 ^a 10.20 ± 4.59 ^b 0.0006 half-screen 2.34 ± 1.13 ^a 4.04 ± 2.67 ^a 6.97 ± 5.39 ^b 2.86E-07 thigh 2.53 ± 0.71 ^a 4.00 ± 1.34 ^b 5.72 ± 2.33 ^c 1.04E-12 upper arm 2.57 ± 0.66 ^a 3.57 ± 1.01 ^b 4.36 ± 1.53 ^c 7.25E-08 Moksim 28.31 ± 4.65 26.04 ± 5.70 25.45 ± 8.56 n.s. Pork belly (top) 45.74 ± 6.43 47.97 ± 7.10 48.04 ± 9.69 n.s. Pork belly (medium) 52.38 ± 5.40 54.69 ± 6.58 55.55 ± 9.42 n.s. Pork belly (bottom) 47.88 ± 6.64 47.90 ± 7.08 49.69 ± 8.28 n.s.

Looking at Table 8, it can be seen that the content of intramuscular fat increases in the order of qq genotype, Qq genotype, and QQ genotype in sirloin, half-mak, thigh, upper arm, pork loin, and pork belly, opposite to the meat protein content in Table 7.

That is, through these results, it was confirmed that, when the haploid genotype of pigs was fixed to the QQ type, the protein content decreased compared to the qq genotype, but the intramuscular fat content increased. Therefore, by predicting the pork protein content through MYH13, MYH1, and MYH3 genotyping, it is possible to increase the consumption of non-preferred parts by controlling the protein content and intramuscular fat content of the pork through this.

[Example 3] Meat pigment content of pork according to genetic haplotype

Tables 9 to 11 are results of comparing the content of meat pigments (myoglobin, oxymioglobin, metmyoglobin) of pork by parts (loin, half-mak, thigh, upper arm) according to the gene haplotypes (qq, Qq, QQ) of pork. . Table 9 shows the relationship with myoglobin content according to gene haplotypes (qq, Qq, QQ), Table 10 shows the relationship with oxymyoglobin content according to gene haplotypes (qq, Qq, QQ), Table 10 11 shows the relationship with metmyoglobin content according to gene haplotypes (qq, Qq, QQ).

part meat
part Genotype p-value qq
(17) Qq
(103) QQ
(67) sirloin 0.28 ± 0.02a 0.26 ± 0.06b 0.25 ± 0.05bc 0.0001 half-screen 0.27 ± 0.05a 0.24 ± 0.07b 0.24 ± 0.06bc 0.0098 thigh 0.30 ± 0.03 0.26 ± 0.05 0.26 ± 0.06 n.s. upper arm 0.28 ± 0.02 0.26 ± 0.06 0.25 ± 0.05 n.s.

Looking at Table 9, it can be seen that the myoglobin content is lowered in the order of qq genotype, Qq genotype, and QQ genotype in the sirloin, half-mak, thigh, and upper arm.

part meat
part Genotype p-value qq
(17) Qq
(103) QQ
(67) sirloin 0.35 ± 0.07a 0.42 ± 0.14b 0.43 ± 0.11bc 0.0005 half-screen 0.39 ± 0.12a 0.44 ± 0.14b 0.44 ± 0.12bc 0.0228 thigh 0.32 ± 0.11 0.4 ± 0.1 0.41 ± 0.13 n.s. upper arm 0.35 ± 0.07 0.42 ± 0.14 0.43 ± 0.11 n.s.

Looking at Table 10, it can be seen that the oxymyoglobin content increases in the order of qq genotype, Qq genotype, and QQ genotype in the sirloin, half-mak, thigh, and upper arm. The higher the content of oxymyoglobin, the more red it has.

part meat
part Genotype p-value qq
(17) Qq
(103) QQ
(67) sirloin 0.27 ± 0.07a 0.22 ± 0.09b 0.22 ± 0.08bc 0.0022 half-screen 0.25 ± 0.09 0.22 ± 0.09 0.22 ± 0.07 n.s. thigh 0.28 ± 0.09 0.25 ± 0.06 0.24 ± 0.08 n.s. upper arm 0.27 ± 0.07 0.22 ± 0.09 0.22 ± 0.08 n.s.

Referring to Table 11, it can be seen that the oxymyoglobin content decreases in the order of qq genotype, Qq genotype, and QQ genotype in the semi-mak, thigh, upper arm, and moxim. The lower the metmioglobin content, the less browning occurs.

That is, from the above results, it was confirmed that, when the haplotype genotype of pigs was fixed to the QQ type, the oxymyoglobin content increased compared to the qq genotype, but the myoglobin and metmyoglobin contents decreased.

In general, consumers prefer bright red pork, but it is natural for browning to occur during long-term storage. MYH13, MYH1, and MYH3 genotyping is used to determine the QQ genotype when fixed as a QQ genotype, so the meat pigment content of pork can be predicted. This can improve the quality of pork.

<110> REPUBLIC OF KOREA <120> Marker for predicting meat color of pork and use thereof <130> DP20200067 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 2003 <212> DNA <213> Artificial Sequence <220> <223> MYH13 gene <400> 1 acaggcactg agatttgctc ctatttgcaa agtgatggac actgttctgg acatggtggg 60 tgtccaggaa gcactgaact gaatagtaat tgctctgtaa ttctgggcat cacactagcc 120 attgcctctg gagcgtccta tgtaagtcag tctgcggccc ggcaagttct atttggtata 180 ttcacccatc tagcaggaat cagcgtcact ctctccttag gggagaggga gttcaacccc 240 ttccaccacc atcttcccct ttctctaaag caaacatcac aaaaacaaag cccaagccct 300 cggagaagga gacgggagca ggggtgtgga ccacggcagc tttcacccgc tgcgtcacta 360 cagagcagag cagagtcttg ttctgccttc aggttcccac ggagcagcat ccactttcta 420 acactccaaa ggaaagtgag gatgcccaag ctggcagggg catctgagct caacacttac 480 ccggtcatcg agggtcttga ctgtgacctt gtcgttctcc ctgctctgga tcataccctt 540 cacatacagt tccttatcgt ccaccgcaaa gcaggctttc ttggaatcga atgggcggtt 600 ctgagcctcg attctctcct tctctgattt ccgcaggtag ggagctgcct ctccaaagac 660 ggccatctct gcgtcagagc tcatggctgc aggggctggg gagacggggg gctgctcagt 720 ctgaagcctg gggagcgctc ccgaatctgg caggccctgc tctcttactt ccattcggac 780 aaggggctgg attcagaagc tcctgggatt aacctaggtc ttgaggactc taggaccagt 840 tctaggggtc tggcgtgggc aagcggggat gagctaaagg gaaaatttta ctctaagaaa 900 aacgtttgag gggtctcttg agtgttgact tggaaacatc ttagtccagc tccaggtatg 960 gaagccagaa gctgtgagag gaaagccaag ctgagcccaa twaaggaggc ctcggaaaag 1020 acttccttga ttacacgtca tgtttgagcc ccatggtcta tgtcactccc aaatcttaaa 1080 tgtgtcttgg gagttcccat catggctcag tggttgacaa atccgactag gaaccatgag 1140 gttgtgggtt cgatccctgg cctcgctccg tgggttaagg atccggtgtt gctgtgagct 1200 gcggtgtagg ttgcagacgt ggctcggatc ccacattgct gtggctctgc cataggccgg 1260 tggctacagc tccaattaga cccctagcct cggaccctcc atatatgcag caggtgcagc 1320 cccagaacag acaaaaagac agaaaaacaa acaaaaaaaa tcttaaagct gtctgaaaag 1380 aagtattgga atgttgataa ttcttagcag aaacttcagg cagtccagtg aaaagtgatg 1440 acttgagtta caggtagcaa ggtgatggga ggtgtgatgg tttagggcag tggttccaaa 1500 cttgaacatg ccccagaatg aactgcagag attgtcaaaa cacacatgtc tgggccctaa 1560 ctgcagagtt tctgaatctg tcggtgtggg atggagcgtg agaatataca tttctagcac 1620 gttcctggag atgctgatgg ggctggtcca gggaccacac cctgagaacg gctgggtgta 1680 gggcctgcct gctccaagtg cggtccttga acaggttgca tcaggagctt gttagacatt 1740 cagaatctca gacccaccca gattacaaaa gcagcatctg tattgtaaca agctctccag 1800 gtgatttctg ggcatatgat aaaattgaca agtactgggc tgaacgcaga ggtctctgaa 1860 cttcagttac tggcagcatc agggggtgac aaagagtgtc taattagatt aacgcctgcc 1920 taagaactcg ctgccaaatg tgtctgttgg atgtggtgtt tatgtgtctg tctgcctctc 1980 tttctctctc ccactccctt cta 2003 <210> 2 <211> 2003 <212> DNA <213> Artificial Sequence <220> <223> MYH1 gene <400> 2 tggatcttct ttaatttcct tgattaatgt tttatagttc tcagcatata tgtctttcac 60 ttctttggtc gagtttattc ctaggtattt aattttttga ggtgtgattt gaaaaggtgt 120 attgtatttt tatattccct ttctaatatt tcattgttag tatacagaaa tgcaaccaat 180 ttctgaatgt taatcttgta tcctgctact ttgctgaatg ctgatcagtt tgagtatttt 240 ttgtgtggag tccttaggat tttctgtata tagtgtcatg tcatctgcat acagtaacaa 300 ttttaccttt tctcttccag tttggatacc ttttattttt tttgttgtct gactgctatg 360 actaggactt ccaatactac gttgaataaa agtggtggga gtgggcatcc ttgtcttttt 420 ccagatttag taggaagact tttagctttt ctccattgag tattatattt gttctgggtt 480 tgtcataaat ggcttttatt atgttaaggt atattccctc tatacccact ttggtaagtg 540 tttttatcgt gaatggatgt tgactttgtc aaatgctttt tctggatcta ttgagatgat 600 tgtgtggctt tcagtataac tacttggcat tagttttttt tttttttaat atatatatat 660 gcaggaaaca agttctttat cagggatata atttgcaaat actttttctc agttggtggc 720 ttgttttttc cttctcttta acagtgtttc tcaaagctca gaaactctgg attttgatga 780 aatctaattt atcttttttt ttttctttct tggcttgtgc ttttggtgtt gctaagacat 840 ttttgtgtaa accaaggtca caaaaattta ctcttatgtt tacttctagg agtttttagg 900 attatgtttt tggtatcctc gtctatccaa aattttgttt aggagcgtgt tttgaatttt 960 ttgttttaaa ctgttgttag taatttaatt tttttttttt tkgagactgt ggcctgtgtg 1020 gtttatactg taaaggaatg aggctgatag gggtttgagg acaggagaga gtggatggta 1080 ggaggtggaa gagggacaca agtacacaaa atacatttat tgtctacatt gcattttgtt 1140 ctattgccat ctctctttct agaaacaaaa ctccttgtgt ttatactgca ttgaatcttg 1200 tcttgttctt cctcttttca taagttcttc ctcttcttcc tctctttctc tggcccactt 1260 atccatccaa tgtatcagaa aaccccatgt ggaattcctg ttgtggctca gagggttagg 1320 aaccctacta gtatccatga ggacgcaggt ttggtccctg gccttgctca gtgggttaag 1380 gagctggtgt tcctgcaagc tgtggtgtag ctcacagatg tggcttggat ctggtgttgc 1440 tgtggctgtg gtgtagatcc aattcgacct ctagcccaca aacgtctata tgccacagtt 1500 gcggccctaa aaagaaaaaa agaaaagaaa accccacgtg cactaccttc ccagtacatc 1560 tagaatccat ccagttctcg tcatctccca atgccatctc tctggtccaa gccacaggct 1620 tttttttttt tttaatcttt tattttgcag taaactccta actggtctcc tggtttccac 1680 ctctatcccc tttagtctgt tctcaacaca gcagtaagag tgattctttt taaaaatgtg 1740 ctaatatcac ttctctggtc aaaaccttct aaagatttca catctctttc tgagtaaaga 1800 caaaagtcct gaggtggcct caggccctac aggatctctg ggctccagat acctctcttt 1860 tgctgtaaca atcttgctca ttctcctcta accctgctag cctccttccc aacctaccaa 1920 actaatcctg cctcagggcc tttgcatttt ctgttgttcc ttcccttgga aaggctctgc 1980 cttgttaatc tcatggctta ccc 2003 <210> 3 <211> 3400 <212> DNA <213> Artificial Sequence <220> <223> MYH3 gene <400> 3 tggtggttat tgccgctgct tccaccctca gggttctcct ggcgagcgga gctccctgcc 60 tacctcggac cctcgttcca tggcccgggc aggcttcttc ccctcgtgcc ttccagcccc 120 tcatgtgcag aagcaggccg tcaggcagat gacccgagac ctcccagccg agcctctgtg 180 ctcgtggagg acgtgtgacg gagagaagga agacaggccg gctgacgggg gaaaagctgg 240 ggtgggaggc cgtcagcctt gagctcgcct tgggctcagg gatgcgacgt ggcttcacgc 300 ttgacaagaa gctcaaagaa atcctgtgtg gaaaacgtcc tctcggtgtc ccggaggtgg 360 gatggatgtg gttgtgcaga ggtgggtgaa ccggcgccaa ctaaaggtca aaagcaagcc 420 ggccccaacc gcggcccctg gtgtttaaga agggaccgcc agcacccttc ccctgaccac 480 ccagcacacg tcacagcctg agacgtagcc agggcccctg cactgtccct cagccccagg 540 gggcttgcta acacctctgc ttccaggtga catgcacctg tcctcaccag gcctcccagg 600 atggctggcc aatggcgcag agagtcaggc cggcgcgtcc ctgggcaggg agaccacgcc 660 ccttcaggac cggagggtcc ttgaggaggg tcgagctctc ttcttggacg aggaggattt 720 ctgggggagg gggtttcagt cccagcggcg gggggtgggc ggtggggcgt gcatgtagc 780 atggcaggtc catgcttcct gactttcctc ctgatggcca cttgcctacc tgctttgatc 840 taaaaatcac caaaatctca gacataatcg agtcaccatt tatccaagaa accatcgagg 900 gtaaagccgc agcttccatt tctttcgatt cttcttccag ggttctgcct tgggcccagc 960 atgcagtggg tgtttaatta atgcccctgc ccctcgggga ctgcagcccc actccccctg 1020 ccccaccccc agcccttaga gtggcctcct ggcccgcgct gcgtgtggct atgctgggag 1080 ggggccgttc ttattctcca gtggggacag ctgacaccag aatgaacgac aacgggttac 1140 ccacaggcca cgctcccaac ggtctgtcag ggaaaaaaag ggaaaaacag acataaagtg 1200 gaataagaat gggcaaacgc ttcagccata cccctctgtg ctcctaaggc tttatttttc 1260 taaccctgat ttagaaacag ccatgctcgt tagacgcccc ctcacccccc tttctctgca 1320 ggccctgcca tccccccacc cccgccccgg ccagcagctg gtctttccta attggtgaca 1380 tgtcttaata actacaggtc cttgagcagc tgtcactgtg gctcctggct ggtgggctac 1440 ctccctctca gtcatttact cgttggtcct actggcgctt aagacagagg tttagttaat 1500 gacgatccta atgagacagc aggacgtgtg ttccccacac aagttgtaca atcacacatt 1560 cctgccacaa ccctgtgttg taacaaaagc cttgctcaaa actccaagag ggtttaaact 1620 tttccgtcct tggcttcatc cctttgccca caggccgaga ttctaggtcc ccgctgtccc 1680 agagaccagg ctcatctcca gccgtgtggc gcctgtggga tggagcgagg gccccccggca 1740 aggctgtccc atcactgagc cgccggttca gagaaaggca tcccaaactt ccagctttct 1800 ccagctagga tcctgtcatt tctatatata cctctctctt ggcagcggca aaaaaaagcg 1860 aggaaggagc tggtcctcac ttgtggtgtc ggtcactctc tttccaaata tagagaagga 1920 atgagtggcg ggggttagca ggggctataa aagcccgcgg ggagcgcccc ttgtagctgc 1980 tctgtgggcg gaggagagtc acagtgcccc ttgtgcgggt ccttcccatc tgaggctcag 2040 aggctcgtgt ggccctgccc ggctttggta aggaccagac gtgcggctga ttctcagccc 2100 ctccccgcct ccagcatccc gcttccttca cctgttctcc cctgccctca tcctccagag 2160 ccttcccggg cagggtccct tcggatgctc tgtggaccac tgccgtcacc ccggcccatg 2220 aacgctgcca cctctctgac ttgtgcagag gccagtgggc ctggccgcct ccccacctgc 2280 gctgcgggcc tgcggtgtct gtcctctcaa ggccacgctg gctgtgcatc cgttggcttg 2340 tctgagactt cgccctgcct gccccacagaa gacagggggc ctggccctgg cttggaggca 2400 caggcttttc aaacagagct tctgtcctga ctgctcacat ctgaggagga ggcatggcag 2460 acagagggtg gtgccacccg ggcaggaggg agccaggtct ggggcggctg ggggctctcc 2520 tgccttcagg gctcacctgt gggccaggtc ccatttgctc ctccagcttg tctctgggcc 2580 aaggctcttt taaagttatt cgtcctttct cttcatttgg ttaattgatt aaggcccatt 2640 cagaactgaa ccagacactc ccacgtctcc tgaccttttg tgtatttatt gcaggtctga 2700 tttctcacgg ctgctgctgt ctgctgtcct cctgcgggtg tgactctcag gtgagaaagc 2760 aggtcaggtc ccctggctca gccatctcca gggtactggt tcccccccgg ccacggcctt 2820 gcggcgagca ggacaggtta ggctggagag gagccccagg gaaggctgcc aagcagatgc 2880 tgatgtgaga agccgcttgt ttgtagaagg gactgaagcc ggtttccagg tgggggatgg 2940 agccaccctg aatccgagcg gttccaaaac tccttagcta tttgcccttt aacacgctct 3000 ttgaagaatg tttgcttttg agagtgttta cctttacgtc ttccctcagc aacccctggc 3060 ttttacagaa gaggaaagcg gggtcccaag agctgcaccc acctctgggc gctctgcccg 3120 ccccagcccc ggctaacggg ggagcttgga ttgcgtgcat cccgtgtcct ctgcacagag 3180 gagctgctca atgaaatgca cccatttgat cccggggggc tggatggcgg cggccttgct 3240 cctgggctcc gcctggaggg cgcctgtggg gtcagggctg gagtctggcc cggggactca 3300 ctggggggtc ccttccagcc gacaccatga gcagcgacac tgaaatggaa gtgttcggca 3360 tagccgctcc cttcctccgc aagtcggaaa aggagaggat 3400 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH13_5U_F <400> 4 tgaggggtct cttgagtgtt g 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH13_5U_R <400> 5 catggttcct agtcggattt g 21 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> MYH13_MINI_seq1 <400> 6 aaagccaagc tgagcccaat 20 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH1_5U_F <400> 7 tgtgtaaacc aaggtcacaa aaa 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1_5U_R <400> 8 atggcaatag aacaaaatgc aa 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> MYH1_MINI_seq1 <400> 9 taatttaatt ttttttttt t 21 <210> 10 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> MYH3_F <400> 10 tgtgtaaacc aaggtcacaa aaa 23 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH3_R <400> 11 atggcaatag aacaaaatgc aa 22 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> MYH13 INPUT seq <400> 12 waaggaggcc tcggaaaa 18 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> MYH1 INPUT seq <400> 13 kgagactgtg gcctgtgtgg tt 22

Claims (10)

(a) the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T or A, and a polynucleotide consisting of 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof;
(b) the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is G or T, and a polynucleotide comprising 5 to 100 consecutive bases including the 1002th base or a complementary polynucleotide thereof, and
(c) haplotype for predicting the meat color of pork, including a polynucleotide comprising 4 to 200 consecutive bases including bases 1524 to 1527 of the MYH3 gene represented by SEQ ID NO: 3 or a complementary polynucleotide thereof marker.
delete A composition for predicting the color of pork, comprising an agent capable of detecting or amplifying the haplotype marker of claim 1.
4. The method of claim 3,
Wherein the agent is a primer or a probe, a composition for predicting the color of pork.
4. The method of claim 3,
The agent comprises the polynucleotides represented by SEQ ID NOs: 4 and 5 capable of amplifying the MYH13 gene, the polynucleotides represented by SEQ ID NOs: 7 and 8 capable of amplifying the MYH1 gene, and SEQ ID NO: 10 capable of amplifying the MYH3 gene and a polynucleotide represented by 11, a composition for predicting the color of pork.
delete A kit for predicting the color of pork, comprising the composition of claims 3 to 5.
a) isolating DNA from a sample isolated from a subject;
b) amplifying the haplotype marker of claim 1 with the DNA; and
c) analyzing the genotype of the amplification product to determine the haplotype; a method for predicting the color of pork.
9. The method of claim 8,
In step c), the 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is T/T, the 1002th base of the MYH1 gene represented by SEQ ID NO:2 is T/T, and 1524 of the MYH3 gene represented by SEQ ID NO:3 If the th to 1527th bases are consecutive bases of ACGT, the haplotype is determined as QQ,
The 1002th base of the MYH13 gene represented by SEQ ID NO: 1 is A/A, the 1002th base of the MYH1 gene represented by SEQ ID NO: 2 is G/G, 1524th to 1527th of the MYH3 gene represented by SEQ ID NO:3 If the base is different from the consecutive bases of ACGT, the haplotype is determined as qq,
A method for predicting the color of pork meat, wherein the haplotypes other than QQ and qq types are determined as Qq or qQ.
10. The method of claim 9,
When the haplotype is determined QQ, it is predicted that the redness and yellowness values of the pork will be higher compared to qq and Qq, the pork color prediction method.

Images