KR20130128603A - Snp for determination of meat quantity in hanwoo and diagnosis method of meat quantity using the same - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker related to carcass weight and eye muscle area of Hanwoo (Korean beef), and more specifically, to an SNP marker related to carcass weight and eye muscle area in FAS gene existing in quantitative trait loci for early determining and selecting premium Hanwoo for improving meat quantity. According to the present invention, the SNP of FAS gene is used for translating carcass weight and eye muscle area of Hanwoo at a molecular biological level and is used as a selectable genetic marker for improving meat quantity of Hanwoo by providing profiles on genes and proteins related to meat quantity of Hanwoo.

Description

SNP for determination of meat quantity in Hanwoo and diagnosis method of meat quantity using the same}

The present invention relates to a monobasic polymorphic marker for determining the amount of Korean beef, and a method for determining Korean beef using the same. More specifically, monobasic polymorphisms associated with carcass weight, backfat thickness and loin cross-sectional area, meat-related traits in the FAS gene present in the quantitative trait locus (QTL) region for early determination and selection of good Hanwoo for meat improvement. And it relates to a method of determining the meat of the Hanwoo using the same.

Recent developments in molecular genetics have been developed to enable the development of genetic markers at the DNA level. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTL) that determine important economic traits and include linkage analysis, genetic maps, parentage testing has been used as a powerful tool to analyze distinction of breeds, pedigree analysis, genetic diversity and relationship. Especially in the field of genetic and breeding of livestock, it is used for marker assisted selection (MAS) through genetic markers based on DNA polymorphism.

Most economic traits in livestock are known to be quantitative traits due to the influence of various genes, and studies are being actively conducted to search for genetic loci and genetic loci involved in these traits. In particular, the discovery of single gene nucleotide polymorphism (SNP) and trait relevance studies have been actively conducted on functional genes for the discovery of trait gene markers, and various trait SNPs have been discovered so far (Lee et al., 2004; Cheong, Korea). Et al., 2007; Kong et al., 2007; Cho et al., 2008). Quantitative trait loci (QTL) studies (Gutierrez-Gil et al., 2007; Casas et al., 2003), specific expression gene discovery (Lee et al., 2007), microarray (Wang et al., 2009) and proteomics (Hollung et al., 2007), and various research techniques are being used, and researches for exploring markers and clarifying biochemical mechanisms are under way.

Conventional cell-surface protein Fas (APO-1, CD95) is an apoptosis inducer that activates apoptosis in lymphocytes or specific cell lines exposed to monoclonal anti-Fas antibodies. Only). (Traunth et al., 1989, Yonehara et al., 1989) Molecular cloning results of human and rat Fas (hFas, mFas) cDNA (complementary DNA, complementary DNA) (Itoh et al., 1991; Oehm et al., 1992; Watanabe (Fukunaga et al., 1992) Fas is a low-affinity nerve growth factor receptor (NGFR), tumor necrosis factor receptor (TNFR) type and type, human B-cell antigen It has been demonstrated that it belongs to the TNFR superfamily that includes CD40, a cell antigen, and CD27, and OX40, a T-cell antigen. (Camerini et al., 1991; Johnson et al., 1986; Loetscher et al., 1990; Mallett et al., 1990; Schall et al., 1990; Stamenkovic et al., 1989)

In a previous study, the inventors found a negative correlation with intramuscular fat content of the Fas and the long-muscle tissue of Korean cattle. In addition, the expression of heat shock protein (HSPB1) in both messenger RNA (mRNA) and protein was found to be negatively correlated with intramuscular fat content. (Kim et al., 2011) Fas (TNF recptor superfamily member 6) and angiotensionogen (AGT) are regulators of the HSPB1 gene. These findings indicate that the FAS gene is one of 258 important genes that regulate adipose tissue production through the MAP kinase (MAPK) signaling pathway.

Therefore, the present inventors believe that the genetic polymorphism of the FAS gene affects the carcass weight and the loin cross-sectional area as well as the effect on the intramuscular fat content of the longest muscle tissue of Hanwoo. ) Was studied.

Single nucleotide polymorphism (SNP) is a single base-pair variation in DNA between individuals of the same species, the most common form of gene polymorphism. SNPs present in the transcriptional regulatory base sequences, such as promoters, can regulate the amount of gene expressed. Base sequences at the exon-intron boundary that affect RNA splicing, or SNPs at 3'-untranslated regions, may affect RNA stability or translational capacity.

When the SNP affects the phenotype and the beef trait is changed, the SNP may be used as a marker indicating the sensitivity to the beef trait. In many cases, the presence of SNPs has been revealed according to the completion of genomic maps, but there are also SNPs that have not yet been found, and the effects on the phenotype have not been studied.

Looking at the related art as follows. Korean Patent Laid-Open No. 2012-0011728 discloses a single nucleotide polymorphism marker that can be used for early selection of meat or meat of Korean cattle. Korean Patent No. 10-0935293 discloses Korean beef cattle using TNF (tumor necrosis factor alpha) gene. Development of transgenic SNP markers is disclosed.

Conventional techniques merely present SNPs associated with hexamorphisms, but the present invention reveals the effect of the FAS gene on hexamorphisms of Hanwoo, and simultaneously determines the nucleotide sequence of the FAS gene. It is significant that the SNP marker was developed.

Under these technical backgrounds, the present inventors have made a diligent effort to develop a single base polymorphic marker associated with the back fat thickness, carcass weight, and sirloin cross-sectional area of Korean cattle.

After all, it is an object of the present invention to provide a monobasic polymorphic marker associated with a broiler of Hanwoo.

It is another object of the present invention to provide a composition for predicting meat mass of Hanwoo.

Still another object of the present invention is to provide a microarray for beef stock prediction.

Still another object of the present invention is to provide a kit for predicting meat of Korean beef.

Still another object of the present invention is to provide a method for determining the amount of meat of Korean cattle using the marker.

According to an aspect of the present invention, there may be provided a marker for quantitative determination of Korean cattle including a single nucleotide polymorphism at the 251 nucleotide position of the first sequence, the second sequence, or the third sequence.

According to another aspect of the present invention, Hanwoo comprises 10 to 200 consecutive polynucleotides comprising the 251 nucleotide of SEQ ID NO: 1, 2, or 3 or a complementary polynucleotide thereof A composition for determining the amount of meat may be provided.

According to another aspect of the present invention, there may be provided a microarray for meat determination of Hanwoo comprising the polynucleotide or complementary polynucleotides thereof.

According to another aspect of the present invention, there may be provided a kit for determining the amount of Hanwoo beef comprising the polynucleotide or a complementary polynucleotide thereof.

According to another aspect of the present invention, it is determined that the 251th nucleotide locus of the first sequence of the sequence listing is GT and TT genotypes thicker than the GG, and the 251nd of the second listing of sequence The nucleotide locus of the GG and GT genotypes was determined to have a higher lobe cross-sectional area than the Korean cattle with the TT genotype, and the 251th nucleotide locus of the SEQ ID No. 3 sequence had the CC genotype compared with the CT or TT genotype. A method for determining the rearing capacity of a Korean beef may be provided, which is determined to have a larger loin cross-sectional area and a carcass weight.

By using the single nucleotide polymorphism of the FAS gene according to the present invention, it is possible to analyze at the molecular biological level of carcass weight, back fat thickness, and loin sectional area, which are meat-related traits of Hanwoo, and profiles for genes and proteins related to Korean beef By providing it, it can be usefully used as a selection genetic marker for improving Korean beef.

Figure 1 shows the location of the SNP found in Hanwoo FAS gene.

Hereinafter, the present invention will be described in more detail.

Justice

As used herein, the term “nucleotide” or polynucleotide is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990).

As used herein, the term "probe" means a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

According to an aspect of the present invention, there may be provided a marker for quantitative determination of Korean cattle including a single nucleotide polymorphism at the 251 nucleotide position of the first sequence, the second sequence, or the third sequence.

According to one embodiment, the meat mass may be at least one selected from the group consisting of back fat thickness, carcass weight and wick section.

At this time, the definition of the details of the meat quantity may be based on the Ministry of Agriculture, Forestry and Fisheries Food Notice No. 2011-50 "Dividing method according to parts, grades and types of meat".

There is no particular limitation on the method for identifying the single base polymorph, and a method generally used in the art may be used. Specifically, allele-specific probe hybridization, allele-specific amplification, sequencing, 5 'nuclease digestion, Selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis and single-stranded conformation polymorphism. Can be performed by

In the method of the invention, the nucleic acid molecule can be obtained from various sources of beef, for example from muscle, epidermis, blood, bone, organs, and most preferably from muscle or blood.

When the starting material in the method of the present invention is gDNA, the separation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (1987); and Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics.

Sequence changes of the monobasic polymorphs of the present invention result in differences in base bonds within single-stranded molecules, resulting in bands of differing mobility, which SSCA detects. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers that are complementary to a sequence comprising a single base polymorphism of the invention. For example, in an RNase protection assay, a riboprobe complementary to a sequence comprising a SNP of the present invention is used. The riboprobe is hybridized with DNA or mRNA isolated from a plant, and then cleaved with an RNase A enzyme capable of detecting a mismatch. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In an assay using a hybridization signal, a probe complementary to a sequence comprising a single base polymorphism of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to determine whether a single base polymorphism is directly observed.

As the probe used in the present invention, a sequence perfectly complementary to the sequence including the monobasic polymorph may be used, but a sequence complementary to the substantially within a range that does not prevent specific hybridization. May be used. Preferably, the 3'-terminal or 5'-end of the probe has a base complementary to the single base polymorphic base. Generally, the stability of the duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that in a probe having a base complementary to the SNP base at the 3'-terminal or 5'-terminal, If the part is not hybridized, such a duplex can be disassembled under stringent conditions. Suitable conditions for hybridization include, but are not limited to, Nucleic Acid Hybridization, A Practical Approach, Hayes, BD, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, IRL Press, Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

According to one embodiment of the invention, the identification of the marker may be carried out by an allele-specific gene amplification method. When a single nucleotide polymorphism is applied to the gene amplification method, it is collectively referred to as SNAP (single nucleotide amplified polymorphism).

Primers in the context of the present invention are single-stranded oligonucleotides, under suitable conditions (the presence of four different nucleoside triphosphates and polymerases such as DNA or RNA polymerases), suitable temperatures and suitable buffers. By acting as a starting point to initiate template-directed DNA synthesis.

The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

Amplification techniques that can be used in the methods of the invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reactions (LCR, Wu, DY) et al., Genomics 4: 560 (1989)), polymerase ligase chain reaction (Barany, PCR Methods and Applic., 1: 5-16 (1991)), Gap-LCR (WO 90/01069), repair chain Reactions (EP 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably according to the PCR amplification step.

According to another aspect of the present invention, Hanwoo comprises 10 to 200 consecutive polynucleotides comprising the 251 nucleotide of SEQ ID NO: 1, 2, or 3 or a complementary polynucleotide thereof A composition for determining the amount of meat may be provided.

At this time, limiting the size of the polynucleotide to 10 ~ 200bp is only limited to represent the technical specificity at the level that can be reproduced by the current hybridization technology, even if the size outside the above range depending on the technology used As long as the polymorphism can be identified.

According to another aspect of the present invention, there may be provided a microarray for meat quantity determination of Hanwoo comprising the polynucleotide.

In this case, the microarray includes not only a polynucleotide for recognizing the nucleotide sequence of the monobasic polymorphism, but also a polypeptide encoded by the polypeptide or a cDNA of the polynucleotide if the marker is within a range that can facilitate identification of the marker. You may.

According to various embodiments of the present invention, the substance for detecting the monobasic polymorphism is not limited to the nucleic acid. A variety of biological techniques may be used, including polypeptides, proteins, other nucleic acids or modifications of proteins that recognize a particular sequence of nucleic acid.

According to another aspect of the present invention, there may be provided a kit for determining the meat of Hanwoo comprising the polynucleotide or a complementary polynucleotide thereof.

The kit may further include a composition or a composition capable of selectively detecting the monobasic polymorph, as well as a container or an accessory capable of making such detection easier and faster.

According to another aspect of the present invention, a method for determining the rearing of a Korean beef may be provided. This will be described in more detail as follows.

Table 1 summarizes the monobasic polymorph of the present invention.

In this case, referring to Table 1, the case where the G.-12T> G locus, the locus of the single nucleotide polymorphism of SNP1, which is the first sequence in the sequence list, is GT and TT genotypes is determined to be thicker than the GG. In the case where the G.1112T> G locus of SNP2, the SNP2 sequence, is GG and GT genotypes, it is determined that the loin cross section area is higher than that of Hanwoo with TT genotype, and G.32548T of the SNP3 sequence 3rd sequence The case where the> C locus is the CC genotype can be determined to have a larger fillet area and carcass weight than the case with the CT or TT genotype.

The criterion is well shown in the correlation between the nucleotide sequences of Tables 2 and 3 and statistical analysis described in the Examples below.

Hereinafter, the present invention will be described in more detail with reference to Examples. The following examples are only for illustrating the present invention, and the scope of the present invention is not to be construed as being limited by these examples.

Example  Korean beef Flesh  Relation Monobasic  excavation

Phenotype data and blood samples for measuring genetic variation of SNP markers were obtained by crossing 76 breeding cattle and dams of the National Livestock Science Institute. It was investigated from the steer of the horses.

The growth period of Korean cattle is 4 ~ 12 months, and the ratio of mixed feed and rice straw is 1.5: 1. The 1st period of finishing meat (finishing period, 13 ~ 18 months) is 2: 1 and 2 times finishing period (19-24 months). The ratio of crude protein (crude protein) and total digestible nutrients (TDN) of the blended feed is 14-16: 68-70 in the growing season, 11-13: 71-73 in the finishing phase, and 2 flesh phases. In the case of 11: 72 ~ 73.

The phenotypic data in this example are the carcass weight (CWT, carcass weight), longissimus muscle area (LMA), back fat thickness (BF) and marbling score (MAR) of Hanwoo. The backfat thickness, EMA, and intramuscular fat were measured at rib junctions 12 and 13 after freezing for 24 hours.

1) dielectric DNA ( genomic DNA ) Extraction

Genomic DNA was isolated from bovine blood by a modified salting out method. DNA was quantified using a spectrophotometer and DNA samples were diluted to 10 ng / with distilled water and stored at -20 ° C.

2) amplification of the template ( template amplification )

SNP identification of the FAS gene was performed from 24 Korean cattle with different grandsires and sires. Primers for sequence determination were prepared with about 700 base pairs of PCR product based on Gene ID: BC140650.1, registered in NCBI GenBank.

Polymerase chain reaction (PCR) solution was prepared by adding genomic DNA (20ng /) 1, DDW 5.5, 10X buffer 2, primer 1, dNTP 1, and Hot Start Taq DNA polymerase 0.5. The polymerase chain reaction pre-denaturates the template DNA for 10 minutes at 94 ° C., then denaturation for 30 seconds at 94 ° C., annealing for 30 seconds at 60 ° C., and 1 minute at 72 ° C. The extension was repeated 35 cycles to amplify the DNA and finally maintained at 72 ° C. for 10 minutes to complete the extension and finished at 4 ° C.

To purify the amplified genomic DNA, PCR product is added to a 96-well filter plate and additional DDW 200 is added. Place paper towel on the bottom, centrifuge at 3000rpm for 15 minutes, dry for 10 minutes, add 50μl of DDW and leave for 10 minutes. After stirring several times with a multipipette, transfer to a new plate and store at 4 ℃.

3) SNaPshot  And sequencing ( genotyping )

SNaPshot probes were designed by checking the annealing temperature of each probe. Table 1 below shows SNaPshot probes for determining genotype of FAS.

Probe The sequence (5 '- > 3') location SNP size
(bp) SNP1 at ₍₁₁₎ CCGGGGACATTTCTTTAGGTCTTTTCAAA G.-12 T> G 51 SNP2 at ₍₁₀₎ AAGCCTAAGCCGCATCCACCTCTTT G.1112 T> G 45 SNP3 ta ₍₄₎ tCTGGTGAGAGTAAATACCCATGTTCATC G.32548 T> C 37

The length of the primer was modified by adding a non-homologous polynucleotide to the 5 'end. The SNaPshot reaction solution was performed after adding 2 μl of a SNaPshot multiplex ready reaction mix, 1.5 μl of DDW, 0.5 primer for SNaPshot, and 1 μl of the prepared template to make a total of 5 μl. SNaPshot reaction was PCR in 25 cycles of 10 seconds at 96 ℃, 5 seconds at 50 ℃, 30 seconds at 60 ℃.

SNaPshot product is incubated with 1 unit of Shrimp alkaline phosphatase (SAP) at 37 ° C. for 1 hour and 72 ° C. for 15 minutes. 8.5 μl of formamide and 0.5 μl of GeneScan-120 LIZ size standard were added to the cultured product 1, followed by denaturation at 95 ° C. for 5 minutes, and then maintained at 4 ° C. Afterwards, analyze it in ABI 3730-Genetic analyzer (applied Biosystems, Foster City, CA, USA). Raw data was analyzed using SeqMAN software (Illumina, sequencing analysis program to assemble Sanger data or analyze SNP), and main data was analyzed using PHASE v2.1.1 and Haploxt. It was.

4) Statistical analysis statistical analyses )

Phenotypic measurements and statistical relevance between the three SNP genotypes of the FAS gene were assessed using a mixed regression model using the ASReml 3.0 program. (Gilmour et al., 2006) It was also accepted that data with p-values less than 0.01 were statistically significant. Differences in mean values were analyzed using Fisher's least significant difference test.

5) Experiment result ( result )

The FAS gene is located at 11241196 ~ 11275050 bp of Korean chromosome 26 (BTA26; bovine chromosome 26). To find the SNP of the FAS gene, the sequence of the entire exon of 24 Korean cattle with different grandsires and sires, as well as the 1kb range of the front and back of the FAS gene Were determined by PCR and PCR-direct sequencing. As a result, more than 99% homology with the sequence of BC140650.1 registered in GenBank, 16 SNPs in exon, 37 SNPs in intron, 2 SNPs in promoter region, total 55 SNPs . These SNPs are 31 common polymorphic sites, taking into account their allele frequency, haplotype-tagging status, and linkage disequilibrium (LD) for genotyping. ) Was selected. Selected SNPs were identified genotype by SNaPshot method, and possible genetic association of FAS polymorphism related to carcass weight (CWT), fillet area (EMA) and backfat thickness (BF). Tested.

As a result, as shown in Fig. 1, SNPs of the promoter regions in the intron region and the exon region were identified. The three SNPs identified were verified to be new SNPs as compared to GenBank's SNP database.

The results of association analysis of carcass traits and SNPs of 274 cows of the progeny test were as shown in Table 1 below.

Conductor shape medium Standard Deviation Minimum value Maximum value Conductor weight (kg) 321.74 34.45 174 423 Fillet cross section (cm ² ) 58.89 8.57 30 99 Back fat thickness (cm) 8.16 3.04 3 21

Analysis of the association of SNPs with carcass traits of the FAS gene was performed under a generalized linear model. The results of single locus association analysis of the FAS gene show that three SNPs are associated with at least one meat quality trait. As shown in Table 2, G.-12T> G is the backfat thickness <0.01), G.1112T> G is the fillet cross-sectional area (p <0.001), and G.32548T> C is the carcass weight and the fillet cross-sectional area (p < 0.01) was found to be significant.

Conductor shape SNP form genotype P value Backfill thickness
(cm) G.-12T> G TT GT GG P <0.01 **
8.09 ± 0.35 8.64 ± 0.31 6.92 ± 0.46 Sirloin cross section
(cm ² )

G.1112T> G
GG GT TT P <0.001 ***
71.05 ± 6.48 70.64 ± 2.44 69.86 ± 3.5 G.32548T> C
CC CT TT P <0.01 **
77.95 ± 3.86 62.75 ± 4.76 70.82 ± 2.95 Conductor weight (kg)
G.32548T> C
CC CT TT P <0.01 **
343.43 ± 4.98 308.67 ± 3.56 303.69 ± 11.4

In Hanwoo, which has a thick back fat thickness, Korean cattle with GT and TT genotypes were present at a higher rate than those with GG genotype at G.-12T> G SNP. Korean cattle with GG and GT genotypes were present at a higher rate than Korean cattle with TT genotypes. However, at the G.32548T> C locus, Hanwoo with CC genotype had a larger loin cross section and carcass weight than Hanwoo with CT or TT genotype.

The following table is related to the nucleotide sequence information of the SNP associated with carcass weight and loin cross-sectional area in the FAS gene of Hanwoo. It is an SNP that can predict the weight of the conductor at the same time.

Sequence List Phenotype SNP Name chromosome Monobasic Polymorphic P value One Backfill thickness G.-12T> G 26 T> G 0.01 2 Sirloin cross-sectional area T1112G 26 T> G 0.001 3 Fillet cross section / carcass weight T32548C 26 T> C 0.01

Example  2. The present invention Single base polymorphism  Containing Microarray Production

In the polynucleotide consisting of each SEQ ID NO shown in Table 4, a polynucleotide consisting of 20 contiguous bases containing each SNP position (251nd) base (each SNP is located at the 11th of the 20) substrate Fixed to phase. Since two alleles exist at each SNP position, two polynucleotides for each sequence were immobilized on the substrate.

First, the N-terminus of each polynucleotide was substituted with an amine group and then spotted on a silylated slide (Telechem), wherein the spotting buffer was used as 2SSC (saline-sodium citrate, pH 7.0). After spotting, the mixture was placed in a dryer to induce binding, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and tertiary distilled water for 2 minutes to remove unbound oligos. The slides were treated at 95 ° C. for 2 minutes to induce denaturation, followed by 15 minutes with blocking solution (1.0 g NaBH ₄ , PBS (pH 7.4) 300, EtOH 100), 1 minute with 0.2% SDS solution, and tertiary distilled water. Each was washed for 2 minutes and dried at room temperature to produce a microarray.

Example  3. According to the present invention Microarray  Korean Beef Flesh  judgment

We isolated target DNA from the blood of Hanwoo to diagnose filamentous constitution and fluorescently labeled it with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 and the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was performed at 42 ° C. for 4 hours. It was washed twice with 2SSC for 5 minutes at room temperature and then dried in air. After drying, the slides were scanned with ScanArray 5000 (GSI Lumonics), and the scan results were analyzed by QuantArray (GSI Lumonics) and ImaGene software (BioDiscover) to analyze the SNP according to the present invention. By confirming whether or not they have, we predicted the carcasses of Korean cattle, especially Hanwoo carcass weight and sirloin sectional area.

As described above, the single-base polymorphism of the FAS gene according to the present invention enables interpretation at the molecular biological level of carcass weight, dorsal fat thickness and loin cross-sectional area, which are meat-related traits of Hanwoo, By providing a profile for the protein, it can be usefully used as a selection gene marker for improving Korean beef.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

                         SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> SNP for determination of meat quantity in Hanwoo and diagnosis        method of meat quantity using the same <130> NPF21613 <160> 3 <170> PatentIn version 3.2 <210> 1 <211> 501 <212> DNA <213> Bos taurus coreanae <400> 1 gatcctcacc tgaacccgag catgccagtc gactgcggaa acgctcccaa cggggaatgc 60 ccgcttgtgc aacaacgctg gcgctttccc cgctccccgt tcaacacccc ttcccccacc 120 ccacccccaa ctccaggcgc agggttgcag aatcaaaggc gccctcccct actcgggcgt 180 tccccagcta agcttcctcc tccaaccccc accccctggc tccggggaca tttctttagg 240 tcttttcaaa ggagctacca acaggtgttc agacacgctg ctggagaaag aggaaagcgt 300 cccgagagta actgtgcgtg agcgcccggg gcgggcccgg gaggggagca ctctcccagg 360 ccggctggag cgcggggagg ggccagtcgg ggctcactac tcaccgggtg cgtaactcgc 420 cctggtgcca gttgtaaggc tccttcactt cggagattgt ttcacagcca tgtccgggat 480 ctgggttcac ttgtcactgg t 501 <210> 2 <211> 501 <212> DNA <213> Bos taurus coreanae <400> 2 tcttggggct gaatgcgcct taaagagact tgtttacctt tttgccgctg cacagaaaaa 60 gaaactgttt tgtttccctt ccgggaatcc ctctccttga gagtgtgagt cactgtctca 120 ggtttgcccc ccgccccttt ttttccctct ctctctctct tccgtttttt tttttttttt 180 ttaatctttc attgcttgcc tgactcggag gcgggaggta accctggccc cattgctcag 240 gcggtggtac ttgctgccac cgcgcatgcg ctgagcagcc tgtacttggc ctagaagcct 300 aagccgcatc cacctctttt ggagagtccc tacctcagac atcccggctt ggtgatggct 360 gatcgaagac tttggcctca aggggttcat ttgagttccg aactctctga aaaccagtgg 420 attcttattt gctgggcctc atcgacgtgc caggcagtgt gataggaatg tttatgagta 480 tgatctgagt cagttctcgc a 501 <210> 3 <211> 501 <212> DNA <213> Bos taurus coreanae <400> 3 cagttctgag aatatactaa atattctaaa tatgttaaaa taagttctga gtagctatag 60 atattgcttg gcttggcttt ttactgggtg tgttttcttt tttcatttat tagatttgta 120 gagctaatat atttgctcaa agctatttgt agggctaata gcttttagca tttcatgatt 180 ctgccttcaa ggatttttaa agtctagttg gggagatgaa tgctggtgag agtaaatacc 240 catgttcatc ttcttgcctg ttaagtgtct aaaaaagcat gaattcaaag attgagatca 300 tgctcaagtg tgtaacatat gatcctgtta gtgtgaaggt aattaatgta tgtgaacaca 360 catgcctatc cacaggttga ccccattcca tgaattagtc gatgtgatca actgcctcta 420 aattacctcc ccagctccac tgataattct agagattttg ccatatttat aaattttgtt 480 tacacctttg agaggaatat a 501

Claims (5)

Marker for determining the meat of Hanwoo comprising a single nucleotide polymorphism at the 251 nucleotide position of the first sequence, the second sequence, or the third sequence.
A composition for determination of meat content in Korean cattle comprising 10-200 consecutive polynucleotides including the 251 th nucleotide of SEQ ID NO: 1, 2, or 3, or complementary polynucleotides thereof.
A microarray for determining the amount of meat of a Korean beef comprising the polynucleotide of claim 2 or a complementary polynucleotide thereof.
The kit for determination of meat quantity of Hanwoo comprising the polynucleotide of claim 2 or the complementary polynucleotides thereof.
When the 251th nucleotide locus of the first sequence in the sequence is determined to be thicker than the GG for GT and TT genotypes, and the 251th nucleotide locus of the second sequence in the sequence is GG and GT genotypes Was determined to have a higher loin cross-sectional area than Hanwoo with TT genotype, and the 251th nucleotide locus in the sequence 3rd genotype had CC genotype greater than that of CT or TT genotype. A beef breeding judging method of Korean beef, characterized in that it is determined to have.

Images