KR101595017B1 - Genetic composition of porcine MICU1 for predicting meat quality of pork and predicting method of meat quality using thereof - Google Patents

Abstract

The present invention relates to a gene composition for predicting meat quality of pork, a microarray and kit containing the same, and a method for predicting meat quality of pork using the kit. The gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level and can be used as a marker for predicting the meat quality of pork Selection of this improved breed is possible.

Description

TECHNICAL FIELD The present invention relates to a MICU1 gene composition of a pig for predicting meat quality of pork, and a method for predicting meat quality of pork using the same.

The present invention relates to a gene composition for predicting meat quality of pork, a microarray and kit containing the same, and a method for predicting meat quality of pork using the kit.

Recent developments in molecular genetic techniques have led to the development of genetic markers that are associated with specific traits, such as genetic disease at the DNA level or meat quality of livestock. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTL) that determine important economic traits and include linkage analysis, genetic maps, parentage testing has been used as a powerful tool to analyze distinction of breeds, pedigree analysis, genetic diversity and relationship. Especially in the field of genetic and breeding of livestock, it is used for marker assisted selection (MAS) through genetic markers based on DNA polymorphism.

Most economic traits in livestock are known to be quantitative traits due to the influence of various genes, and studies are being actively conducted to search for genetic loci and genetic loci involved in these traits. Especially, in order to discover the gene related to the trait, a single nucleotide polymorphism (SNP) and trait related researches have been actively carried out on functional genes. Various trait related SNPs have been discovered to date.

Genomic maps often reveal the presence of SNP, but there are SNPs that have not yet been discovered, and there are still many cases where the SNPs that have been discovered have not been studied for their phenotypic effects. If the SNP affects the phenotype and the meat or meat-related trait of the pork varies, it can be used as a marker with effects on the meat or meat-related traits of the pork.

Korean Patent Publication No. 2011-0139009

It is an object of the present invention to provide a gene composition for predicting meat quality of pork.

Another object of the present invention is to provide a microarray for predicting meat quality of pork containing the gene composition.

It is still another object of the present invention to provide a kit for predicting meat quality of pork containing the gene composition.

Yet another object of the present invention is to provide a method for predicting meat quality of pork using the gene composition, microarray or kit.

In order to solve the above technical problem,

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotides consecutive polynucleotides or complementary polynucleotides thereof each containing a polynucleotide of the 101st position in the nucleotide sequence shown in SEQ ID NO: 1 to 3 A gene composition for predicting meat quality of pork can be provided.

In one embodiment, the meat quality of the pork can be predicted by at least one of 24 hours post-hoc pH, juice loss, meat color, fat content, muscle fat content, backfat thickness and moisture content.

According to another aspect of the present invention, a microarray for predicting meat quality of pork containing the gene composition may be provided.

According to another aspect of the present invention, a kit for predicting meat quality of pork containing the gene composition may be provided.

According to another aspect of the present invention, when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is GG and GA, the pH is higher than that of AA at 24 hours post-hoc, Juice loss and yellowness, and if GA and AA, have a higher fat content than in the case of GG; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 2 is AA, it has a higher juice loss and yellowness than in the case of GG and GA, and has a higher fat content in case of GA and AA than in case of GG ; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 3 is GG and AA, it has a higher isotopic thickness than that of GA, and in the case of GG, a higher degree of redness, A method of predicting the meat quality of pork which has a fat content and which is judged to have a higher moisture content in case of GA and AA than in case of GG can be provided.

According to another aspect of the present invention, a single base polymorphic single phase type for the 101st locus in the nucleotide sequence shown in SEQ ID NOS: 1 to 3 is: GGA single phase type, has a lower yellowness than the other single phase type, If not, it is determined to have high redness, moisture content, backfat thickness and intramuscular fat content; AAG single phase, a meat quality predicting method of pork can be provided, which has a higher intramuscular fat content than the other monophasic forms, and is not of the AAG single phase type, and has a high aftertaste pH of 24 and a low juicy loss.

The gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level and can be used as a marker for predicting the meat quality of pork Selection of this improved breed is possible.

Certain terms are hereby defined for convenience in order to facilitate a better understanding of the present invention. Unless otherwise defined herein, scientific and technical terms used in the present invention shall have the meanings commonly understood by one of ordinary skill in the art. Also, unless the context clearly indicates otherwise, the singular form of the term also includes plural forms thereof, and plural forms of the term should be understood as including its singular form.

As used herein, the term " nucleotide "or" polynucleotide "is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically indicated (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

The term "probe" as used herein refers to a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

As used herein, the term " single nucleotide polymorphism "(SNP) is a single base-pair variation in the DNA between identical species and is the most common polymorphism . The SNPs present in the transcriptional regulatory sequences such as promoters can regulate the amount of expressed gene and can be used to identify sequences that are located at the exon-intron boundaries that affect RNA splicing, SNPs may affect RNA stability or translation performance.

The term "MICU1 (mitochondrial calcium uptake 1)" gene used in the present invention exists in the chromosome 14 of pig, and the MICU1 protein encoded by the gene promotes the uptake of calcium into the mitochondria. The chromosome 14 is associated with fat such as abdominal fat weight (ABOF), backfat thickness (BFT), carcass weight (CWT) and intestinal fat weight (CFW) There is a quantitative trait loci (QTL).

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotides consecutive polynucleotides or complementary polynucleotides thereof each containing a polynucleotide of the 101st position in the nucleotide sequence shown in SEQ ID NO: 1 to 3 A gene composition for predicting meat quality of pork can be provided.

The nucleotide sequence shown in SEQ ID NOS: 1 to 3 represents a part of MICU1 (mitochondrial calcium uptake 1) gene of pork. According to the present invention, the nucleotide sequence shown in SEQ ID NO: 1 (c.1576 G> A), SEQ ID NO: 2 (c. 1662 G > A) and SEQ ID NO: 3 (c. 1925 G > A) as the single nucleotide polymorphism or a complementary polynucleotide of 10 to 200 nucleotides A gene composition for predicting meat quality of pork according to a combination of polynucleotides can be provided.

Here, the meat quality of the pork can be measured by car weight (CWT), pH 24 (pH 24), water holding capacity (WHC), juice loss, heat loss, CIE_highness Shearinf force (SF), Moisture content, Fat content, Intramuscular fat (IMF), CIE_ redness (MC_a), CIE_ yellowness (MC_b), Backfat thickness The protein content, the collagen content, and the like.

In another embodiment, the meat quality of the pork meat is preferably at least one, more preferably at least one selected from the group consisting of pH, juice loss, meat color, fat content, intramuscular fat content, Time pH, juice loss, meat color, fat content, intramuscular fat content, backfat thickness and moisture content.

In meat quality assessment important element of the post 24 hours pH (pH24) one after slaughter pork is as the pH measured after 24 hours of slaughter, 45 minutes after the pH (pH45 _min) and the pH of the back 1 hours (pH _1h ) (J. Anim. Sci. & Technol. (Kor.) 44 (2) 233-238, 2002) to measure the meat quality of pork meat objectively. The normal pH lowering rate of porcine conductors is 0.01 unit / min corresponding to 150 min stiffness time assuming a linear decrease in pH. When the pH lowering rate is increased, protein denaturation is induced and PSE (pale, soft, exudative) And a high pH reduction rate can make the color paler more pale. Therefore, the degree of protein denaturation after slaughter depends on the rate of decrease in pH until the onset of toughness.

The items for predicting or determining the meat quality of the pork are based on the detailed criteria for determining the livestock meat grade according to Notification No. 2013-109 of the Ministry of Food, Agriculture, Forestry and Livestock, and the meat quality of the pork can be predicted or measured The determination method is well known in the above-mentioned notification and the technical field to which the present invention belongs.

Here, the method for identifying the single nucleotide polymorphism (SNP) is not particularly limited, and a method commonly used in the art may be used. Specifically, an allele-specific probe hybridization method, an allele-specific amplification method, a sequencing method, a 5 'nuclease digestion method, A method selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis and single-stranded conformation polymorphism ≪ / RTI >

The nucleic acid molecule can be obtained from various sources of pigs, for example, from muscle, epidermis, blood, bone, organs, and most preferably from muscle or blood.

Here, when the starting material is gDNA, the separation of gDNA can be carried out according to a conventional method known in the art (see Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics.

Sequence changes of the single base polymorphism result in differences in base-linkage within the single-stranded molecule, leading to the appearance of different bands of mobility, and SSCA detects this band. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers that are complementary to a sequence comprising a single base polymorphism of the invention. For example, in an RNase protection assay, a riboprobe complementary to a sequence comprising a single base polymorphism of the present invention is used. The riboprobe is hybridized with DNA or mRNA isolated from the animal, and then cleaved with an RNase A enzyme capable of detecting a mismatch. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In an assay using a hybridization signal, a probe complementary to a sequence comprising a single base polymorphism of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to determine whether a single base polymorphism is directly observed.

As a probe used in the present invention, a perfectly complementary sequence may be used in the sequence including the single nucleotide polymorphism, but a sequence substantially complementary to the complementary sequence does not interfere with the specific hybridization May be used. Preferably, the 3'-terminal or 5'-end of the probe has a base complementary to the single base polymorphic base. In general, the stability of the duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that a probe having a base complementary to a single base polymorphic base at the 3'-terminal or 5'- Such a duplex can be disassembled under stringent conditions. Suitable conditions for hybridization include, but are not limited to, Nucleic Acid Hybridization, A Practical Approach, Hayes, BD, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, IRL Press, Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

In one embodiment, identification of the gene composition may be performed by an allele-specific gene amplification method. When a single nucleotide polymorphism is applied to the gene amplification method, it is collectively referred to as SNAP (single nucleotide amplified polymorphism).

As used herein, the term "primer" refers to a single strand of oligonucleotides, suitable conditions (presence of four different nucleoside triphosphates and a polymerase such as a DNA or RNA polymerase) Quot; means acting as a starting point from which template-directed DNA synthesis can be initiated under suitable buffers. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

Amplification techniques that can be used in the present invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reaction (LCR, Wu, DY et al. (Genomics 4: 560 (1989)), polymerase ligase chain reaction (Barany, PCR Methods and Appl., 1: 5-16 (1991)), Gap-LCR (WO 90/01069) 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably, it is amplified according to the PCR amplification step.

Here, the size of the polynucleotide is limited to 10 to 200 bp, which is preferably limited to represent technical specificity at a reproducible level by the current hybridization technique, and the degree to which the single nucleotide polymorphism can be identified It can be used as a size outside the above range depending on the technique used.

In addition, the gene composition for predicting pork meat quality according to the present invention may include other single base polymorphism types having proven statistical significance with the pork meat quality other than the single base polymorphism disclosed in the present invention. The statistical significance, And can be used in various combinations for improving accuracy and the like.

According to another aspect of the present invention, a microarray for predicting meat quality of pork containing the gene composition may be provided.

Here, the microarray may include a polynucleotide for recognizing the nucleotide sequence of the single nucleotide polymorphism, as well as a polypeptide encoded by the nucleotide sequence or cDNA of the polynucleotide, .

According to various embodiments of the present invention, the material for detecting the single base polymorphism is not limited to nucleic acids. A variety of biological techniques may be used, including polypeptides, proteins, other nucleic acids or modifications of proteins that recognize a particular sequence of nucleic acid.

According to another aspect of the present invention, a kit for predicting meat quality of pork containing the gene composition may be provided. The kit may further comprise a gene composition of a component capable of selectively detecting the single nucleotide polymorphism, as well as a container or accessory device capable of facilitating such detection more easily and rapidly.

According to another aspect of the present invention, when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is GG and GA, the pH is higher than that of AA at 24 hours post-hoc, Juice loss and yellowness, and if GA and AA, have a higher fat content than in the case of GG; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 2 is AA, it has a higher juice loss and yellowness than in the case of GG and GA, and has a higher fat content in case of GA and AA than in case of GG ; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 3 is GG and AA, it has a higher isotopic thickness than that of GA, and in the case of GG, a higher degree of redness, A method of predicting the meat quality of pork which has a fat content and which is judged to have a higher moisture content in case of GA and AA than in case of GG can be provided.

According to another aspect of the present invention, a single base polymorphic single phase type for the 101st locus in the nucleotide sequence shown in SEQ ID NOS: 1 to 3 is: GGA single phase type, has a lower yellowness than the other single phase type, If not, it is determined to have high redness, moisture content, backfat thickness and intramuscular fat content; AAG single phase, a meat quality predicting method of pork can be provided, which has a higher intramuscular fat content than the other monophasic forms, and is not of the AAG single phase type, and has a high aftertaste pH of 24 and a low juicy loss.

The term "haplotype " as used herein refers to a set of single nucleotide polymorphisms statistically associated on the same chromosome, and is a set of adjacent single nucleotide polymorphisms that tend to be inherited together on the same chromosome. For example, the number of possible single-phase polymorphisms of a single nucleotide polymorphism for a total of three SNP loci is eight, but the number of single-phase polymorphisms actually observed may be less than that, and among the observed single- The number of single-phase forms with statistical significance may be limited.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1. Development of single base polymorphism from MICU1 gene for predicting meat quality in pork meat

(1) Disclosure materials

All the disclosures used in the examples of the present invention are of a total of 673 pigs produced in the breeding stock of the Berkshire variety purebred pig, The pigs were reared under the same conditions and when the average body weight reached about 110 kg, the mutation frequency of the MICU1 gene and the associated trait analysis were analyzed.

Other meat quality traits except backfat thickness (BF) measured between 10th and 11th vertebrae after slaughter were measured using sirloin tissue. The carcass weight (CWT) was measured after slaughter except for the head, internal organs, legs and leather parts. The acidity of the carcass weight (pH ^* K21, NWK-Binar GmbH Co., Germany). The water holding capacity (WHC) was measured by measuring the weight of the juice adsorbed on the filter paper by standing on the cut face of the fillet for 5 minutes and then adsorbing the juice on the cut surface with a 5 cm diameter filter paper (Whatman No. 5) The juice loss (Driploss) was measured by measuring the weight and the weight of the first liquor after 24 hours at 4 ℃ after cutting the outside air into the zipper pack. The heat loss was measured by heating the deep portion temperature of the fillet at 75 ° C for 10 minutes and then cooling to reduce the weight. The meat color was measured by measuring the CIE (Commision Internationale de Leclairage) brightness (L), redness (a), and yellowness (b) values with a color intensity meter (Minolta Co. CR 300, Respectively. The standard plates used were white tiles with Y = 92.40, x = 0.3136, y = 0.3196. Shearing force (SF) was measured using a Warner-Bratzler shear force meter (GR Elec. Mfg. Co., USA) to objectively analyze the year of ingestion. The water content, fat content, protein content and collagen content were measured according to the method provided by the American Chemical Society.

Table 1 below shows the mean, standard deviation, minimum value and maximum value of each trait for 673 pigs of the Berkshire variety used as disclosure material.

characteristics Average Standard Deviation Minimum value Maximum value CWT (kg) 85.93 5.49 71.00 105 pH 24 5.78 0.20 5.37 6.72 WHC (%) 59.09 3.03 50.42 67.63 Drip loss (%) 4.42 1.89 0.75 14.38 Heat loss (%) 26.15 4.28 10.33 39.02 MC_L 48.53 2.76 38.01 57.68 MC_a 6.18 1.00 3.40 9.62 MC_b 3.24 1.19 0.33 6.85 BF (mm) 25.13 5.21 12.00 46.00 SF (kg / 0.5 inch ² ) 2.89 0.69 1.45 5.66 Moisture (%) 75.38 1.01 69.98 77.47 IMF (%) 2.82 1.17 0.67 10.15 Protein (%) 23.96 0.75 21.46 26.24 Collagen (%) 0.89 0.13 0.53 1.39

(2) DNA and RNA extraction from tissue

DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the protocol provided. About 20 mg of the sirloin tissue was cut and placed in a 1.5-ml tube. After finely chopping, 600 μl of Nucleic Lysis Solution and 20 μl of Proteinase K were added, vortexed and allowed to dissolve the cells in a 55 ° C water bath for 1 hour. During the interval, he did bore texting every 20 minutes. After incubation, the mixture was cooled on ice for 3 minutes, then 3 μl of RNaseA (20 mg / ml) was added, and the mixture was placed in a 37 ° C incubator for 15 minutes. After cooling for 10 minutes at room temperature, 200 μl of protein precipitation solution was added, followed by vigorous boiling for 20 seconds, cooling on ice for 5 minutes, and centrifugation at 13,000 rpm for 6 minutes. The supernatant was transferred to a fresh 1.5 ml tube, inverted by adding 600 [mu] l of isopropanol and centrifuged at 13,000 rpm for 6 min. The supernatant was discarded except for the pellet, 1 ml of 70% ethanol was added, and the solution was changed 10 times and centrifuged at 13,000 rpm for 6 minutes. The supernatant was discarded and dried at room temperature. Then, 200 μl of sterilized distilled water was added and the concentration and quality were measured using Nano Drop ND-1000 Spectrophotometer V3.7 (Themo Scientific, USA). The extracted DNA was stored at -20 ° C in a freezer until it was used at 50 ng / μl. mRNA was also extracted from the filament tissue using Trizol reagent. The extracted mRNA was synthesized using random hexamers and SuperScript III (Invitron).

(3) Preparation of primer and gene amplification

Mutations in the exon region were searched for gene mutations that could alter the predicted function of the MICU1 gene. A total of 117 cDNAs of Berkshire pigs were used, amplified using the primers described in Table 2 below, and the sequence mutations were detected by decoding the base sequences.

Type of primer The sequence (5 '- > 3') Annealing
Temperature (° C) size
(bp) MICU1_mRNA F1 GCTGAAGCTCCGCTGTAGAC 60 905 R1 CAGCTTCCCCTTGAGATCAG F2 CAGGTTCAAAGCATCATTCG 60 858 R2 CGGAATGAGAGCCTAGCAGA F3 CCCAAACAGTAACCCCACAC 60 832 R3 GGGAGGGGTTATTGCAAACT MICU1_SNP F GACTGTGATGGCAATGGAGA 60 854 R GCTCAACCTCTGCTGCTCTT

The nucleotide sequence was decoded using ABI PRISM 3730 Genetic Analyzer (Life Technologies). Detection results were combined using the SeqMan program in the LasStar 7 package from DNASTAR and found mutations. A total of three single nucleotide polymorphisms were found in the exon region through analysis of the first genotype.

Single nucleotide polymorphism Genotype frequency
(n = 673) Allele frequency GG GA AA G A c.1576G> A 0.59 (394) ^a 0.35 (236) 0.06 (43) 0.76 0.24 c.1662G> A 0.58 (391) 0.35 (235) 0.06 (42) 0.76 0.24 c.1925G> A 0.47 (318) 0.44 (294) 0.11 (72) 0.69 0.33

In order to confirm the polymorphism of the detected mutations, genomic DNA of a total of 673 Berkshire individuals was subjected to PCR direct sequence sequencing using the primers shown in Table 2 above.

20 μl of the gene amplification reaction was mixed with 1 μl of 50 ng / μl DNA, 2 μl of each primer, 1 μl of 10 mM dNTPs mix, 2 μl of 10 × reaction buffer, HS Taq DNA Polymerase (Genet Bio, Chungnam , Korea) was added to the reaction mixture, and the reaction mixture was amplified using a gene amplifier (MJ research PCR, PTC-240, USA). The amplification reaction conditions were preliminarily denatured at 94 ° C for 10 minutes, followed by denaturation at 94 ° C for 30 seconds, binding at 60 ° C to 63 ° C for 30 seconds, and reaction at 72 ° C for 1 minute. Min. The PCR product was electrophoresed using 1% agarose gel, and amplification was confirmed on UV using a gel image analyzer.

(4) Statistical analysis

For analysis of the genotypes of three single nucleotide polymorphisms and the association between each of the traits for 673 birds used in the analysis, two-step analysis was performed using the SAS9.2 PROC GLM (generalized linear model) procedure (Statistical Analysis System, USA) Respectively. Factors affecting the phenotype were applied to the general linear model as follows.

General linear model (GLM): Y = Xb + e

Here, X = vector including fixed effects and covariance for each trait, b = fixed effect and covariance effect for each trait, e = random error,

In the given model, the slaughter date was corrected to covariance as a fixed effect for sire and sex for all traits. Regression analysis model was applied to analyze the marker effect that affects each trait for each model set by Least Squares (LS).

Model: y = μ + xb + addi + doi + e

Here, μ = total mean for each trait, b = fixed effect and covariance effect for each trait, addi = additive effect of i-th single nucleotide polymorphism with fixed effect, doi = fixed effect, Dominant effect of polymorphism, e = random error,

(5) Trait association analysis of single nucleotide polymorphism of porcine MICU1 gene

In the analysis, paternal and sex were used as fixed factors, and the slaughter timing was covariance. The additive and dominant effects of each variant were fixed according to the regression variable by replacing the AA, AB, and BB genotypes with 1, 0, -1 and 0, 1, and 0, respectively.

As a result, a total of three single nucleotide polymorphisms (c.1576G / A, c.1662G / A, c.1925G / A) were found and all three exon mutations were located in the untranslational region (UTR) .

As shown in Table 4 below, the three single nucleotide polymorphisms in the porcine MICU1 gene showed statistically significant association with pH, juice loss, meat color (redness and yellowness), fat content, moisture content and fat content .

Traits Genotype P-Value
( P < 0.05) GG GA AA c.1576G> A pH 24 5.720.02 5.730.02 5.660.03 0.0465 Driploss 4.810.17 4.870.17 5.540.30 0.0353 MC_b 3.140.10 3.110.11 3.560.19 0.0345 Fat 2.400.10 2.630.11 2.690.19 0.0185 c.1662G> A Driploss 4.800.17 4.860.18 5.540.31 0.0372 MC_b 3.140.10 3.110.11 3.550.19 0.0482 Fat 2.410.11 2.620.11 2.700.19 0.0328 c.1925G> A BF 25.550.48 24.490.48 25.220.68 0.0238 MC_a 6.110.10 5.890.10 6.000.14 0.0268 MC_b 3.270.11 3.070.11 2.960.15 0.0201 Moisture 75.420.10 75.690.10 75.690.14 0.0012 * IMF 2.710.10 2.330.11 2.490.15 <0.0001 **

*: P &lt;0.005; **: P < 0.001

Haplotypes of the three single nucleotide polymorphisms were also analyzed. The haplotype analysis was performed using the PHASE 2.1.1 program. As shown in Table 5 below, a total of 3 haplotypes were formed, and 56.2%, 29.7% and 21.7% of GGG, GGA and AAG single phase forms were found, respectively.

No. Single-phase type frequency One GGG 0.462572 2 GGA 0.296791 3 AAG 0.216880

As shown in Table 6, the relationship between the three haplotypes and the meat quality was analyzed. As a result, the GGG single-phase type did not show any statistical significance with the meat quality-related traits described in Table 1. However, the GGA single- In the absence of GGA single-phase type in the backfat thickness and intramuscular fat content, the value was relatively higher and the degree of yellowness was lower as the GGA was present. The AAG single phase showed relatively higher value when the AAG single phase was not present at 24 hours post-hoc pH, and the juice loss was lower as the AAG single phase type did not exist. Also, as the presence of AAG single phase, the content of intramuscular fat was found to be high.

characteristics Haplotype 2 (GGA), Frequency: 0.296791 P-value
(P < 0.05) 0 copy
(n = 319) 1copy
(n = 288) 2copies
(n = 60) MC_a 6.11 0.10 5.89 0.10 5.96 0.16 0.0344 MC_b 3.27 0.11 3.05 0.11 2.95 0.17 0.0127 BF (mm) 25.58 0.47 24.53 0.47 25.27 0.75 0.0246 Moisture (%) 75.42 0.10 75.69 0.10 75.68 0.15 0.0016 ** IMF (%) 2.73 0.10 2.32 0.10 2.49 0.17 <0.0001 *** Traits  Haplotype 3 (AAG), Frequency: 0.216880 P-value
(P < 0.05) 0 copy
(n = 401) 1copy
(n = 231) 2copies
(n = 35) pH 24 5.72 0.02 5.73 0.02 5.64 0.04 0.0194 Drip loss (%) 4.83 0.17 4.86 0.18 5.80 0.33 0.0072 * IMF (%) 2.43 0.10 2.64 0.11 2.73 0.21 0.0323

*: P &lt;0.01; **: P &lt;0.005; ***: P < 0.001

Therefore, selection of individuals not present in both GGA and AAG single-phase types may increase the likelihood of selection of pigs with excellent pH, jujube loss, redness, backfat thickness, water content, and intramuscular fat content for 24 hours after death . Another possibility is that selection of individuals with AAG single-phase type as an endogenous species without GGA single-phase type may be able to select a particularly high breed for intramuscular fat content.

Example 2: Production of a microarray containing a single nucleotide polymorphic gene composition for predicting meat quality of pork according to an embodiment of the present invention

A microarray comprising a single base polymorphic gene composition for predicting meat quality in an embodiment of the present invention was prepared by the following method.

A nucleotide consisting of 20 consecutive bases each containing a 101 nucleotide in the nucleotide sequence of SEQ ID NOS: 1 to 3 as a single nucleotide polymorphism (the three kinds of single nucleotide polymorphisms are the 11th nucleotide of the 20 consecutive nucleotides Position) was fixed on the substrate. Since there are two alleles at a single base polymorphism, two polynucleotides are immobilized on the substrate for each sequence.

First, the N-terminal of each polynucleotide was substituted with an amine group and then spotted on a silylation slide (Telechem). The spotting buffer was washed with 2 x SSC (saline-sodium citrate, pH 7.0) Respectively. After spotting, the binding was induced by placing in a drier, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and third distilled water for 2 minutes to remove unbound oligos. The slide was treated for 2 min at 95 ° C to induce denaturation and then incubated with blocking solution (1.0 g NaBH ₄ , 300 ml PBS (pH 7.4), 100 ml EtOH) for 15 min, 0.2% SDS solution for 1 min , And then washed with tertiary distilled water for 2 minutes and dried at room temperature to prepare a microarray.

Example 3. Method for predicting meat quality of pork using the microarray according to an embodiment of the present invention.

The present inventors separated the target DNA from the blood of pigs for which the meat quality was to be predicted, and fluorescently labeled with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 and the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was carried out at 42 DEG C for 4 hours. Washed twice with 2 x SSC at room temperature for 5 minutes and then dried in air.

After drying, the slides were scanned with Scan Array 5000 (ScanArray 5000: GSI Lumonics) and the results were analyzed with QuantArray (GSI Lumonics) and ImaGene software (BioDiscover). From the above analysis results, the meat quality of the pork was predicted by confirming the genotype of the single base polymorph according to the present invention.

Therefore, as described above, the gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level, As a predictable molecular marker, selection of breeds with improved meat quality is possible.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit of the invention as set forth in the appended claims. The present invention can be variously modified and changed by those skilled in the art, and it is also within the scope of the present invention.

                         SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> NPF-25087 <130> Genetic composition of porcine MICU1 for predicting meat quality        of pork and predicting method of meat quality using thereof <160> 3 <170> PatentIn version 3.2 <210> 1 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 1 aagccgagcc ttggcacagc cttccctgcc gctccttctg gaagtagtgc tcctccctcc 60 gggggatgat ctcaggattc ctcgggttgc cccggtccca ntgttctgct aggctctcat 120 tccgaaccag tgattctccc tgtaagtgtt cagaaacatg agcaagtcct gaaagcgcag 180 gccttcggca cgttcaacag c 201 <210> 2 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 2 ttgccccggt cccagtgttc tgctaggctc tcattccgaa ccagtgattc tccctgtaag 60 tgttcagaaa catgagcaag tcctgaaagc gcaggccttc ngcacgttca acagctccac 120 ccattcaagc acccacccta cggataaggc atgcagggaa ctctccacta actgccaggc 180 ctgggagaca cccagggctg g 201 <210> 3 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 3 ttttaagcta caagttggga gaacttctgg caggcaaaag gaaatcacgg ctgaacgaca 60 acaaagatga cctgagcacg ggagctgttg ggaggcctgg nccagatgaa ggattcgtgt 120 cagtccccag ggtagctctg aggcctggcc cggaaggcga tgtgcacggt gggaatggag 180 caagatttgg aatgtaaagc a 201

Claims (6)

A gene composition for predicting meat quality of pork comprising continuous polynucleotides of 10 to 200 nucleotides each, or complementary polynucleotides thereof, each of which contains a polynucleotide at position 101 in the nucleotide sequence shown in SEQ ID NO: 1 to 3 .
The method according to claim 1,
Wherein the meat quality of the pork is predicted by at least one selected from pH, juice loss, meat color, fat content, intramuscular fat content, backfat thickness and moisture content for 24 hours post-mortem.
7. A microarray for predicting meat quality of pork comprising the gene composition according to claim 1 or 2.
A kit for predicting meat quality of pork comprising the gene composition according to claim 1 or 2.
When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 1 is GG and GA, it has higher post-24-hour pH than AA, and in case of AA, the juice loss and yellowness are higher than those of GG and GA , And when it is GA and AA, it is judged to have a higher fat content than that of GG;
When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 2 is AA, it has a higher juice loss and yellowness than in the case of GG and GA, and has a higher fat content in case of GA and AA than in case of GG ;
When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 3 is GG and AA, it has a higher isotopic thickness than that of GA, and in the case of GG, a higher degree of redness, Fat content, and in case of GA and AA, it is judged to have a higher water content than that of GG.
A single nucleotide polymorphic single-phase form for the 101st locus in the nucleotide sequence shown in SEQ ID NO: 1 to 3:
GGA single-phase, it is judged to have a lower yellowness than that of the other single-phase, and to have a high redness, moisture content, backfat thickness and intramuscular fat content when not of the GGA single phase type;
AAG single-phase type has higher intramuscular fat content than the other single-phase type, and has a high post-24-hour pH and low juicy loss when not AAG single-phase type.