KR101595019B1 - Genetic composition of porcine FSD2 for predicting meat quality of pork and predicting method of meat quality using thereof - Google Patents

Abstract

The present invention relates to a gene composition for predicting meat quality of pork, a microarray and kit containing the same, and a method for predicting meat quality of pork using the kit. The gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level and can be used as a marker for predicting the meat quality of pork Selection of this improved breed is possible.

Description

TECHNICAL FIELD The present invention relates to a pork FSD2 gene composition for predicting meat quality of pork meat and a method for predicting meat quality of pork meat using the same.

The present invention relates to a gene composition for predicting meat quality of pork, a microarray and kit containing the same, and a method for predicting meat quality of pork using the kit.

Recent developments in molecular genetic techniques have led to the development of genetic markers that are associated with specific traits, such as genetic disease at the DNA level or meat quality of livestock. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTL) that determine important economic traits and include linkage analysis, genetic maps, parentage testing has been used as a powerful tool to analyze distinction of breeds, pedigree analysis, genetic diversity and relationship. Especially in the field of genetic and breeding of livestock, it is used for marker assisted selection (MAS) through genetic markers based on DNA polymorphism.

Most economic traits in livestock are known to be quantitative traits due to the influence of various genes, and studies are being actively conducted to search for genetic loci and genetic loci involved in these traits. Especially, in order to discover the gene related to the trait, a single nucleotide polymorphism (SNP) and trait related researches have been actively carried out on functional genes. Various trait related SNPs have been discovered to date.

Genomic maps often reveal the presence of SNP, but there are SNPs that have not yet been discovered, and there are still many cases where the SNPs that have been discovered have not been studied for their phenotypic effects. If the SNP affects the phenotype and the meat or meat-related trait of the pork varies, it can be used as a marker with effects on the meat or meat-related traits of the pork.

Korean Patent Publication No. 2011-0139009

The object of the present invention is to identify the structure of FSD2 (fibronectin type III and SPRY domain containing 2) gene of pigs which is expected to be related to the intracellular density and the moisture content of pork, and from this, And to provide a gene composition for predicting meat quality of pork by discovering a novel single base polymorphism associated with the content.

Another object of the present invention is to provide a microarray for predicting meat quality of pork containing the gene composition.

It is still another object of the present invention to provide a kit for predicting meat quality of pork containing the gene composition.

Yet another object of the present invention is to provide a method for predicting meat quality of pork using the gene composition, microarray or kit.

In order to solve the above technical problem,

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotide consecutive polynucleotides or complementary polynucleotides thereof each containing a polynucleotide having a base sequence at the 101st position in the nucleotide sequence shown in SEQ ID NO: 1 to 9 A gene composition for predicting meat quality of pork can be provided.

In one embodiment, the meat quality of the pork can be predicted by at least one selected from among carcasses, meat color, moisture content and fat content.

According to another aspect of the present invention, a microarray for predicting meat quality of pork containing the gene composition may be provided.

According to another aspect of the present invention, a kit for predicting meat quality of pork containing the gene composition may be provided.

According to another aspect of the present invention, when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is GG, it has higher conductance than that of AA and GA, and in the case of AA and GG, Has a higher brightness and has a higher yellowness in the case of AA, GA and GG, and a higher moisture content in case of GA and GG than that of AA; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 2 is GG, it has higher conductance than those of CC and GC. When the genotype is CC and GG, it has higher brightness than GC. GC and GG, and, if GC and GG, have a higher water content than CC; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 3 is AA, it has a higher conductance in the case of GA and GG and has higher yellowness and fat content in the case of GG in case of AA and GA, GA, it is determined that it has a higher moisture content in the case of AA and GG; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 4 is AA, it has higher conductance than that of GA and GG, and has higher yellowness and fat content than that of AA and GA in case of GG, , It is determined to have a higher water content in the case of AA and GG; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 5 is GG, it has higher conductance than that of AA and GA, and in case of AA, it has higher brightness and yellowness than GA and GG, And GG, it is determined that it has a higher moisture content than when it is AA; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 6 is TT, it has a higher conductance than those of CC and TC. When CC is TC, it has higher brightness and yellowness than TC and TT, And TT, it is determined to have a higher moisture content than that in case of CC; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 7 is TT, it has a higher conductance than that of CC and TC. When CC is TC, it has higher yellowness than TC and TT. , It is determined that the water content is higher than that in the case of CC; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 8 is CC, it has a higher conductance than TC and TT. In case of TT, CC and TC have higher yellowness than CC and TC , It is determined to have a higher water content than that in the case of TT; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 9 is TT, it has a higher conductance than those of CC and TC. When CC is TC, it has higher yellowness than TC and TT. , A method of predicting the meat quality of pork can be provided, which is judged to have a higher water content than that of the case of CC.

According to another aspect of the present invention, when the single-phase form of the single base polymorphism to the 101st flank of the nucleotide sequence shown in SEQ ID NOs: 1 to 9 is GGAAGTTCT single phase type, it has higher conductance and moisture content than the single- , GGAAGTTCT If it is not a single-phase type, a method of predicting meat quality of pork can be provided which is judged to have a high yellowness.

The gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level and can be used as a marker for predicting the meat quality of pork Selection of this improved breed is possible.

Figure 1 shows the structure of the porcine FSD2 gene and the position of the SNP.

Certain terms are hereby defined for convenience in order to facilitate a better understanding of the present invention. Unless otherwise defined herein, scientific and technical terms used in the present invention shall have the meanings commonly understood by one of ordinary skill in the art. Also, unless the context clearly indicates otherwise, the singular form of the term also includes plural forms thereof, and plural forms of the term should be understood as including its singular form.

As used herein, the term " nucleotide "or" polynucleotide "is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides unless otherwise specifically indicated (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

The term "probe" as used herein refers to a linear oligomer having a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

As used herein, the term " single nucleotide polymorphism "(SNP) is a single base-pair variation in the DNA between identical species and is the most common polymorphism . The SNPs present in the transcriptional regulatory sequences such as promoters can regulate the amount of expressed gene and can be used to identify sequences that are located at the exon-intron boundaries that affect RNA splicing, SNPs may affect RNA stability or translation performance.

As used herein, the term "FSD2 (fibronectin type III and SPRY domain containing 2)" gene is associated with the Fibronectin type III domain found in extracellular proteins of various animals and the ryanodine receptor associated with PSE (pale soft exudative) It is a gene encoding a protein containing the SPRY domain.

According to an aspect of the present invention, there is provided a polynucleotide comprising 10 to 200 nucleotide consecutive polynucleotides or complementary polynucleotides thereof each containing a polynucleotide having a base sequence at the 101st position in the nucleotide sequence shown in SEQ ID NO: 1 to 9 A gene composition for predicting meat quality of pork can be provided.

1 to 10 show a part of FSD2 (fibronectin type III and SPRY domain containing 2) gene of pigs. According to the present invention, the 101st locus in the nucleotide sequence shown in SEQ ID NOs: 1 to 9 is referred to as a single base polymorph A gene construct for predicting meat quality of pork according to a combination of consecutive polynucleotides of 10 to 200 nucleotides each, or a complementary polynucleotide thereof, may be provided.

Here, the 101st locus in the nucleotide sequences shown in SEQ ID NOS: 1 and 2 is present in the 5'-untranslational region (UTR), and in the nucleotide sequence shown in SEQ ID NOS: 3 to 10, Is located within the second exon of the FSD2 gene as the coding sequence (CDS) region.

Here, the meat quality of the pork can be measured by car weight (CWT), pH 24 (pH 24), water holding capacity (WHC), juice loss, heat loss, CIE_highness ), CIE_ redness (MC_a), CIE_ yellowness (MC_b), backfat thickness (BF), shearinf force (SF), moisture content, fat content, protein Protein content and collagen content, and the like.

In another embodiment, the meat quality of the pork is preferably selected from among carcasses, meat color (CIE_lightness (MC_L), CIE_ redness (MC_a), CIE_ yellowness (MC_b)), moisture content and fat content , At least one of the carbohydrate, moisture content and fat content in the carcass, more preferably in the carcass.

The items for predicting or determining the meat quality of the pork are based on the detailed criteria for determining the livestock meat grade according to Notification No. 2013-109 of the Ministry of Food, Agriculture, Forestry and Fisheries, and the meat quality of the pork can be predicted or measured The determination method is well known in the above-mentioned notification and the technical field to which the present invention belongs.

Here, the method for identifying the single nucleotide polymorphism (SNP) is not particularly limited, and a method commonly used in the art may be used. Specifically, an allele-specific probe hybridization method, an allele-specific amplification method, a sequencing method, a 5 'nuclease digestion method, A method selected from the group consisting of molecular beacon assay, oligonucleotide ligation assay, size analysis and single-stranded conformation polymorphism ≪ / RTI >

The nucleic acid molecule can be obtained from various sources of pigs, for example, from muscle, epidermis, blood, bone, organs, and most preferably from muscle or blood.

Here, when the starting material is gDNA, the separation of gDNA can be carried out according to a conventional method known in the art (see Rogers & Bendich (1994)). When the starting material is mRNA, the total RNA is isolated by a conventional method known in the art (see Sambrook, J. et al., Molecular Cloning, A Laboratory Manual, 3rd ed. Cold Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)). The isolated total RNA is synthesized by cDNA using reverse transcriptase. Since the total RNA is isolated from animal cells, it has a poly-A tail at the end of mRNA. CDNA can be easily synthesized using oligo dT primers and reverse transcriptase using such sequence characteristics.

Sequence changes of the single base polymorphism result in differences in base-linkage within the single-stranded molecule, leading to the appearance of different bands of mobility, and SSCA detects this band. DGGE analysis uses a denaturing gradient gel to detect sequences that represent wild type sequences and other mobility. Other techniques generally use probes or primers that are complementary to a sequence comprising a single base polymorphism of the invention. For example, in an RNase protection assay, a riboprobe complementary to a sequence comprising a single base polymorphism of the present invention is used. The riboprobe is hybridized with DNA or mRNA isolated from the animal, and then cleaved with an RNase A enzyme capable of detecting a mismatch. If there is a mismatch and RNase A recognizes, a smaller band is observed.

In an assay using a hybridization signal, a probe complementary to a sequence comprising a single base polymorphism of the present invention is used. In this technique, a hybridization signal of the probe and the target sequence is detected to determine whether a single base polymorphism is directly observed.

As a probe used in the present invention, a perfectly complementary sequence may be used in the sequence including the single nucleotide polymorphism, but a sequence substantially complementary to the complementary sequence does not interfere with the specific hybridization May be used. Preferably, the 3'-terminal or 5'-end of the probe has a base complementary to the single base polymorphic base. In general, the stability of the duplex formed by hybridization tends to be determined by the agreement of terminal sequences, so that a probe having a base complementary to a single base polymorphic base at the 3'-terminal or 5'- Such a duplex can be disassembled under stringent conditions. Suitable conditions for hybridization include, but are not limited to, Nucleic Acid Hybridization, A Practical Approach, Hayes, BD, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, IRL Press, Washington, DC (1985). ≪ / RTI > The stringent condition used for hybridization can be determined by controlling the temperature, the ionic strength (buffer concentration) and the presence of a compound such as an organic solvent, and the like. This stringent condition can be determined differently depending on the sequence to be hybridized.

In one embodiment, identification of the gene composition may be performed by an allele-specific gene amplification method. When a single nucleotide polymorphism is applied to the gene amplification method, it is collectively referred to as SNAP (single nucleotide amplified polymorphism).

As used herein, the term "primer" refers to a single strand of oligonucleotides, suitable conditions (presence of four different nucleoside triphosphates and a polymerase such as a DNA or RNA polymerase) Quot; means acting as a starting point from which template-directed DNA synthesis can be initiated under suitable buffers. The suitable length of the primer is determined by the characteristics of the primer to be used, but is usually 15 to 30 bp in length. The primer need not be exactly complementary to the sequence of the template, but should be complementary enough to form a hybrid-complex with the template.

Amplification techniques that can be used in the present invention include PCR amplification (Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822)), ligase chain reaction (LCR, Wu, DY et al. (Genomics 4: 560 (1989)), polymerase ligase chain reaction (Barany, PCR Methods and Appl., 1: 5-16 (1991)), Gap-LCR (WO 90/01069) 439,182), 3SR (Kwoh et al., PNAS, USA, 86: 1173 (1989)) and NASBA (US Pat. No. 5,130,238). Most preferably, it is amplified according to the PCR amplification step.

Here, the size of the polynucleotide is limited to 10 to 200 bp, which is preferably limited to represent technical specificity at a reproducible level by the current hybridization technique, and the degree to which the single nucleotide polymorphism can be identified It can be used as a size outside the above range depending on the technique used.

In addition, the gene composition for predicting pork meat quality according to the present invention may include other single base polymorphism types having proven statistical significance with the pork meat quality other than the single base polymorphism disclosed in the present invention. The statistical significance, And can be used in various combinations for improving accuracy and the like.

According to another aspect of the present invention, a microarray for predicting meat quality of pork containing the gene composition may be provided.

Here, the microarray may include a polynucleotide for recognizing the nucleotide sequence of the single nucleotide polymorphism, as well as a polypeptide encoded by the nucleotide sequence or cDNA of the polynucleotide, .

According to various embodiments of the present invention, the material for detecting the single base polymorphism is not limited to nucleic acids. A variety of biological techniques may be used, including polypeptides, proteins, other nucleic acids or modifications of proteins that recognize a particular sequence of nucleic acid.

According to another aspect of the present invention, a kit for predicting meat quality of pork containing the gene composition may be provided. The kit may further comprise a gene composition of a component capable of selectively detecting the single nucleotide polymorphism, as well as a container or accessory device capable of facilitating such detection more easily and rapidly.

According to another aspect of the present invention, when the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 is GG, it has higher conductance than that of AA and GA, and in the case of AA and GG, Has a higher brightness and has a higher yellowness in the case of AA, GA and GG, and a higher moisture content in case of GA and GG than that of AA; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 2 is GG, it has higher conductance than those of CC and GC. When the genotype is CC and GG, it has higher brightness than GC. GC and GG, and, if GC and GG, have a higher water content than CC; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 3 is AA, it has a higher conductance in the case of GA and GG and has higher yellowness and fat content in the case of GG in case of AA and GA, GA, it is determined that it has a higher moisture content in the case of AA and GG; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 4 is AA, it has higher conductance than that of GA and GG, and has higher yellowness and fat content than that of AA and GA in case of GG, , It is determined to have a higher water content in the case of AA and GG; When the genotype of the 101st locus in the nucleotide sequence shown in SEQ ID NO: 5 is GG, it has higher conductance than that of AA and GA, and in case of AA, it has higher brightness and yellowness than GA and GG, And GG, it is determined that it has a higher moisture content than when it is AA; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 6 is TT, it has a higher conductance than those of CC and TC. When CC is TC, it has higher brightness and yellowness than TC and TT, And TT, it is determined to have a higher moisture content than that in case of CC; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 7 is TT, it has a higher conductance than that of CC and TC. When CC is TC, it has higher yellowness than TC and TT. , It is determined that the water content is higher than that in the case of CC; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 8 is CC, it has a higher conductance than TC and TT. In case of TT, CC and TC have higher yellowness than CC and TC , It is determined to have a higher water content than that in the case of TT; When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 9 is TT, it has a higher conductance than those of CC and TC. When CC is TC, it has higher yellowness than TC and TT. , A method of predicting the meat quality of pork can be provided, which is judged to have a higher water content than that of the case of CC.

According to another aspect of the present invention, when the single-phase form of the single base polymorphism to the 101st flank of the nucleotide sequence shown in SEQ ID NOs: 1 to 9 is GGAAGTTCT single phase type, it has higher conductance and moisture content than the single- , GGAAGTTCT If it is not a single-phase type, a method of predicting meat quality of pork can be provided which is judged to have a high yellowness.

The term "haplotype " as used herein refers to a set of single nucleotide polymorphisms statistically associated on the same chromosome, and is a set of adjacent single nucleotide polymorphisms that tend to be inherited together on the same chromosome. For example, the number of possible single-phase polymorphisms of a single nucleotide polymorphism for a total of nine SNP loci is 512, but the number of single-phase phenotypes actually observed may be less than that, and among the observed single- The number of single-phase forms with statistical significance may be limited.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1. Development of single nucleotide polymorphism derived from FSD2 gene for pork meat quality prediction

(1) Disclosure materials

All disclosed pigs used in the examples of the present invention are Berkshire varieties purebred pig, which is a paternal strain, totaling 704 pigs produced in a domesticated piglet located in Namwon, Jeonbuk. Pigs were reared under the same conditions and slaughtered when the average body weight reached about 110 kg, and FSD2 gene mutation frequency analysis and associated trait analysis were performed.

Other meat quality traits except backfat thickness (BF) measured between 10th and 11th vertebrae after slaughter were measured using sirloin tissue. The carcass weight (CWT) was measured after slaughter except for the head, internal organs, legs and leather parts. The acidity of the carcass weight (pH ^* K21, NWK-Binar GmbH Co., Germany). The water holding capacity (WHC) was measured by measuring the weight of the juice adsorbed on the filter paper by standing on the cut face of the fillet for 5 minutes and then adsorbing the juice on the cut surface with a 5 cm diameter filter paper (Whatman No. 5) The juice loss (Driploss) was measured by measuring the weight and the weight of the first liquor after 24 hours at 4 ℃ after cutting the outside air into the zipper pack. The heat loss was measured by heating the deep portion temperature of the fillet at 75 ° C for 10 minutes and then cooling to reduce the weight. The meat color was measured by measuring the CIE (Commision Internationale de Leclairage) brightness (L), redness (a), and yellowness (b) values with a color intensity meter (Minolta Co. CR 300, Respectively. The standard plates used were white tiles with Y = 92.40, x = 0.3136, y = 0.3196. Shearing force (SF) was measured using a Warner-Bratzler shear force meter (GR Elec. Mfg. Co., USA) to objectively analyze the year of ingestion. The water content, fat content, protein content and collagen content were measured according to the method provided by the American Chemical Society.

Table 1 below shows the mean, standard deviation, minimum value and maximum value of each trait for a total of 666 pigs of the Berkshire variety used as disclosure material.

characteristics Average Standard Deviation Minimum value Maximum value CWT (kg) 85.98 5.51 71 105 pH 24 5.77 0.19 5.37 6.72 WHC (%) 58.40 3.38 50.13 67.82 Drip loss (%) 4.43 1.91 12.30 14.38 Heat loss (%) 26.51 4.16 12.30 39.02 MC_L 48.49 2.75 38.00 57.68 MC_a 6.26 1.04 3.40 9.62 MC_b 3.14 1.21 0.33 6.85 BF (mm) 25.10 5.20 12 41 SF (kg / 0.5 inch ² ) 3.08 0.80 1.45 6.14 Moisture (%) 75.17 1.12 69.98 77.57 Fat (%) 2.67 1.18 0.42 10.15 Protein (%) 23.76 0.88 20.95 26.24 Collagen (%) 0.89 0.13 0.53 1.39

(2) DNA extraction from tissue

DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the protocol provided. About 20 mg of the sirloin tissue was cut and placed in a 1.5-ml tube. After finely chopping, 600 μl of Nucleic Lysis Solution and 20 μl of Proteinase K were added, vortexed and allowed to dissolve the cells in a 55 ° C water bath for 1 hour. During the interval, he did bore texting every 20 minutes. After incubation, the mixture was cooled on ice for 3 minutes, then 3 μl of RNaseA (20 mg / ml) was added, and the mixture was placed in a 37 ° C incubator for 15 minutes. After cooling for 10 minutes at room temperature, 200 μl of protein precipitation solution was added, followed by vigorous boiling for 20 seconds, cooling on ice for 5 minutes, and centrifugation at 13,000 rpm for 6 minutes. The supernatant was transferred to a fresh 1.5 ml tube, inverted by adding 600 [mu] l of isopropanol and centrifuged at 13,000 rpm for 6 min. The supernatant was discarded except for the pellet, 1 ml of 70% ethanol was added, and the solution was changed 10 times and centrifuged at 13,000 rpm for 6 minutes. The supernatant was discarded and dried at room temperature. Then, 200 μl of sterilized distilled water was added and the concentration and quality were measured using Nano Drop ND-1000 Spectrophotometer V3.7 (Themo Scientific, USA). The extracted DNA was stored at -20 ° C in a freezer until it was used at 50 ng / μl.

RNA was isolated from a male ruderollis in a total of 18 tissues (cerebrum, cerebellum, pituitary, hypothalamus, sirloin, liver, stomach, lung, heart, spleen, kidney, appendix, duodenum, large intestine, rectum, ) Were extracted and extracted with Trizol reagent. The extracted RNA was synthesized by using a random hexamer and SuperScript III (Invitron).

(3) Identification of the structure of the pig FSD2 gene

In the process of confirming the coding DNA information (CDS) of the pig FSD2 gene, there is an unexplained part in the porcine genome sequence (Ensembl database, 7: 57,653,600-57,679,877) revealed to date and the exon region of the correct porcine FSD2 gene I could not define it. Therefore, in order to improve the perfection of the present invention, the primers shown in Table 2 below were prepared on both sides of the non-detoxification area in a Korean traditional pig BAC (bacterial artificial chromosome) gene bank possessed by the National Livestock Academy of Rural Development Administration, Clones were selected.

Type of primer order product
Size (bp) Usage Forward Reverse FSD2_mRNA1 AAGCTGCGGATGTCTTCTGT TCATGTACACTGCACGCTCA 875 cDNA sequencing FSD2_mRNA2 AGCTCACCTGAGAAGGACCA GTGTGTCTCATGCACCAGGA 740 FSD2_mRNA3 GTGGAGGTGGACGAGTGTTT CTTGCGGTCTCAGGGTCTGTT 781 FSD2_gDNA1 AAAAATTGTGGATGAGTTGAGC TCATATCCTCCCTACACCCTTG 903 Exon 2 SNP
genotyping FSD2_gDNA2 TGCCAGCAGAGAAAGCAGTA CCTACTCTGGCCACAACCAT 738 Exon 4 SNP
genotyping FSD2_gDNA3 GAGCGGCTCAAGAAAAACAC ACGAATCCGAGTAGGAACCA 542 Exon 6 SNP
genotyping FSD2_upper GGGTGAGACATGGCTGATTT CATGAGGCACAAAAGCTGAA 259 BAC Screening FSD2_lower CAGAGCCCCAGAGTCATCAACT CGACTCTGAGGAGAGGAGGA 210 FSD2_mRNA1 AAGCTGCGGATGTCTTCTGT TCATGTACACTGCACGCTCA 875 Tissue-specific
qPCR Porcine_GAPDH GCAAAGTGGACATTGTCGCC TCCTGGAAGATGGTGATGGC 160

BAC DNA was extracted from the selected BAC clone KNP-346F01 using a Large Construction Kit (Qiagen). The extracted BAC DNA was randomly sequenced using GS Junior pyrosequencer (Roche Diagnostic), and the combination was completed using Newbler's de novo assembler program to obtain a single 132,448 base pair information. The combination of the 15 EST information of NCBI (BF193397, FS678702, BX671727, DT333101, EW306575, EW242042, EW511269, EW410997, DY416136, FS682916, BX671726, DY419298, EW308607, BX925930, EW308615) of the completed KPN-346F01 clone sequence, The exon region of the FSD2 gene was defined (see Figure 1).

(4) Primer production and gene amplification

Mutations in the exon region were searched to explore gene mutations that could alter the predicted function of the FSD2 gene. A total of 120 Burkholder pig cDNAs were used, amplified using the primers shown in Table 2 above, and sequenced by sequencing. The nucleotide sequence was decoded using ABI PRISM 3730 Genetic Analyzer (Life Technologies). Detection results were combined using the SeqMan program in the LasStar 7 package from DNASTAR and found mutations. A total of ten single nucleotide polymorphisms (SNPs) were found in the exon region through primary genotype analysis (see FIG. 1 and Table 3).

SNP domain genotype Number frequency Allele frequency g.-26G / A 5'-UTR GG 104 0.15 GA 337 0.5 A (0.60) AA 232 0.34 G (0.40) total 673 One g.-15G / C 5'-UTR GG 106 0.16 GC 337 0.5 C (0.59) CC 231 0.34 G (0.41) total 674 One g.102G / A exon2 GG 297 0.44 GA 312 0.46 A (0.33) AA 66 0.1 G (0.67) total 675 One g.124G / A exon2 GG 298 0.44 GA 311 0.46 A (0.33) AA 66 0.1 G (0.67) total 675 One g.134G / A exon2 GG 105 0.16 GA 337 0.5 A (0.59) AA 233 0.35 G (0.41) total 675 One g.290T / C exon2 TT 104 0.15 TC 338 0.5 C (0.60) CC 233 0.35 T (0.40) total 675 One g.594T / C exon2 TT 104 0.15 TC 338 0.5 C (0.60) CC 233 0.35 T (0.40) total 675 One g.3662T / C exon4 TT 232 0.34 TC 348 0.51 C (0.40) CC 100 0.15 T (0.60) total 680 One g.3824T / C exon4 TT 102 0.15 TC 338 0.5 C (0.60) CC 237 0.35 T (0.40) total 677 One g.6756G / A exon6 GG 297 0.47 GA 287 0.46 G (0.70) AA 46 0.07 A (0.30) total 630 One

In order to confirm the polymorphism of the detected mutations, PCR direct sequence sequencing was performed on the genomic DNA of a total of 704 Berkshire individuals using the primers shown in Table 2 above.

20 μl of the gene amplification reaction was mixed with 1 μl of 50 ng / μl DNA, 2 μl of each primer, 1 μl of 10 mM dNTPs mix, 2 μl of 10 × reaction buffer, HS Taq DNA Polymerase (Genet Bio, Chungnam , Korea) was added to the reaction mixture, and the reaction mixture was amplified using a gene amplifier (MJ research PCR, PTC-240, USA). The amplification reaction conditions were preliminarily denatured at 94 ° C for 10 minutes, followed by denaturation at 94 ° C for 30 seconds, binding at 60 ° C to 63 ° C for 30 seconds, and reaction at 72 ° C for 1 minute. Min. The PCR product was electrophoresed using 1% agarose gel, and amplification was confirmed on UV using a gel image analyzer.

(5) Statistical analysis

For the analysis of the genotypes and polymorphisms of 10 single nucleotide polymorphisms in 704 polymorphisms used in the analysis, two-step analysis was performed using the SAS9.2 PROC GLM (generalized linear model) procedure (Statistical Analysis System, USA) Respectively. Factors affecting the phenotype were applied to the general linear model as follows.

General linear model (GLM): Y = Xb + e

Here, X = vector including fixed effects and covariance for each trait, b = fixed effect and covariance effect for each trait, e = random error,

In the given model, the slaughter date was corrected to covariance as a fixed effect for sire and sex for all traits. Regression analysis model was applied to analyze the marker effect that affects each trait for each model set by Least Squares (LS).

Model: y = μ + xb + addi + doi + e

Here, μ = total mean for each trait, b = fixed effect and covariance effect for each trait, addi = additive effect of i-th single nucleotide polymorphism with fixed effect, doi = fixed effect, Dominant effect of polymorphism, e = random error,

(6) Trait association analysis of single nucleotide polymorphisms in the pig FSD2 gene

In the analysis, paternal and sex were used as fixed factors, and the slaughter timing was covariance. The additive and dominant effects of each variant were fixed according to the regression variable by replacing the AA, AB, and BB genotypes with 1, 0, -1 and 0, 1, and 0, respectively. Among the 10 exon mutations, two single nucleotide polymorphisms (g.-26G / A and g.-15G / C, respectively at position 101 in the nucleotide sequence shown in SEQ ID NOs: 1 and 2) (G.90G / A, g.134G / A, g.290T / C, g. 594T / C, g. 362T / C, g. 3824T / C and g. 6756G / A, respectively at position 101 in the nucleotide sequence shown in SEQ ID NOS: 3 to 10) were located in the coding sequence (CDS) region.

As shown in the following Table 4, 9 SNPs (the 101st locus in the nucleotide sequence shown in SEQ ID NOs: 1 to 9) in the porcine FSD2 gene have statistically significant correlation with meat color, moisture content and fat content in the carcass of pork .

SNP Traits Genotype P-value AA GA GG g.-26G / A CWT 86.15 0.6 86.67 0.53 88.22 0.68 0.0086 ** MC_L 49.56 0.31 48.95 0.27 49.38 0.35 0.0362 * MC_B 3.38 0.11 3.08 0.1 3.15 0.13 0.0037 ** Moisture 75.39 0.1 75.64 0.09 75.6 0.12 0.0083 ** CC GC GG g.-15G / C CWT 86.13 0.6 86.72 0.53 88.1 0.68 0.0129 * MC_L 49.58 0.31 48.96 0.27 49.34 0.35 0.036 * MC_B 3.38 0.11 3.09 0.1 3.13 0.13 0.0054 ** Moisture 75.4 0.1 75.63 0.09 75.61 0.12 0.0162 * AA GA GG g.102G / A CWT 88.11 0.8 86.9 0.53 86.25 0.58 0.042 * MC_B 3.18 0.15 3.08 0.1 3.3 0.11 0.0397 * Moisture 75.53 0.14 75.69 0.09 75.37 0.1 0.0003 *** Fat 2.51 0.15 2.44 0.1 2.69 0.11 0.0148 * AA GA GG g.124G / A CWT 88.12 0.8 86.9 0.53 86.26 0.58 0.0439 * MC_B 3.18 0.15 3.08 0.1 3.3 0.11 0.0453 * Moisture 75.53 0.14 75.69 0.09 75.38 0.1 0.0005 *** Fat 2.5 0.15 2.45 0.1 2.69 0.11 0.0185 * AA GA GG g.134G / A CWT 86.1 0.6 86.69 0.53 88.21 0.68 0.0069 ** MC_L 49.58 0.31 48.94 0.27 49.37 0.35 0.0301 * MC_B 3.38 0.12 3.08 0.1 3.14 0.13 0.0056 ** Moisture 75.4 0.1 75.64 0.09 75.6 0.12 0.0131 * CC TC TT g.290T / C CWT 86.1 0.6 86.68 0.53 88.25 0.68 0.0057 ** MC_L 49.58 0.31 48.97 0.27 49.31 0.35 0.0421 * MC_B 3.38 0.12 3.09 0.1 3.14 0.13 0.0057 ** Moisture 75.4 0.1 75.64 0.09 75.61 0.12 0.0133 * CC TC TT g.594T / C CWT 86.13 0.6 86.66 0.53 88.25 0.68 0.0065 ** MC_B 3.38 0.12 3.08 0.1 3.14 0.13 0.004 ** Moisture 75.39 0.1 75.64 0.09 75.6 0.12 0.0084 ** CC TC TT g.3662T / C CWT 88.06 0.71 86.74 0.53 85.86 0.61 0.0044 ** MC_B 3.13 0.13 3.03 0.1 3.32 0.12 0.0059 ** Moisture 75.61 0.12 75.65 0.09 75.42 0.11 0.0173 * CC TC TT g.3824T / C CWT 86.13 0.61 86.61 0.54 88.08 0.7 0.0144 * MC_B 3.31 0.12 3.03 0.1 3.11 0.13 0.0083 ** Moisture 75.4 0.11 75.66 0.09 75.62 0.12 0.0067 **

*: P &lt;0.05; **: P &lt;0.01; ***: P < 0.001

In addition, a PHASE 2.1.1 program was used for haplotype analysis of the single nucleotide polymorphism. As shown in the following Table 5, five haplotypes were formed, and the GGAAGTTCT single-phase type and the ACGGACCTC single phase type occupied 29.6% and 55.7% of the haplotypes, respectively.

No. haplotype frequency One GGGGGTTCT 0.065407 2 GGAAGTTTC 0.030665 3 GGAAGTTCT 0.295714 4 ACGGACCTC 0.557074 5 ACGGACCCT 0.036416

As shown in Table 6 showing haplotype-specific trait associations for nine SNPs in the pig FSD2 gene, the conductance was high in the GGAAGTTCT single-phase type and in the ACGGACCTC single phase type, while the GGAAGTTCT single- Respectively. In addition, high water content was exhibited in GGAAGTTCT single phase type and ACGGACCTC single phase type. Therefore, selection of individuals without GGAAGTTCT single-phase type and without ACGGACCTC single-phase type will be able to select individuals with high conductance and moisture content and low yellowness.

Haplotype 3 (GGAAGTTCT), Frequency: 0.295714 Traits 0 One 2 P-value (n = 317) (n = 278) (n = 53) CWT 86.17 0.58 86.73 0.55 88.34 0.88 0.0341 * Driploss 4.80 0.18 4.80 0.17 4.87 0.27 0.9590 pH 24 5.73 0.02 5.72 0.02 5.70 0.03 0.7851 WHC 58.08 0.24 57.86 0.23 58.23 0.37 0.4107 HeatLoss 26.21 0.44 25.72 0.42 25.78 0.67 0.3700 BF 24.71 0.50 25.35 0.47 25.45 0.76 0.2328 MC_L 49.31 0.30 48.93 0.28 49.20 0.45 0.2717 MC_B 3.29 0.11 3.00 0.10 3.03 0.17 0.0036 ** Moisture 75.42 0.10 75.69 0.09 75.54 0.15 0.0027 ** SF 3.16 0.07 3.13 0.06 3.14 0.10 0.8988 Fat 2.65 0.11 2.45 0.11 2.60 0.17 0.1030 Protein 24.02 0.08 24.04 0.07 24.1 0.12 0.7708 MC_A 5.99 0.11 5.88 0.10 6.14 0.16 0.1795 Collagen 0.89 0.01 0.89 0.01 0.90 0.02 0.7540 Haplotype4 (ACGGACCTC) Frequency: 0.557074 Traits 0 One 2 P-value (n = 113) (n = 346) (n = 189) CWT 87.58 0.67 86.69 0.55 85.79 0.64 0.0259 * Driploss 4.87 0.21 4.76 0.17 4.86 0.20 0.7673 pH 24 5.68 0.02 5.73 0.02 5.74 0.02 0.0279 * WHC 58.17 0.28 57.93 0.23 57.89 0.26 0.5743 HeatLoss 25.78 0.51 25.94 0.42 25.93 0.49 0.9369 BF 25.13 0.58 25.11 0.47 25.22 0.55 0.9675 MC_L 49.30 0.34 49.00 0.28 49.10 0.33 0.6394 MC_B 3.16 0.13 3.07 0.10 3.13 0.12 0.7362 Moisture 75.62 0.12 75.64 0.09 75.34 0.11 0.0022 ** SF 3.14 0.08 3.17 0.06 3.07 0.07 0.2607 Fat 2.45 0.13 2.54 0.11 2.65 0.12 0.2678 Protein 24.16 0.09 24.01 0.07 23.97 0.08 0.0829 MC_A 5.93 0.12 5.93 0.10 6.04 0.12 0.4574 Collagen 0.90 0.02 0.90 0.01 0.88 0.02 0.2195

*: P &lt;0.05; **: P < 0.01

Example 2: Production of a microarray containing a single nucleotide polymorphic gene composition for predicting meat quality of pork according to an embodiment of the present invention

A microarray comprising a single base polymorphic gene composition for predicting meat quality in an embodiment of the present invention was prepared by the following method.

A nucleotide consisting of 20 consecutive bases each consisting of a single nucleotide polymorphism at the 101st locus in the nucleotide sequence shown in SEQ ID NOs: 1 to 10, wherein the 10 kinds of single nucleotide polymorphisms correspond to the 11th Position) was fixed on the substrate. Since there are two alleles at a single base polymorphism, two polynucleotides are immobilized on the substrate for each sequence.

First, the N-terminal of each polynucleotide was substituted with an amine group and then spotted on a silylation slide (Telechem). The spotting buffer was washed with 2 x SSC (saline-sodium citrate, pH 7.0) Respectively. After spotting, the binding was induced by placing in a drier, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and third distilled water for 2 minutes to remove unbound oligos. The slide was treated for 2 min at 95 ° C to induce denaturation and then incubated with blocking solution (1.0 g NaBH ₄ , 300 ml PBS (pH 7.4), 100 ml EtOH) for 15 min, 0.2% SDS solution for 1 min , And then washed with tertiary distilled water for 2 minutes and dried at room temperature to prepare a microarray.

Example 3. Method for predicting meat quality of pork using the microarray according to an embodiment of the present invention.

The present inventors separated the target DNA from the blood of pigs for which the meat quality was to be predicted, and fluorescently labeled with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 and the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was carried out at 42 DEG C for 4 hours. Washed twice with 2 x SSC at room temperature for 5 minutes and then dried in air.

After drying, the slides were scanned with Scan Array 5000 (ScanArray 5000: GSI Lumonics) and the results were analyzed with QuantArray (GSI Lumonics) and ImaGene software (BioDiscover). From the above analysis results, the meat quality of the pork was predicted by confirming the genotype of the single base polymorph according to the present invention.

Therefore, as described above, the gene composition for predicting the meat quality of pork according to the present invention and the method for predicting the quality of pork using the same can be used to analyze the meat quality of the pork at the molecular level, As a predictable molecular marker, selection of breeds with improved meat quality is possible.

It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit of the invention as set forth in the appended claims. The present invention can be variously modified and changed by those skilled in the art, and it is also within the scope of the present invention.

                         SEQUENCE LISTING <110> RURAL DEVELOPMENT ADMINISTRATION   <120> Genetic composition of porcine FSD2 for predicting meat quality        of pork and predicting method of meat quality using thereof <130> NPF-25086 <160> 10 <170> PatentIn version 3.2 <210> 1 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 1 ataaccatct agtgcactga cctcagaaat ggggttttct gttctaggac ccaggatatc 60 tattaataac tgtccaaaaa gaaaccttcc tgtgcagagg ngctgccccg agcatccaga 120 gccacgatgg aagaggaagc aggtgaggcc ccggggctgg gcaggcccgc tgctcctaag 180 gatttccact tttatcacgt g 201 <210> 2 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or c <400> 2 gtgcactgac ctcagaaatg gggttttctg ttctaggacc caggatatct attaataact 60 gtccaaaaag aaaccttcct gtgcagaggg gctgccccga ncatccagag ccacgatgga 120 agaggaagca ggtgaggccc cggggctggg caggcccgct gctcctaagg atttccactt 180 ttatcacgtg gatctgtacg a 201 <210> 3 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 3 tggaagagga agcaggtgag gccccggggc tgggcaggcc cgctgctcct aaggatttcc 60 acttttatca cgtggatctg tacgactctg aagacagact ncagatcttc ccggaaggaa 120 acactcggat gcgaagagag gtagtccagg ctgaaatgac caacgaacca agagcagccg 180 tgaaagagaa ggctccgaga g 201 <210> 4 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 4 cccggggctg ggcaggcccg ctgctcctaa ggatttccac ttttatcacg tggatctgta 60 cgactctgaa gacagactgc agatcttccc ggaaggaaac nctcggatgc gaagagaggt 120 agtccaggct gaaatgacca acgaaccaag agcagccgtg aaagagaagg ctccgagaga 180 ccttgaagaa gaagtggatg a 201 <210> 5 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 5 ggcaggcccg ctgctcctaa ggatttccac ttttatcacg tggatctgta cgactctgaa 60 gacagactgc agatcttccc ggaaggaaac actcggatgc naagagaggt agtccaggct 120 gaaatgacca acgaaccaag agcagccgtg aaagagaagg ctccgagaga ccttgaagaa 180 gaagtggatg aacttgtcca t 201 <210> 6 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = t or c <400> 6 aaggctccga gagaccttga agaagaagtg gatgaacttg tccatcttta cggacttgaa 60 gatgatcatg aattaggcga tgcattcgtt gacgaaagca ngcccagaat agaggtttca 120 gagtatcctc cttatgggat gatggggaga gaagcagcca gggagcagag agactggaga 180 cttagcggcg aggaggctaa t 201 <210> 7 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = t or c <400> 7 gctacgtcat cccagaggag gaagacgagg atgaagctgc ggatgtcttc tgtgtcacct 60 gcaaaacacc agtcagagct ttggaggttt ctgatgaaca naaggaacat gaggtaaccc 120 cactccataa agcactggaa agtgccaagg taaatagatc tccttagttc ttcttgctct 180 tgatattgca tttctatctc a 201 <210> 8 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = t or c <400> 8 actctgtcgt gaacattcat acactgaaat gatggctgag gttgactatc ttgcaggaga 60 attttggaag acaagaacaa aactttgagt cacattacaa ngagatcttg gaaacacttg 120 ctcaaaaata cgaagaaaaa atacaagctc taggggagaa aaagaaagag aagctagaag 180 ccttgtatgg acaactggtc a 201 <210> 9 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = t or c <400> 9 agaaagagaa gctagaagcc ttgtatggac aactggtcag ctgtggagaa aatcttgata 60 cctgcaaaga actaatggaa acaatagagg agatgtgtca ngaagagaag gttgatttca 120 taaaggtcag tagcaaggag ttcccactgt ggtacaaagg gatcagagcg tctctgcagc 180 accaggacgc aggttcgatc c 201 <210> 10 <211> 201 <212> DNA <213> Sus scrofa <220> <221> misc_feature &Lt; 222 > (101) <223> n = g or a <400> 10 tcaaagttcg gccaagaggc cctctttgca ttatactagt gacccctcag gagagtgccc 60 ctccattctt gtcagtgtgt ctttttacac ccacagactc ngaaaattcc tgaaaacaaa 120 aacagatgtt gagatctcga cgcagcctga cttcgacgac cagactttgg acttttctga 180 tgtggagcag ctgatggact c 201

Claims (6)

A consecutive polynucleotide of 10 to 200 nucleotides each containing the 101 th locus in the nucleotide sequence of SEQ ID NO: 1 derived from a porcine FSD2 (fibronectin type III and SPRY domain containing 2) gene as a single nucleotide polymorphism, Polynucleotides;
A consecutive polynucleotide of 10 to 200 nucleotides each, or a complementary polynucleotide therefor, each of which contains a 101 base in the base sequence represented by SEQ ID NO: 2 derived from a porcine FSD2 gene as a single base polymorph;
A consecutive polynucleotide of 10 to 200 nucleotides each comprising a polynucleotide polynomial of the 101st position in the nucleotide sequence of SEQ ID NO: 3 derived from a porcine FSD2 gene, or a complementary polynucleotide thereof;
A consecutive polynucleotide of 10 to 200 nucleotides each, or a complementary polynucleotide therefor, each of which contains a 101 base in the nucleotide sequence of SEQ ID NO: 4 derived from a porcine FSD2 gene as a single nucleotide polymorphism;
A consecutive polynucleotide of 10 to 200 nucleotides each, or a complementary polynucleotide therefor, each containing a 101 base position in the nucleotide sequence of SEQ ID NO: 5 derived from a porcine FSD2 gene as a single base polymorphism;
A consecutive polynucleotide of 10 to 200 nucleotides each comprising a polynucleotide polynomial of the 101st position in the nucleotide sequence of SEQ ID NO: 6 derived from a porcine FSD2 gene, or a complementary polynucleotide thereof;
A consecutive polynucleotide of 10 to 200 nucleotides each, or a complementary polynucleotide therefor, each of which contains a 101 base in the nucleotide sequence of SEQ ID NO: 7 derived from a porcine FSD2 gene as a single nucleotide polymorphism;
A consecutive polynucleotide of 10 to 200 nucleotides each, or a complementary polynucleotide therefor, each of which contains the 101 th locus in the nucleotide sequence of SEQ ID NO: 8 derived from the porcine FSD2 gene as a single nucleotide polymorphism; And
A consecutive polynucleotide of 10 to 200 nucleotides each comprising a polynucleotide of the 101st position in the nucleotide sequence of SEQ ID NO: 9 derived from a porcine FSD2 gene, or a complementary polynucleotide thereof; Wherein the polynucleotide comprises at least one polynucleotide selected from the group consisting of:
The method according to claim 1,
Wherein the meat quality of the pork is predicted by at least one selected from among carcasses, meat color, moisture content and fat content.
7. A microarray for predicting meat quality of pork comprising the gene composition according to claim 1 or 2.
A kit for predicting meat quality of pork comprising the gene composition according to claim 1 or 2.
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 1 derived from the porcine FSD2 gene is GG, it has higher conductance than that of AA and GA, and in the case of AA and GG, AA, GA and GG, GA and GG, and AA, respectively.
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 2 derived from the porcine FSD2 gene is GG, it has a higher conductance than those of CC and GC, and in case of CC and GG, CC, GC and GG, and, if GC and GG, has a higher water content than CC;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 3 derived from the porcine FSD2 gene is AA, it has higher conductance than that of GA and GG. In case of GG, And if it is a GA, it is determined that it has a higher moisture content than that of AA and GG;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 4 derived from the porcine FSD2 gene is AA, it has higher conductance than that of GA and GG. In case of GG, , And if it is a GA, it is determined that it has a higher moisture content than that of AA and GG;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 5 derived from the porcine FSD2 gene is GG, it has higher conductance than that of AA and GA. In case of AA, a higher brightness and yellowness Determining that the water content is higher than that in case of GA and GG;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 6 derived from the porcine FSD2 gene is TT, it has higher conductance than those of CC and TC. When CC is TC, it has higher brightness and yellowness , And if it is TC and TT, it has a higher moisture content than in the case of CC;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 7 derived from the porcine FSD2 gene is TT, it has a higher conductance than those of CC and TC, and in CC, it has a higher yellowness in the case of TC and TT , &Lt; / RTI &gt; if TC and TT, has a higher moisture content than when it is CC;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 8 derived from the porcine FSD2 gene is CC, it has a higher conductance than that of TC and TT, and in case of TT, it has a higher yellowness in the case of CC and TC , &Lt; / RTI &gt; CC and TC, it is determined that it has a higher moisture content than in the case of TT;
When the genotype of the 101st locus in the nucleotide sequence of SEQ ID NO: 9 derived from the porcine FSD2 gene is TT, it has a higher conductance than that of CC and TC, and in CC, it has a higher yellowness in the case of TC and TT , &Lt; / RTI &gt; if TC and TT, has a higher moisture content than when it is CC; &Lt; / RTI &gt; wherein the method comprises at least one step selected from the group consisting of:
The haplotype of the single base polymorphism of the following Table 5 relative to the 101st locus from the nucleotide sequence of SEQ ID NOS: 1 to 9 derived from the porcine FSD2 gene was higher than that of the GGAAGTTCT single-phase type, And water content, and not GGAAGTTCT single-phase, GAAGTTCT is determined to have higher yellowness than single-phase.

Images