KR101584598B1 - Genetic marker of porcine PKM2 for predicting back fat thickness of Sus scrofa and predicting method of back fat thickness using thereof - Google Patents

Abstract

The present invention relates to a genetic marker for predicting the back thickness of a pig, a microarray and kit containing the same, and a method for predicting the back thickness of a pig using the same. The genetic markers for predicting the back thickness of pigs according to the present invention and the method for predicting back thickness of pigs using the same can be used to analyze the backbone thickness characteristics of pigs at the molecular level, It is possible to select breeds with excellent economic traits as predictable molecular markers.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a porcine PKM2 gene marker for predicting the back thickness of a pig, and a method for predicting back thickness of a pig using the same,

The present invention relates to a genetic marker for predicting the back thickness of a pig, a microarray and kit containing the same, and a method for predicting the back thickness of a pig using the same.

Recent developments in molecular genetic techniques have led to the development of genetic markers that are associated with specific traits, such as genetic disease at the DNA level or meat quality of livestock. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTL) that determine important economic traits and include linkage analysis, genetic maps, parentage testing has been used as a powerful tool to analyze distinction of breeds, pedigree analysis, genetic diversity and relationship. Especially in the field of genetic and breeding of livestock, it is used for marker assisted selection (MAS) through genetic markers based on DNA polymorphism.

Most economic traits in livestock are known to be quantitative traits due to the influence of various genes, and studies are being actively conducted to search for genetic loci and genetic loci involved in these traits. Especially, in order to discover the gene related to the trait, a single nucleotide polymorphism (SNP) and trait related researches have been actively carried out on functional genes. Various trait related SNPs have been discovered to date.

Genomic maps often reveal the presence of SNP, but there are SNPs that have not yet been discovered, and there are still many cases where the SNPs that have been discovered have not been studied for their phenotypic effects. SNPs affect phenotypes and can be used as markers that have an effect on the economic traits of pigs if the economic traits such as pig weight, meat quality, meat color, backfat thickness, intramuscular fat and number of hatching are changed.

Korean Patent Publication No. 2011-0139009

It is an object of the present invention to identify the structure of the PKM (Pyruvate Kinase Muscle) 2 gene in pigs, which is expected to play an important role in the degradation pathway of the sugar, and to discover new single base polymorphisms associated with the back- Thereby providing a genetic marker for predicting the back thickness of pigs.

It is another object of the present invention to provide a microarray for predicting the back thickness of pigs containing the gene markers.

It is still another object of the present invention to provide a kit for predicting backgrowth thickness of a pig containing the genetic marker.

It is a further object of the present invention to provide a method for predicting the back thickness of a pig using the gene marker, microarray or kit.

In order to solve the above technical problem,

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotide consecutive polynucleotides or polynucleotides complementary thereto, each polynucleotide having a base sequence at the 101st position in the nucleotide sequence of SEQ ID NO: 1 Genetic markers for backfat thickness prediction can be provided.

According to another aspect of the present invention, there is provided a microarray for predicting the back thickness of a pig including the genetic marker.

According to another aspect of the present invention, there is provided a kit for predicting the back thickness of a pig including the genetic marker.

According to another aspect of the present invention, there is provided a method of predicting the back thickness of a pig which is determined to have a thicker backfat thickness than that of GG when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is AA or AG A method can be provided.

The genetic markers for predicting the back thickness of pigs according to the present invention and the method for predicting back thickness of pigs using the same can be used to analyze the backbone thickness characteristics of pigs at the molecular level, It is possible to select breeds with excellent economic traits as predictable molecular markers.

Certain terms are hereby defined for convenience in order to facilitate a better understanding of the present invention. Unless otherwise defined herein, scientific and technical terms used in the present invention shall have the meanings commonly understood by one of ordinary skill in the art. Also, unless the context clearly indicates otherwise, the singular form of the term also includes plural forms thereof, and plural forms of the term should be understood as including its singular form.

As used herein, the term " nucleotide "or" polynucleotide "is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically indicated (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

The term "probe" as used herein refers to a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

As used herein, the term " single nucleotide polymorphism "(SNP) is a single base-pair variation in the DNA between identical species and is the most common polymorphism . The SNPs present in the transcriptional regulatory sequences such as promoters can regulate the amount of expressed gene and can be used to identify sequences that are located at the exon-intron boundaries that affect RNA splicing, SNPs may affect RNA stability or translation performance.

The term "PKM (Pyruvate Kinase Muscle)" used in the present invention is also referred to as pyruvate kinase type K, cytosolic thyroid hormone-binding protein (CTHBP), thyroid hormone-binding protein 1 (THBP1) or opa-interacting protein 3 As a known enzyme, it catalyzes the last step of the process of phosphinolpyruvate dephosphorylation with pyruvate and is one of the enzymes of pyruvate kinase, a glycolytic enzyme. pyruvate kinase is expressed in different forms of isoenzyme according to the different metabolic functions of different tissues.

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotide consecutive polynucleotides or polynucleotides complementary thereto, each polynucleotide having a base sequence at the 101st position in the nucleotide sequence of SEQ ID NO: 1 Genetic markers for backfat thickness prediction can be provided.

SEQ ID NO: 1 shows a part of the pig PKM (pyruvate kinase muscle) 2 gene of the Berkshire variety. According to the present invention, 10 to 200 nucleotides including the 101 th locus (g.34341 A> G) A genetic marker for predicting the backtight thickness of a pig according to a combination of consecutive polynucleotides or complementary polynucleotides thereto may be provided.

Here, the thickness of back porch of the pig means the thickness of the back fat of the conductor and is useful for objectively evaluating the quality and the weight of the conductor. In the case of pigs, the method of measuring the backfill thickness includes manpower measurement and mechanical measurement. The above-mentioned measurement method and the criteria for determining the grade of porcine conductor thereof are based on the Ministry of Agriculture, Forestry and Livestock Notice No. 2013-109, and the test of the function of the genetic marker according to the present invention is also based on the notification.

Here, the method for identifying the single nucleotide polymorphism (SNP) is not particularly limited, and a method commonly used in the art may be used. Specifically, an allele-specific probe hybridization method, an allele-specific amplification method, a sequencing method, a 5 'nuclease digestion method, A method selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis and single-stranded conformation polymorphism ≪ / RTI >

The nucleic acid molecule can be obtained from various sources of pigs, for example, from muscle, epidermis, blood, bone, organs, and most preferably from muscle or blood.

Here, when the starting material is gDNA, the separation of gDNA can be carried out according to a conventional method known in the art (see Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics.

Sequence changes of the single base polymorphism result in differences in base-linkage within the single-stranded molecule, leading to the appearance of different bands of mobility, and SSCA detects this band. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers that are complementary to a sequence comprising a single base polymorphism of the invention. For example, in an RNase protection assay, a riboprobe complementary to a sequence comprising a single base polymorphism of the present invention is used. The riboprobe is hybridized with DNA or mRNA isolated from the animal, and then cleaved with an RNase A enzyme capable of detecting a mismatch. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In an assay using a hybridization signal, a probe complementary to a sequence comprising a single base polymorphism of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to determine whether a single base polymorphism is directly observed.

As a probe used in the present invention, a perfectly complementary sequence may be used in the sequence including the single nucleotide polymorphism, but a sequence substantially complementary to the complementary sequence does not interfere with the specific hybridization May be used. Preferably, the 3'-terminal or 5'-end of the probe has a base complementary to the single base polymorphic base. In general, the stability of the duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that a probe having a base complementary to a single base polymorphic base at the 3'-terminal or 5'- Such a duplex can be disassembled under stringent conditions. Suitable conditions for hybridization include, but are not limited to, Nucleic Acid Hybridization, A Practical Approach, Hayes, BD, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, IRL Press, Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

In one embodiment, identification of the genetic marker may be performed by an allele-specific gene amplification method. When a single nucleotide polymorphism is applied to the gene amplification method, it is collectively referred to as SNAP (single nucleotide amplified polymorphism).

As used herein, the term "primer" refers to a single strand of oligonucleotides, suitable conditions (presence of four different nucleoside triphosphates and a polymerase such as a DNA or RNA polymerase) Quot; means acting as a starting point from which template-directed DNA synthesis can be initiated under suitable buffers. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

Amplification techniques that can be used in the present invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reaction (LCR, Wu, DY et al. (Genomics 4: 560 (1989)), polymerase ligase chain reaction (Barany, PCR Methods and Appl., 1: 5-16 (1991)), Gap-LCR (WO 90/01069) 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably, it is amplified according to the PCR amplification step.

Here, the size of the polynucleotide is limited to 10 to 200 bp, which is preferably limited to represent technical specificity at a reproducible level by the current hybridization technique, and the degree to which the single nucleotide polymorphism can be identified It can be used as a size outside the above range depending on the technique used.

In addition, the genetic markers for predicting the backfat thickness according to the present invention may include other single polymorphic polymorphisms that have proven statistically significant with the pig backfat thickness other than the single base polymorphism disclosed in the present invention, Can be used in various combinations to improve the statistical significance, reliability, and accuracy of prediction.

According to another aspect of the present invention, there is provided a microarray for predicting the back thickness of a pig including the genetic marker.

Here, the microarray may be a polynucleotide for recognizing the nucleotide sequence of the single nucleotide polymorphism, as well as a polypeptide encoded by the polynucleotide or the cDNA of the polynucleotide, if the nucleotide sequence is within a range that facilitates identification of the gene marker .

According to various embodiments of the present invention, the material for detecting the single base polymorphism is not limited to nucleic acids. A variety of biological techniques may be used, including polypeptides, proteins, other nucleic acids or modifications of proteins that recognize a particular sequence of nucleic acid.

According to another aspect of the present invention, there is provided a kit for predicting the back thickness of a pig including the genetic marker. The kit may further comprise a genetic marker of a component capable of selectively detecting the single nucleotide polymorphism, as well as a container or accessory device capable of facilitating such detection more easily and rapidly.

According to another aspect of the present invention, there is provided a method of predicting the back thickness of a pig which is determined to have a thicker backfat thickness than that of GG when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is AA or AG A method can be provided.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1. Development of single nucleotide polymorphism from PKM2 gene for predicting backfat thickness in pigs

(1) Disclosure materials

All disclosed pigs used in the examples of the present invention are a total of 666 pigs produced from the porkbear line of the Berkshire variety purebred pig, which is produced from the domesticated piglets located in Namwon, Jeonbuk. The pigs were reared under the same conditions. When the average weight reached about 110 kg, pigs were slaughtered and analyzed for the frequency of PKM2 gene mutations and associated trait analysis.

Except for the backfat thickness (BF) measured between the 10th and 11th vertebrae after slaughter, the other backfat thickness traits were measured using sirloin tissue. The carcass weight (CWT) was measured after slaughter except for the head, internal organs, legs and leather parts. The acidity of the carcass weight (pH ^* K21, NWK-Binar GmbH Co., Germany). The water holding capacity (WHC) was measured by measuring the weight of the juice adsorbed on the filter paper by standing on the cut face of the fillet for 5 minutes and then adsorbing the juice on the cut surface with a 5 cm diameter filter paper (Whatman No. 5) The juice loss (Driploss) was measured by measuring the weight and the weight of the first liquor after 24 hours at 4 ℃ after cutting the outside air into the zipper pack. The heat loss was measured by heating the deep portion temperature of the fillet at 75 ° C for 10 minutes and then cooling to reduce the weight. The meat color was measured by measuring the CIE (Commision Internationale de Leclairage) brightness (L), redness (a), and yellowness (b) values with a color intensity meter (Minolta Co. CR 300, Respectively. The standard plates used were white tiles with Y = 92.40, x = 0.3136, y = 0.3196. Shearing force (SF) was measured using a Warner-Bratzler shear force meter (GR Elec. Mfg. Co., USA) to objectively analyze the year of ingestion. The water content, fat content, protein content and collagen content were measured according to the method provided by the American Chemical Society.

Table 1 below shows the mean, standard deviation, minimum value and maximum value of each trait for a total of 670 pigs of Berkshire varieties used as disclosure materials.

characteristics Average Standard Deviation Minimum value Maximum value CWT (kg) 85.98 5.51 71 105 pH 24 5.77 0.19 5.37 6.72 WHC (%) 58.40 3.38 50.13 67.82 Drip loss (%) 4.43 1.91 12.30 14.38 Heat loss (%) 26.51 4.16 12.30 39.02 MC_L 48.49 2.75 38.00 57.68 MC_a 6.26 1.04 3.40 9.62 MC_b 3.14 1.21 0.33 6.85 BF (mm) 25.10 5.20 12 41 SF (kg / 0.5 inch ² ) 3.08 0.80 1.45 6.14 Moisture (%) 75.17 1.12 69.98 77.57 Fat (%) 2.67 1.18 0.42 10.15 Protein (%) 23.76 0.88 20.95 26.24 Collagen (%) 0.89 0.13 0.53 1.39

(2) DNA extraction from tissue

DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the protocol provided. About 20 mg of the sirloin tissue was cut and placed in a 1.5-ml tube. After finely chopping, 600 μl of Nucleic Lysis Solution and 20 μl of Proteinase K were added, vortexed and allowed to dissolve the cells in a 55 ° C water bath for 1 hour. During the interval, he did bore texting every 20 minutes. After incubation, the mixture was cooled on ice for 3 minutes, then 3 μl of RNaseA (20 mg / ml) was added, and the mixture was placed in a 37 ° C incubator for 15 minutes. After cooling for 10 minutes at room temperature, 200 μl of protein precipitation solution was added, followed by vigorous boiling for 20 seconds, cooling on ice for 5 minutes, and centrifugation at 13,000 rpm for 6 minutes. The supernatant was transferred to a fresh 1.5 ml tube, inverted by adding 600 [mu] l of isopropanol and centrifuged at 13,000 rpm for 6 min. The supernatant was discarded except for the pellet, 1 ml of 70% ethanol was added, and the solution was changed 10 times and centrifuged at 13,000 rpm for 6 minutes. The supernatant was discarded and dried at room temperature. Then, 200 μl of sterilized distilled water was added and the concentration and quality were measured using Nano Drop ND-1000 Spectrophotometer V3.7 (Themo Scientific, USA). The extracted DNA was stored at -20 ° C in a freezer until it was used at 50 ng / μl.

(3) Identification of PKM2 gene structure in pigs

In the process of confirming the coding DNA information (CDS) of the PKM2 gene of pigs, the exon region could not be defined because the pig genome sequence revealed to date has not been correctly identified. Therefore, in order to enhance the completeness of this disease, 140 expressing sequence fragments (ESTs) registered in the US National Center for Biological Information (NCBI) database and accession no. NC_010449 of PKM2 were combined. The entire structure of the porcine PKM2 gene could be identified by defining the exon and intron regions of the porcine PKM2 gene as shown in Table 2 below.

Exon location Exon size (bp) Intron Intron size (bp) One 1-129 129 One 799 2 929-1,008 80 2 397 3 1,406-1,469 64 3 151 4 1,621-1,705 85 4 19,288 5 20,994-21,175 182 5 512 6 21,688-21,779 92 6 2,856 7 24,636-24,767 132 7 454 8 25,222-25,408 187 8 714 9 26,123-26,393 271 9 1,626 10 28,020-28,170 151 10 240 11 28,411-28,563 153 11 3,335 12 31,899-32,065 167 12 1,803 13 33,869-34,050 182 13 581 14 34,632-35,358 727

(4) Primer production and gene amplification

Mutations in the exon region were searched to explore gene mutations that could alter the predicted function of the PKM2 gene. A total of 96 Burkshire pig gDNAs were used, amplified using the primers described in Table 3 below, and sequenced by searching for the amplified nucleotide sequence.

No. direction The sequence (5 '- > 3') One tablet GGGCTATTCAGTGAGGGGTA station AGCGTGGCTCCTTTCTTGAG 2 tablet TGCAGAGACCATCAAGAACG station CGTCTCTCCAGACAGCATGA 3 tablet GATAGCTCGTGAGGCTGAGG station ATATCCACGTCCTGCTCCAC 4 tablet GTCTGCACATCAGGTGGCTA station GTAGACCTTGCTGCCCACAT 5 tablet TTGGGTGGGGTAGTTCAGAG station AGACAGTCAGCAACGGCTTT

The nucleotide sequence was decoded using ABI PRISM 3730 Genetic Analyzer (Life Technologies). Detection results were combined using the SeqMan program in the LasStar 7 package from DNASTAR and found mutations. A single nucleotide polymorphism (SNP) was found in the exon region through primary genotype analysis (see Table 4).

SNP location Genotype frequency
(n = 670) Allele frequency g.34341A> G AA
(115, 0.17) AG
(338, 0.50) GG
(217, 0.32) A
(0.42) G
(0.58)

In order to confirm the polymorphism of the detected mutations, the genomic DNA of a total of 670 Berkshire individuals was subjected to PCR direct sequence sequencing using the primer No. 5 in Table 3 above.

20 μl of the gene amplification reaction was mixed with 1 μl of 50 ng / μl DNA, 2 μl of each primer, 1 μl of 10 mM dNTPs mix, 2 μl of 10 × reaction buffer, HS Taq DNA Polymerase (Genet Bio, Chungnam , Korea) was added to the reaction mixture, and the reaction mixture was amplified using a gene amplifier (MJ research PCR, PTC-240, USA). The amplification reaction conditions were preliminarily denatured at 94 ° C for 10 minutes, followed by denaturation at 94 ° C for 30 seconds, binding at 60 ° C to 63 ° C for 30 seconds, and reaction at 72 ° C for 1 minute. Min. The PCR product was electrophoresed using 1% agarose gel, and amplification was confirmed on UV using a gel image analyzer.

(4) Statistical analysis

For the analysis of the genotype and polymorphism of one single nucleotide polymorphism in 670 polymorphisms used in the analysis, two-step analysis was performed using SAS9.2 PROC GLM (generalized linear model) procedure (Statistical Analysis System, USA) Respectively. Factors affecting the phenotype were applied to the general linear model as follows.

General linear model (GLM): Y = Xb + e

Here, X = vector including fixed effects and covariance for each trait, b = fixed effect and covariance effect for each trait, e = random error,

In the given model, the slaughter date was corrected to covariance as a fixed effect for sire and sex for all traits. Regression analysis model was applied to analyze the marker effect that affects each trait for each model set by Least Squares (LS).

Model: y = μ + xb + addi + doi + e

Here, μ = total mean for each trait, b = fixed effect and covariance effect for each trait, addi = additive effect of i-th single nucleotide polymorphism with fixed effect, doi = fixed effect, Dominant effect of polymorphism, e = random error,

(5) Trait association analysis of single nucleotide polymorphisms of pig PKM2 gene

In the analysis, paternal and sex were used as fixed factors, and the slaughter timing was covariance. The additive and dominant effects of each variant were fixed according to the regression variable by replacing the AA, AB, and BB genotypes with 1, 0, -1 and 0, 1, and 0, respectively.

As a result, the exon mutation of one (g.34341 A> G) was located in the tntranslational region (UTR) compared to the 3'-, and only statistically significant results were obtained for only 14 of the traits .

characteristics genotype P-value AA
(n = 115) AG
(n = 338) GG
(n = 217) CWT (kg) 86.09 + - 0.70 86.70 + - 0.54 86.96 + - 0.56 0.403 BF (mm) 25.63 + - 0.59 25.47 + - 0.46 24.43 + - 0.48 0.027 pH 24 5.73 + 0.02 5.72 + 0.02 5.71 ± 0.02 0.488 WHC (%) 58.23 ± 0.29 58.03 + - 0.22 57.98 + - 0.23 0.626 Drip loss (%) 4.82 ± 0.22 4.79 ± 0.17 4.96 + 0.17 0.552 Heat loss (%) 26.03 + -0.53 25.71 + - 0.41 26.25 + - 0.43 0.347 MC_L 49.01. + -. 0.35 49.09 ± 0.27 49.35 ± 0.28 0.482 MC_a 6.14 ± 0.13 6.01 + - 0.10 6.05 ± 0.10 0.457 MC_b 3.35 ± 0.13 3.14 ± 0.10 3.22 ± 0.11 0.167 SF (kg / 0.5 inch ² ) 3.10 0.08 3.18 ± 0.06 3.11 ± 0.06 0.297 Moisture (%) 75.40 ± 0.12 75.55 + - 0.10 75.63 + - 0.10 0.118 IMF (%) 2.61 ± 0.13 2.59 ± 0.10 2.49 + - 0.10 0.514 Protein (%) 24.04 + - 0.01 24.06 + 0.07 24.07 ± 0.07 0.948 Collagen (%) 0.89 + 0.02 0.90 + - 0.01 0.89 ± 0.01 0.917

*: P < 0.05

Example 2. Fabrication of microarrays containing single nucleotide polymorphic gene markers for predicting back thickness of pigs according to the examples in the present invention

A microarray comprising a single nucleotide polymorphic gene marker for prediction of backfire thickness in an embodiment of the present invention was prepared by the following method.

A nucleotide consisting of 20 consecutive bases (the above-mentioned single base polymorphism is located at the 11th position among the 20 consecutive bases) consisting of 20 consecutive bases containing the 101st nucleotide locus as a single base polymorphism in the nucleotide sequence shown in SEQ ID NO: . Since there are two alleles at a single base polymorphism, two polynucleotides are immobilized on the substrate for each sequence.

First, the N-terminal of each polynucleotide was substituted with an amine group and then spotted on a silylation slide (Telechem). The spotting buffer was washed with 2 x SSC (saline-sodium citrate, pH 7.0) Respectively. After spotting, the binding was induced by placing in a drier, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and third distilled water for 2 minutes to remove unbound oligos. The slide was treated for 2 min at 95 ° C to induce denaturation and then incubated with blocking solution (1.0 g NaBH ₄ , 300 ml PBS (pH 7.4), 100 ml EtOH) for 15 min, 0.2% SDS solution for 1 min , And then washed with tertiary distilled water for 2 minutes and dried at room temperature to prepare a microarray.

Example 3. Predicting Back Thickness of Porcine Pigs Using Microarrays According to Examples of the Invention.

The present inventors separated the target DNA from the blood of the pig to estimate the backfat thickness, and fluorescently labeled with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 and the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was carried out at 42 DEG C for 4 hours. Washed twice with 2 x SSC at room temperature for 5 minutes and then dried in air.

After drying, the slides were scanned with Scan Array 5000 (ScanArray 5000: GSI Lumonics) and the results were analyzed with QuantArray (GSI Lumonics) and ImaGene software (BioDiscover). From the above analysis result, it was confirmed whether the pig had the genotype of the single nucleotide polymorphism according to the present invention, thereby predicting the back thickness of the pig.

The genetic markers for predicting the back thickness of pigs according to the present invention and the method for predicting back thickness of pigs using the same can be used to analyze the backbone thickness characteristics of pigs at the molecular level, It is possible to select breeds with excellent economic traits as predictable molecular markers.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit of the invention as set forth in the appended claims. The present invention can be variously modified and changed by those skilled in the art, and it is also within the scope of the present invention.

                         SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> Genetic marker of porcine PKM2 for predicting back fat thickness        of Sus scrofa and predicting method of back fat thickness using        the <130> NPF-25085 <160> 1 <170> PatentIn version 3.2 <210> 1 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = a or g <400> 1 caaccccctt agcctccctc actccccctt tgttgtgcac tgtgcacttc tgttccttca 60 ctccatttag ctgccgctgc agacaaacac tccaccctcc ncctcccatt tccccgacta 120 ctgcagccgc ctccaggcct gttgctatag agtctacctg tatgtcaata aacaacagct 180 gaagcacctg tttcctctct t 201

Claims (4)

A continuous polynucleotide of 10 to 200 nucleotides in SEQ ID NO: 1 or a complementary polynucleotide for the polynucleotide of SEQ ID NO: 1 contained in a single base polymorphism of A / G at position 101 in the nucleotide sequence shown in SEQ ID NO: 1 Genetic marker for prediction of backfat thickness.
A microarray for predicting the back thickness of a pig comprising a genetic marker according to claim 1.
A kit for predicting back thickness of pigs comprising a genetic marker according to claim 1.
Wherein the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is AA or AG, it is judged to have a thicker backfat thickness than that of GG.