KR101444414B1 - Composition for predicting of meat quality in Hanwoo - Google Patents

Abstract

The present invention relates to a composition for predicting the Korean Meat quality and a method for predicting the Korean Meat quality using the same. More specifically, DNA markers having a statistical relation with the year, juiciness and flavor, which are the target traits of the meat quality of Korean beef meat, are selected from the carpain / chlorpastatin gene, and the meat quality of the Korean beef meat is predicted .
Using the single base polymorphism of the calpain / calpastatin gene according to the present invention, it is possible to analyze at the molecular level of the year, juiciness and flavor, which are meat quality traits of Korean beef meat, Can be usefully used as a selection gene marker for improving meat quality of Hanwoo meat by providing a profile of meat-related genes and proteins of meat.

Description

{Composition for predicting meat quality in Hanwoo}

The present invention relates to a composition for predicting the Korean Meat quality and a method for predicting the Korean Meat quality using the same. More specifically, DNA markers having a statistical relation with the year, juiciness and flavor, which are the target traits of the meat quality of Korean beef meat, are selected from the carpain / chlorpastatin gene, and the meat quality of the Korean beef meat is predicted .

The development of analytical techniques for genetic markers using polymorphisms is based on the major genes that determine important economic traits, quantitative trait loci (QTL), linkage analysis, genetic mapping, , Paternity discrimination, pedigree analysis and correlation.

It is also used for marker assisted selection (MAS) in the field of genetic and breeding of livestock using genetic markers associated with major genes or loci of quantitative traits. Most of the economic traits of livestock are expressed through the interaction of various genes, and research on the search for genes involved in these traits and their interactions are actively under way. Research on the development of gene markers through the analysis of single nucleotide polymorphism (SNP) and linkage with traits is being actively conducted on functional genes related to traits. Recently, SNPs of various trait-related genes such as LPL gene, TCAP gene, DIGAT1 gene, FABP gene and MC4R gene have been discovered by domestic researchers.

Calpain encodes a cysteine protease and acts as the first enzyme in postmortem tenderization to reduce the Warner Bratzler Shear Force (WBSF) It has been reported that it plays an important role in degrading the protein of the carcass after slaughter to soften the meat quality. Calpastatin (CAST) is a gene that acts as an endogenous inhibitor of calpain and is located in BTA7. Several studies have reported that polymorphism in the CAST gene that suppresses calpain affects the fleshy year.

Protein degradation by neutral protease calpain, which is activated by Ca ²⁺ concentration, has a very important effect on important proteins that regulate cell growth. Several studies have shown that the Calpain system plays an important role in the growth of normal skeletal muscle.

When the SNP affects the phenotype and the meat quality or the meat-related traits of the Hanwoo are changed, the SNP can be used as a marker showing sensitivity to meat quality or meat-related traits of Hanwoo. Genomic maps often reveal the presence of SNPs, but there are SNPs that have not yet been discovered, and even the SNPs found may not have been studied for their effect on phenotypes.

The related art will be described as follows. Korean Patent Publication No. 2010-0089692 discloses a meat-quality SNP marker of Korean beef cattle, Korean Patent Publication No. 2012-0011728 discloses a SNP marker that can be used for early selection of meat or meat quality of Korean beef cattle.

Conventional techniques merely present SNPs that are only associated with meat or carbohydrate traits, but the present invention includes SNP markers statistically associated with shear force, year, flavor and sucrose as target traits associated with meat quality of Hanwoo meat It is important to provide a composition for predicting meat quality of Hanwoo meat and to provide a method for predicting meat quality of Hanwoo meat using the same.

Under such technical background, the present inventors have made intensive efforts to develop a composition comprising a DNA marker for predicting the meat quality (year, juiciness and flavor) of Korean beef cattle.

Finally, it is an object of the present invention to provide a composition comprising a DNA marker which is statistically related to year, juiciness and flavor, which is a target trait for meat quality of Hanwoo meat.

In order to solve the above technical problem,

According to one aspect of the present invention, there are provided 10 to 200 consecutive polynucleotides comprising the nucleotide sequence of SEQ ID NOS: 1 to 3, wherein the 27th base of each of the nucleotide sequences is a single base polymorphism, or a complementary poly A composition for predicting meat quality of Hanwoo meat including nucleotides can be provided.

According to another aspect of the present invention, there is provided a microarray for predicting meat quality of Hanwoo meat comprising the composition.

According to another aspect of the present invention, there is provided a kit for predicting meat quality of Hanwoo meat including the composition.

According to another aspect of the present invention, when the 27th nucleotide locus of SEQ ID NO: 1 is a GG genotype, it is determined that the jujuba and flavor are higher than those of AA and AG genotype, and the 27th nucleotide locus of SEQ ID NO: The GC and GC genotypes were determined to be higher in juiciness and flavor than the AA and GG genotypes. When the 27th nucleotide locus in SEQ ID NO: 3 was the AG genotype, A meat quality prediction method can be provided.

Using the single base polymorphism of the calpain / calpastatin gene according to the present invention, it is possible to analyze at the molecular level of the year, juiciness and flavor, which are meat quality traits of Korean beef meat, Can be usefully used as a selection gene marker for improving meat quality of Hanwoo meat by providing a profile of meat-related genes and proteins of meat.

Hereinafter, the present invention will be described in more detail.

The term "nucleotide" or "polynucleotide ", as used in the description of the present invention, is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides, (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

As used in the detailed description of the present invention, the term "probe" means a linear oligomer with a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

The term "single nucleotide polymorphism " (SNP), as used in the description of the present invention, is a single base-pair variation in DNA between individuals of the same species, It is an existing form. The SNPs present in the transcriptional regulatory sequences such as promoters can regulate the amount of expressed gene and can be used to identify sequences that are located at the exon-intron boundaries that affect RNA splicing, SNPs may affect RNA stability or translation performance.

The term "meat quality" as used in the detailed description of the present invention is a characteristic of meat quality, which is an evaluation of the characteristics of fat and connective tissues. Here, meat quality of Korean beef meat in particular includes shearing force, In the present invention, meat quality was predicted as a year, juiciness and flavor directly related to the taste of the Korean beef meat that the consumer feels.

The meat quality of the Hanwoo meat was evaluated by 30 trained sensory testers: 1 point (very harsh, very dry, very poor) to 10 points (very tender, very juicy, very good) Were evaluated independently by each sensory testee only once and recorded as an average of the scores evaluated by the sensory testors.

According to one aspect of the present invention, there are provided 10 to 200 consecutive polynucleotides comprising the nucleotide sequence of SEQ ID NOS: 1 to 3, wherein the 27th base of each of the nucleotide sequences is a single base polymorphism, or a complementary poly A composition for predicting meat quality of Hanwoo meat including nucleotides can be provided.

Here, SEQ ID NO: 1 corresponds to CAST1_T5 SNP, SEQ ID NO: 2 corresponds to CAST3_T7 SNP, and SEQ ID NO: 3 corresponds to CAPN1-2_T3 SNP.

Here, the meat quality of the Korean beef meats may be determined by one or more selected from the group consisting of shear force, year, flavor, and juice. Here, the definition of the shearing force, year, flavor, and succulence related to the meat quality of the Hanwoo meat is based on the Ministry of Food, Agriculture, Forestry and Fisheries Notice No. 2011-50,

There is no particular limitation on the method for identifying the single nucleotide polymorphism, and a method commonly used in the art can be used. Specifically, an allele-specific probe hybridization method, an allele-specific amplification method, a sequencing method, a 5 'nuclease digestion method, A method selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis and single-stranded conformation polymorphism ≪ / RTI >

In the method of the present invention, the nucleic acid molecule can be obtained from various sources of beef, for example, from muscles, epidermis, blood, bones, organs, and most preferably from muscles or blood.

When the starting material in the method of the present invention is gDNA, the separation of gDNA can be carried out according to conventional methods known in the art (Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (1987); and Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics.

Sequence changes of the single base polymorphisms of the present invention result in differences in base-linkage within the single-stranded molecule, leading to the emergence of different bands where SSCA detects this band. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers that are complementary to a sequence comprising a single base polymorphism of the invention. For example, in an RNase protection assay, a riboprobe complementary to a sequence comprising a SNP of the present invention is used. The riboprobe is hybridized with DNA or mRNA isolated from a plant, and then cleaved with an RNase A enzyme capable of detecting a mismatch. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In an assay using a hybridization signal, a probe complementary to a sequence comprising a single base polymorphism of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to determine whether a single base polymorphism is directly observed.

As a probe used in the present invention, a perfectly complementary sequence may be used in the sequence including the single nucleotide polymorphism, but a sequence substantially complementary to the complementary sequence does not interfere with the specific hybridization May be used. Preferably, the 3'-terminal or 5'-end of the probe has a base complementary to the single base polymorphic base. Generally, the stability of the duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that in a probe having a base complementary to the SNP base at the 3'-terminal or 5'-terminal, If the part is not hybridized, such a duplex can be disassembled under stringent conditions. Suitable conditions for hybridization include, but are not limited to, Nucleic Acid Hybridization, A Practical Approach, Hayes, BD, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, IRL Press, Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

According to one embodiment of the present invention, identification of the composition can be performed by an allele-specific gene amplification method. When a single nucleotide polymorphism is applied to the gene amplification method, it is collectively referred to as SNAP (single nucleotide amplified polymorphism).

The term "primer ", as used in the description of the present invention, is a single strand of oligonucleotides, suitable conditions (presence of four different nucleoside triphosphates and polymerases such as DNA or RNA polymerases) , Acting as a starting point at which to initiate template-directed DNA synthesis under appropriate temperature and suitable buffer.

The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

Amplification techniques that may be used in the methods of the present invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reactions (LCR, Wu, DY Lac (WO 90/01069), the repair chain (GenBank, et al., Genomics 4: 560 (1989)), the polymerase ligase chain reaction (Barany, PCR Methods and Appl., 1: (EP 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably by PCR amplification step.

Herein, the size of the polynucleotide is limited to 10-200 bp. However, the size of the polynucleotide is only limited to the extent that it can be reproduced by current hybridization technology, and even if the size is out of the above range, It is sufficient to be able to identify the base polymorphism.

Also, one or more DNA markers for predicting the meat quality of Hanwoo meat, which is composed of the nucleotide sequence of SEQ ID NO: 1, 2, or 3 and contains the 27th base of the nucleotide sequence as a single base polymorphism, But may include species other than the SNP markers disclosed in the present invention.

According to another aspect of the present invention, there is provided a microarray for predicting meat quality of Hanwoo meat comprising the composition.

At this time, the microarray includes not only the polynucleotide for recognizing the base sequence of the single nucleotide polymorphism but also the polypeptide encoded thereby or the cDNA of the polynucleotide so long as it can more easily identify the composition You may.

According to various embodiments of the present invention, the material for detecting the single base polymorphism is not limited to nucleic acid. A variety of biological techniques may be used, including polypeptides, proteins, other nucleic acids or modifications of proteins that recognize a particular sequence of nucleic acid.

According to another aspect of the present invention, there is provided a kit for predicting meat quality of Hanwoo meat including the composition.

The kit may further comprise a composition of components capable of selectively detecting the single nucleotide polymorphism, as well as a container or accessory device capable of facilitating such detection more readily and rapidly.

According to another aspect of the present invention, a method of predicting a meat quality of Hanwoo can be provided. This will be described in more detail as follows.

The following Table 1 describes the SNPs according to the present invention.

SNP Sequence information (5 '- > 3') CAST1_T5
(rs109727850)
(GLY62ASP) CAGTCAGCTCTCCAGAACTCAGGCTG [A / G] TGAAAAAGCCCCGGTCCCCAAGGTC CAST3_T7
(rs110914810)
(THR662SER) CGATGCCCTGGATCAACTTTCTGACA [C / G] TCTCGGGCAAAGACAGCCTGATCCA CAPN1-2_T3
(rs17871051)
(ILE530VAL) CCCTCTGCAGAGAGCTGGATGACCAG [A / G] TCCAGGCCAATCTCCCCGACGAGGT

The SNPs according to Table 1 correspond to three SNPs (P <0.05) having a statistical significance from the carpain / chlorpastatin gene to the Korean beef cattle trait (year, juiciness, etc.) in 291 Hanwoo. Two of these three SNPs (CAST1_T5 and CAST3_T7) were selected from the Hanwoo cholapastatin gene, and these SNPs corresponded to the genetic mutations causing mutations in amino acid sequences 62 and 662, and the other one (CAPN1-2_T3) Phenone gene, which corresponds to a genetic mutation that causes a mutation in amino acid sequence 530.

Here, it is determined that the 27th nucleotide locus of CAST1_T5 (SEQ ID NO: 1) is higher in juiciness and flavor than the AA and AG genotypes in case of GG genotype, and when the 27th nucleotide locus of CAST3_T7 CC and GC genotypes were determined to be higher in juiciness and flavor than in AA and GG genotypes when the 27th nucleotide locus of CAPN1-2_T3 (SEQ ID NO: 3) was the AG genotype. can do.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1. Relationship between Karpain / Calpastatin SNP and Meat Traits of Hanwoo Meat

1) Selection of experiment subjects

Phenotype data and blood samples for measuring the genetic variation of SNP markers were obtained from the National Institute of Animal Husbandry at 291 Two cows (116 cows, 90 horses, 85 horses).

In the growing period (4 ~ 12 months) of Hanwoo, the feed and straw were mixed at a ratio of 1.5: 1, and the finishing period I (13 ~ 18 months) was 2: 1, (finishing period II, 19-24 months) were mixed at a ratio of 4.5: 1. The ratio of crude protein to total digestible nutrients (TDN) of the compound feed was 14 to 16:68 to 70 for the growing period, 11 to 13: 71 to 73 for the fattening period, In the case of 11: 72 ~ 73.

2) Warner Bratzler shear force (WBS)

The shear force was measured with a 25 mm thick steak sample cooked according to the method described by Wheeler et al. (2000). Forty-eight hours post-mortem, a 25 mm thick stake of about 80 g was placed in a polyethylene bag and heated in a water bath at 80 캜 for 30 minutes until the internal temperature of the stake reached 70 캜. After cooking, the samples were allowed to cool for 30 minutes at room temperature, and then six representative core samples of 1.27 cm in diameter were taken from each sample parallel to the muscle fibers. Each core sample was cut perpendicular to the muscle fibers at the center of the core. The shear force is the average value of the maximum force required to cut each core sample.

3) Sensory Evaluation

Forty-eight hours post-transfection, isolating callus (LD) was isolated and vacuum packed and aged at 2 ° C for 7 days. To prepare Hanwoo meat, the frozen meat pieces were cut at 75 ° C × 20 × 4 mm in size parallel to the direction of the muscle fibers at 4 ° C. Each of the sensory samples was individually vacuum packaged and stored at -20 ° C until evaluation. Hanwoo meat was thawed at about 4 ℃ for sensory evaluation. Each piece of meat was cooked at 245-255 ° C, and the piece of meat was inverted when the juice first appeared on the surface of the sample. The cooked meat pieces were served to 30 trained sensory workers immediately after cooking for evaluation. The sensory evaluators rated the sample for the year, juiciness and flavor with a score of 10: 1 point (very tender, very dry, very poor) to 10 points (very tender, very juicy, very good)

Each sample was evaluated independently at one time by each sensory testee and recorded as an average of the scores evaluated by the sensory testors.

Table 2 below shows statistics on the meat quality of Korean beef cattle.

characteristics
All (291 pairs) Cows (116 dogs) Hydrogen (90 units) Steer cattle (85 dogs) Average Standard
Deviation Average Standard
Deviation Average Standard
Deviation Average Standard
Deviation Shear force (kg) 5.8 2.7 6.6 2.6 7.2 2.7 3.4 0.6 Intramuscular fat content (%) 6.9 4.5 5.4 3.0 4.1 2.9 11.4 4.0 Sensory evaluation Juiciness 4.3 0.7 4.0 0.8 4.2 0.5 4.7 0.4 year 3.9 0.8 3.8 0.8 3.5 0.7 4.4 0.5 zest 4.3 0.4 4.2 0.4 4.2 0.4 4.6 0.3

4) Determination of SNP genotype

In the present invention, the genotypes of three SNPs in the CAT gene and four SNPs in the CAPN1 gene were determined. The location and information of the SNPs are listed in Table 3 below.

gene BTA SNP name location
(Btau4.0) SNP
(Contig ref / SNP) AA substitution Recording CAST

7

CAST1_T5
(rs109727850) 97350808 A / G-VIC Asp / Gly AA = 0
AG = 1
GG = 2 CAST2_T6
(rs109384915) 97420163 T / C-VIC Val / Ala CC = 0
CT = 1
TT = 2 CAST3_T7
(rs110914810) 97432440 G / C-VIC Ser / Thr GG = 0
GC = 1
CC = 2 CAPN1


29


CAPN1-3_T1
(rs17872079) 45330760 A / G-VIC - GG = 0
GA = 1
AA = 2 CAPN1-4_T4
(rs17872093) 45330924 C / T-VIC - CC = 0
CT = 1
TT = 2 CAPN1-1_T2
(rs17872000) 45332752 G / C-VIC Gly / Ala CC = 0
CG = 1
GG = 2 CAPN1-2_T3
(rs17871051) 45349336 G / A-VIC Val / Ile AA = 0
AG = 1
GG = 2

To analyze the genotypes of SNPs detected from Hanwoo chalfaein / calpastatin gene, DNA was extracted from 291 Hanwoo, male and female goats. Genotyping was performed on an ABI 7500 Real-Time PCR system using a TaqMan probe manufactured by Applied Biosystems (LSK, Korea). The sequence of the calpain / calpastatin primer for TaqMan sequencing is shown in Table 4 below.

SNP name Forward primer Reverse primer Probe 1 (VIC) Probe 2 (FAM) CAPN1-3
(rs17872079) GCCCAAGGCAACGAGTTCT GTGGCCTGGAGCTGTCC TTGGCATAGGCTTTCT TTGGCATAGGCCTTCT CAPN1-1
(rs17872000) AGCTGCTCCCGCATGTAAG GGCTGGGCAGGTCAGT TCCACGCCGTTCCA CCACGGCGTTCCA CAPN1-2
(rs17871051) CCCCACCCTCTGCAGAGA GGCAGGGCACGTACCT CCTGGATCTGGTCATC CTGGACCTGGTCATC CAPN1-4
(rs17872093) GCACGTCTGAGGGCTTTGA TTGCGCAGCTCGTACCA CACCGGCGGAGTCA TTCACCGGTGGAGTCA CAST1
(rs109727850) CAAGCCTTGGGAGCAGTCA CATGTCCAGGAAATGACTGACCTT ACTCAGGCTGATGAAAA CTCAGGCTGGTGAAAA CAST2
(rs109384915) GCTCCGCCCACAGCA GAACACTGCTTTCTCAAGACATTTCC CACTCACCGCTGGAGC CACTCACCACTGGAGC CAST3
(rs110914810) ACGATGCCCTGGATCAACTTT TCTCATCTGGATCAGGCTGTCTT TGCCCGAGAGTGTCAG TGCCCGAGACTGTCAG

The real-time PCR reaction was carried out using TaqMan Master mix provided by Applied Biosystems, DNA (2 ng / ml), primers (1/10 and 100 pm / s), TaqMan Master mix 10 and Distill water 6 was added thereto to perform real-time genotyping at a final volume of 20. Real-Time PCR was performed for a total of 40 cycles, and the reaction was performed for 5 minutes in which the double strand of DNA was made into a single strand at 95, and an annealing reaction for binding the primer to the template DNA was performed for 60 to 30 seconds, The polymerization reaction was carried out at 72 for 1 minute for a total of 40 cycles. After the Real-Time PCR reaction, the genotype was determined through analysis of the melting temperature.

5) Statistical analysis

Statistical analysis according to the present invention was performed with ASReml (Gilmour et al, 2006). The regression linear mixture model described below was applied to analyze the association between each gene marker and meat quality characteristics (shear force, year, juiciness and flavor).

Here, Y _ijkl is observed in the plasma, μ is the overall average, YS _i is i ^ty birth year-fixing, wherein the fixing effect of the season, Sex _j is a ^{j th sex (fixed term),} (Gen) k is on each SNP k ^th fixed, wherein, IMF _l of genotype effect indicates the guard, wherein for the age are killed intramuscular guard wherein the fat (covariate term), and Sday _ijkl is, a _ijkl may be adapted to any effect, e _ijkl are irregular This is the residual error. The genetic covariance between experimental animals is designed through a family diagram based on the numerator relationship matrix (A): Var (a) = A σ ² _a , It was recorded as 0, 1, 2.

When no dominance effect was observed, a regression model was performed to measure the additive effect. The model represents a regression over the number of copies of one of the two alleles present in the genotype to estimate the additive effect of the genetic marker. For example, with respect to A / G genetic polymorphism, genotype AA was recorded as 0, AG as 1, and GG as 2.

To analyze the effects on isolated haplotypes in the population, the following composite regression mixture model was used.

Here, Y _ijkl is observed in the plasma, μ is the overall average, YS _i is i ^ty birth year-fixing, wherein the fixing effect of the season, Sex _j is a j ^th sex, (haplotypes) _k are each stage dispersion type (h = 0, 1, or 2) The number of copies, t is the group number of the stage dispersion type separated in, IMF _l is wherein the intramuscular fat content guard, and Sday _ijkl denotes a guard section on which slaughter age, a _ijkl is adapted to random effects , e _ijkl corresponds to an irregular residual error. The genetic covariance between experimental animals is designed through a numerical relationship matrix (A) based on the pedigree: Var (a) = A σ ² _a .

The regression correlation coefficients of each of the short - chain types were expressed as the deviations from the mean of all regression correlation coefficients. The reconstruction of the monolithic form was performed using the Phase program (Stephen et al, 2005).

6) The evaluating effect of nonsynonymous SNPs (CAPN1-1_T2 and CAPN1-2_T3) on stability and binding affinity within CAPN1 / CAST complexes.

Molecular modeling of the CAPN1 / CAST system was performed by determining whether the asynchronous SNPs (CAPN1-1_T2 and CAPN1-2_T3), which have important effects on the year and flavor, affect the stability and binding affinity of the CAPN1 / CAST complex.

Homologous modeling from the protein sequence of CAPN1 was performed using DS modeling 3.1. Homologous searches and sequence alignments to find the template structure were performed by generating a sequence profile obtained from the SwissProte (httpL // www.expasy.org) protein database BLAST search. The template structure of Hanwoo CAPN1 was obtained as 1QXP: b, 1KXR: B and 3BOW: A, and when the sequence identity (> 50% And showed excellent E-values (<1 × 10 ^-5 ).

In the present invention, the inventors have found that the molecular partners CAST3_T7 or SNP markers for the year of the beef meat with a specific property of binding of the Ca ²⁺ ions increase the structural integrity between the affinity and the SNP marker complex (and CAPN316 CAPN350) in order to better understand the effect of the introduction of structural knowledge.

Structural stability was measured as the difference between the free energy of the mutant structure and the free energy of the wild-type protein as the effect of a single-point mutation on CAPN1 stability (CAPN316 and CAPN350 mutated to Gly316Ala and Val530Ile, respectively).

Here, all interactive energy terms ΔG were calculated by the CHARMm Polar H Force Field using the generalized Born implicit solvent model, the empirical Van der Waals term, the electrostatic interaction and the nonpolar, surface independent mercury term (cavitation energy).

The energy equation also includes side-chain and back-bone entropy energies. When amino acid residues are replaced with other residues and have different sizes and relatively non-polarities, the form of the amino acid residues and the form of the neighboring residues may be changed. After constructing the mutation structure of SNP markers, the morphology of the mutation residues and neighboring residues was further optimized using MODELER. The mutation energy of the linkage can be considered as the difference in free energy between the binding of the two protein domains that contain SNP markers in the structure of the mutated complex due to one point mutation in the selected residue. The bond free energy can be defined as the difference in free energy between the complex and the unbound state.

The mutation energy values for binding affinity were calculated as the sum of Van der Waals, electrostatic, nonpolar and entropy bounds as well as the measured structural stability. Mutagenic energy values and mutagenic effects in the SNP markers were measured by adding the property of the amino acid residues to each mutant variant. This predictive model can provide a hypothetical search for the relationship between the energy effects of mutations on protein stability and protein binding affinity and the hydrolysis of myofibrillar proteins within the functional changes of CAPN1, have.

7) Genotype and allele frequency

Genotypes of 3 SNPs in CAST gene and 4 SNPs in CAPN1 gene were determined in 291 Hanwoo. Table 5 below shows the genotype and allele frequencies for the seven gene markers in cow, hydrogen, and steer.

Marker Genotype Opposition
gene All (291 pairs) Cows (116 dogs) Hydrogen (90 units) Steer cattle (85 dogs) Number frequency Number frequency Number frequency Number frequency CAST1_T5


AA 86 29 25 32 AG 150 64 44 42 GG 54 23 20 11 G 0.44 0.47 0.47 0.37 CAST2_T6
CC 131 54 37 40 CT 107 38 38 31 TT 36 17 12 7 T 0.32 0.33 0.35 0.28 CAST3_T7
GG 15 5 2 8 GC 86 41 21 24 CC 189 70 66 53 G 0.2 0.21 0.14 0.23 CAPN1-3_T1


GG 132 51 34 47 GA 125 46 46 33 AA 34 19 10 5 A 0.33 0.36 0.36 0.25 CAPN1-4_T4


CC 132 64 45 28 CT 122 43 35 44 TT 32 9 10 13 T 0.31 0.26 0.30 0.41 CAPN1-1_T2


CC 125 50 42 33 CG 137 49 40 48 GG 31 17 10 4 G 0.33 0.35 0.36 0.32 CAPN1-2_T3


AA 3 2 0 One AG 99 36 35 28 GG 187 78 54 55 A 0.18 0.17 0.19 0.17

The allele frequencies of the three SNPs of the CAST gene were relatively similar in the cow, the hydrogen, and the goat. G allele frequency was 44% in CAST1_T5, 32% in CAST2_T6 and 20% in CAST3_T7. For CAPN1-1_T2 (CAPN316), CAPN1-3_T1 and CAPN1-4_T4, the minor allele frequency (MAF) was between 25% and 41% for all cows, hydrogen, and steers. The frequency of the A allele of CAPN1-2_T3 (CAPN530) was 16% for cows, hydrogen, and sorghum. Unlike the other six SNPs in the CAST and CAPN1 genes, only three had the AA genotype in CAPN1-2_T3 (CAPN530).

Two SNPs (CAPN1-1_T2 and CAPN1-2_T3) out of 7 SNP markers in the CAST and CAPN1 genes tested in the present invention have already been studied for bos Taurus , bos indicus and bos indicus x bos taurus hybrids Johnson and Graser, 2010; Alliasis et al, 2011), and no other five SNPs were studied.

In the CAPN1 gene, the present inventors found that the G allele of CAPN1-1_T2 (CAPN316) had an allele frequency of normal degree (33%) in Hanwoo. In the case of Page et al (2004), 95% of the Charlais breed and 92% of the Limousin breed have a very high allele frequency, and Allais et al (2011) , The G allele of CAPN316 has a frequency of 91% in charolle species and 73% in limousine species. Johnston and Graser (2010) found that the G allele frequency (57%) was lower in the Angus breed population. In bos indicus species, the frequency of the G allele was very high (97%) (Johnston and Graser, 2010). White et al. (2005) found that these markers do not provide useful information in the Hereford x Brahman group. In the case of Hanwoo, the CAPN1-2_T3 (CAPN530) marker has a high G allele frequency (82%). In Allias et al (2011), 76% of the cholera species and 64% of the Limousin species found G allele frequencies, while Casas et al. (2005) reported that the G allele was fixed in Brahman species.

8) Relationship between SNP markers and traits

In order to verify the dominant effect of each marker, analysis of variance (ANOVA analyzes) was performed, and the remaining 6 SNP markers except the CAPN1-2 marker showed no significant dominant effect. Therefore, the present inventors decided to measure the additive effects of the marker using a simple linear regression model.

In the present invention, the ratio of each additive effect to the standard deviation (RSD) of the residual term was calculated to determine the effect size of each SNP on phenotypic variances.

In Hanwoo species, there was a significant effect of CAST1 (+0.14, P = 0.04) and CAST3 (-0.12, P = 0.02) on juiciness but there was significant difference in other traits (intramuscular fat, shear force, year and flavor) The effect was not found.

Table 6 below describes the additive effects of SNP alleles on intramuscular fatness, intramuscular fat and shear force, and Table 7 describes the additive effects of SNP alleles on meaty year, juiciness and air ratio.

Marker
Intramuscular fat (%) Shear force (kg) effect a / RSD P value effect a / RSD P value CAST1
(rs109727850) _T5 0.29 0.30 0.06 0.32 0.20 ± 0.19 0.07 0.38 CAST2
(rs109384915) _T6 0.10 0.30 0.02 0.78 0.01 ± 0.19 0.00 0.91 CAST3
(rs110914810) _T7 -0.10 ± 0.36 -0.02 0.78 0.39 + 0.23 0.15 0.09 CAPN1-3
(rs17872079) _T1 0.21 ± 0.31 0.05 0.52 0.18 ± 0.19 0.07 0.37 CAPN1-4
(rs17872093) _T4 -0.11 ± 0.30 -0.02 0.68 -0.04 ± 0.19 -0.01 0.93 CAPN1-1
(rs17872000) _T2 -0.10 + 0.33 0.00 0.96 -0.23 ± 0.20 -0.08 0.20 CAPN1-2
(rs17871051) _T3 -0.60 ± 0.40 -0.13 0.14 0.06 ± 0.26 0.02 0.62

Marker
year Juiciness zest effect a / RSD P value effect a / RSD P value effect a / RSD P value CAST1
(rs109727850) _T5 0.06 0.06 0.07 0.14 0.10 ± 0.05 0.14 0.04 0.05 ± 0.04 0.12 0.06 CAST2
(rs109384915) _T6 0.09 0.06 0.11 0.06 0.02 ± 0.05 0.03 0.33 -0.04 0.03 -0.09 0.32 CAST3
(rs110914810) _T7 -0.08 ± 0.07 -0.10 0.21 -0.12 ± 0.06 -0.17 0.02 -0.05 + 0.04 -0.11 0.21 CAPN1-3
(rs17872079) _T1 -0.03 0.06 -0.03 0.98 -0.08 ± 0.05 -0.11 0.30 -0.01 0.04 -0.01 0.88 CAPN1-4
(rs17872093) _T4 -0.06 + 0.06 -0.08 0.18 0.05 ± 0.05 0.07 0.32 -0.02 + 0.04 -0.05 0.47 CAPN1-1
(rs17872000) _T2 0.11 + 0.06 0.14 0.08 0.03 0.06 0.04 0.89 0.05 ± 0.04 0.11 0.25 CAPN1-2
(rs17871051) _T3 -0.13 + 0.07 -0.16 0.01 -0.12 ± 0.07 -0.17 0.04 0.05 ± 0.05 0.10 0.62

In the case of CAPN1-2_T3 in the Hanwoo species, the effect of the G allele of CAPN1-2_T3 SNP marker on the light (-0.13, P = 0.01) and juiciness (-0.12, P = 0.04) There is an association with tender meat. In addition, we found that CAST1_T5 and CAST3_T7 showed a significant effect of 0.10 (P = 0.04) and -0.17 (P = 0.02), respectively, on juiciness.

9) Sensory evaluation according to genotype

The cooked meat pieces were served to 30 trained sensory workers immediately after cooking to assess meat quality (year, juiciness and flavor). The sensory evaluators rated the sample with a score of 10 for the year, juiciness and flavor: 1 point (very harsh, very dry, very poor) to 10 points (very tender, very juicy, very good) It was evaluated once for each independent inspectors and recorded as the average of the scores evaluated by the sensory testors.

Table 8 below shows the average value of the sensory evaluation according to the genotypes CAST1_T5, CAST3_T7 and CAPN1-2_T3 for the meat quality (year, juiciness and flavor) of Hanwoo meat (P = 0.02).

Marker CAST1_T5 CAST3_T7 CAPN1-2_T3 genotype GG AA AG GG GC CC AG AA GG year 5.8 5.5 5.3 5.7 5.3 5.5 6.1 5.2 5.1 Juiciness 6.4 4.8 5.1 6.3 5.0 5.1 6.4 5.3 5.4 zest 6.2 5.4 5.3 5.9 4.9 5.2 6.1 5.3 5.2

According to the sensory evaluation results shown in Table 8 above, in the CAST1_T5 SNP, in the case of the GG genotype and the CAST3_T7 than in the case of the AA and AG genotypes, in the case of the GG genotype, the juiciness and flavor Were significantly higher. Also, in the CAPN1-2_T3 SNP, the score for the juiciness and flavor of Hanwoo meat was significantly higher for AG genotype than for AA and GG genotypes. In addition, in the case of CAT1_T5, GG genotype, CAST3_T7 GG genotype and CAPN1-2_T3 AG genotype, the annual score was higher than that of AA genotype, CC genotype and AA genotype, respectively.

Thus, it is determined that the 27th nucleotide locus of CAST1_T5 (SEQ ID NO: 1) is higher in juiciness and flavor than the AA and AG genotypes in case of GG genotype, and the 27th nucleotide locus of CAST3_T7 And the 27th nucleotide locus of CAPN1-2_T3 (SEQ ID NO: 3) was higher than that of the AA and GG genotypes when the AG genotype was higher than that of the CC and GC genotypes, and the year, juiciness and flavor were higher .

That is, as described above, when the composition for predicting meat quality of Korean beef meats containing three SNPs (CAST1_T5, CAST3-T7 and CAPN1-2_T3) according to the present invention is used, The meat quality of the meat and the taste of the Hanwoo meat can be predicted early.

Example 2: Fabrication of a microarray containing the SNP of the present invention

Polynucleotides consisting of 20 consecutive bases (each SNP is located at the 11th position of the 20) containing each SNP locus (27th) base in the polynucleotide consisting of the respective sequence numbers shown in Table 1 above, Lt; / RTI &gt; Since there are two alleles at each SNP position, two polynucleotides were immobilized on the substrate for each sequence.

First, the N-terminal of each polynucleotide was substituted with an amine group and then spotted on a silylation slide (Telechem). The spotting buffer was washed with 2 x SSC (saline-sodium citrate, pH 7.0) Respectively. After spotting, the binding was induced by placing in a dryer, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and then with tertiary distilled water for 2 minutes to remove unbound oligos. The slide was treated at 95 ° C for 2 minutes to induce denaturation. Subsequently, the slide was incubated with blocking solution (1.0 g NaBH ₄ , 300 ml PBS (pH 7.4), 100 ml EtOH) for 15 minutes, 0.2% SDS solution for 1 minute, Washed with distilled water for 2 minutes, and dried at room temperature to prepare a microarray.

Example 3 Prediction of Meat Quality of Hanwoo Meat Using Microarray According to the Present Invention

The present inventors isolated target DNA from the blood of Hanwoo to predict the meat quality of Hanwoo meat, and fluorescently labeled with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 and the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was carried out at 42 DEG C for 4 hours. Washed twice with 2 x SSC for 5 minutes at room temperature and then dried in air. After drying, the slides were scanned with a scan array 5000 (ScanArray 5000: GSI Lumonics) and the results were analyzed by QuantArray (GSI Lumonics) and ImaGene software (BioDiscover) The meat quality of Hanwoo meat was predicted by judging the year and the degree of succulence of Hanwoo meat.

As described above, by using the single base polymorphism of the calpain / calpastatin gene according to the present invention, it is possible to analyze at the molecular biological level of the year, juiciness and flavor, which are meat quality traits of Korean beef meat, It is useful as a selection gene marker for improvement of meat quality of Hanwoo meat by providing objective gene information and profile of meat-related genes and proteins of Hanwoo meat.

While the present invention has been particularly shown and described with reference to exemplary embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, It will be obvious that it is not. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> RURAL DEVELOPMENT ADMINISTRATION <120> DNA marker for predicting of palatability in Hanwoo <130> NPF22384 <160> 3 <170> PatentIn version 3.2 <210> 1 <211> 52 <212> DNA <213> Bos taurus coreanae <220> <221> misc_feature <222> (27) N = GG, AA, GA, AG <400> 1 cagtcagctc tccagaactc aggctgntga aaaagccccg gtccccaagg tc 52 <210> 2 <211> 52 <212> DNA <213> Bos taurus coreanae <220> <221> misc_feature <222> (27) <223> n = GG, CC, GC, CG <400> 2 cgatgccctg gatcaacttt ctgacantct cgggcaaaga cagcctgatc ca 52 <210> 3 <211> 52 <212> DNA <213> Bos taurus coreanae <220> <221> misc_feature <222> (27) N = AG, AA, GA, GG <400> 3 ccctctgcag agagctggat gaccagntcc aggccaatct ccccgacgag gt 52

Claims (4)

A composition for predicting meat quality of Korean beef meats comprising 10 to 200 consecutive polynucleotides or complementary polynucleotides thereto, each of which comprises a 27 base position in each base sequence of SEQ ID NOS: 1 to 3 as a single base polymorph.
A microarray for predicting meat quality of Hanwoo meat comprising the composition according to claim 1.
A kit for predicting meat quality of Hanwoo meat comprising the composition according to claim 1.
When the 27th nucleotide locus of SEQ ID NO: 1 is a GG genotype, it is determined that the juiciness and flavor are higher than those of AA and AG genotypes. When the 27th nucleotide locus of SEQ ID NO: 2 is a GG genotype, And the flavor is judged to be high. When the 27th nucleotide locus of SEQ ID NO: 3 is the AG genotype, it is judged that the year, juiciness and flavor are higher than those of the AA and GG genotypes.