KR20140072230A - Genetic marker for diagnosis of muscle fiber type within porcine muscle and diagnosis method using the same - Google Patents

Abstract

The present invention relates to a genetic marker for diagnosis of a porcine muscle fiber type and a diagnosis method using the same. More specifically, provided are a genetic marker for diagnosis of a muscle fiber type, which is one of porcine meat traits, by using single nucleotide polymorphism (SNP) in the 5′ control domain of a myosin heavy chain 4 (MYH4); a method for diagnosis of a muscle fiber type by using the generic marker. It is possible to interpret a muscle fiber type, which is one of porcine meat traits at a molecular biological level by using the genetic marker for diagnosis of a porcine muscle fiber type according to the present invention. The genetic marker of the present invention can be used as a molecular marker, which can diagnose a porcine muscle fiber type, in improving porcine meat by diagnosing the muscle fiber type which is closely related to selecting breeding pig and porcine meat.

Description

[0001] The present invention relates to a genetic marker for diagnosing swine fibrosis,

The present invention relates to a genetic marker for diagnosing porcine muscle fiber form and a diagnostic method therefor. More particularly, the present invention provides a gene marker for diagnosing myofibroblast, one of the meat quality traits of pigs, using SNPs present in the 5 'regulatory region of MYH4 (Myosin heavy chain 4) gene, And to a method for diagnosing myofibroblastic morphology.

Recent developments in molecular genetic techniques have led to the development of genetic markers that are associated with specific traits, such as genetic disease at the DNA level or meat quality of livestock. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTL) that determine important economic traits and include linkage analysis, genetic maps, parentage testing has been used as a powerful tool to analyze distinction of breeds, pedigree analysis, genetic diversity and relationship. Especially in the field of genetic and breeding of livestock, it is used for marker assisted selection (MAS) through genetic markers based on DNA polymorphism.

Most economic traits in livestock are known to be quantitative traits due to the influence of various genes, and studies are being actively conducted to search for genetic loci and genetic loci involved in these traits. Especially, in order to discover the gene related to the trait, a single nucleotide polymorphism (SNP) and trait related researches have been actively carried out on functional genes. Various trait related SNPs have been discovered to date.

If the SNP affects the phenotype and the meat quality or fat-related traits of the pig vary, the SNP may be used as a marker for effect on the meat or meat-related traits of the pig. Genomic maps often reveal the presence of SNPs, but there are also SNPs that have not yet been discovered, and there are many cases where the SNPs that have been discovered have not been studied for their effect on phenotypes.

In the related art, Korean Patent Laid-Open Publication No. 2002-0065103 and No. 2012-0067941 exist. However, in the prior art, the gene in which the gene marker exists is PPARG1A (peroxisome proliferator-activated receptor-gamma coactivator-1) The target gene in which the present invention and the gene marker are present is different.

Korea Patent Publication No. 2012-0065103 Korean Patent Publication No. 2012-0067941

Under these technical backgrounds, the present inventors have made intensive efforts to develop genetic markers for diagnosing porcine muscle fiber form and a diagnostic method therefor.

Finally, it is an object of the present invention to provide a genetic marker for the diagnosis of porcine myofiber.

Another object of the present invention is to provide a composition for diagnosing porcine muscle fiber form.

It is another object of the present invention to provide a microarray for diagnosing swine muscle fiber form.

It is a further object of the present invention to provide a kit for the diagnosis of porcine myofiber.

It is still another object of the present invention to provide a method for diagnosing porcine muscle fibrosis type using the gene marker.

According to one aspect of the present invention, in the nucleotide sequence shown in SEQ ID NO: 1, there can be provided a genetic marker for porcine muscarinic forms consisting of 10 to 100 consecutive bases containing a base at the -1398th SNP position.

According to another aspect of the present invention, there is provided a polynucleotide comprising a polynucleotide consisting of 10 to 100 consecutive bases or a complementary polynucleotide thereon in the nucleotide sequence shown in SEQ ID NO: 1, A composition for diagnosing swine fibrosis form can be provided.

According to another aspect of the present invention, there is provided a microarray for diagnosing porcine myofascial form comprising the polynucleotide or a complementary polynucleotide for the polynucleotide.

According to another aspect of the present invention, there is provided a kit for diagnosing porcine myofascial form comprising a polynucleotide or a complementary polynucleotide therefor.

According to another aspect of the present invention, in the nucleotide sequence shown in SEQ ID NO: 1, when the -1398th SNP position is the TT genotype, the expression amount of the porcine myxoid type IIa is determined to be lower than that of the GG and GT genotype A method for diagnosing a type of swine fibrosis can be provided.

Using the genetic markers for the diagnosis of porcine myofiber according to the present invention, it is possible to analyze at the molecular level the myofiber form, one of the meat quality traits of pigs, as a molecular marker capable of diagnosing the shape of muscle fibers of pigs It can be used to improve the meat quality of pork by diagnosing the shape of muscle fiber which is closely related with the selection of breed and the meat quality of pork.

Brief Description of the Drawings Fig. 1 is a graph showing the SNPs (g.-1398G > T) present in the MYH4 gene of pigs It is an electropherogram.
FIG. 2 shows gene expression levels of SNPs (g.-1398G > T) in the MYH4 gene of pigs by genotype.

Hereinafter, the present invention will be described in more detail.

The term "nucleotide" or "polynucleotide ", as used in the description of the present invention, is a deoxyribonucleotide or ribonucleotide present in single- or double-stranded form and includes analogs of natural nucleotides, (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90: 543-584 (1990)).

As used in the detailed description of the present invention, the term "probe" means a linear oligomer with a natural or modified monomer or linkage comprising a deoxyribonucleotide and a ribonucleotide that can hybridize to a particular nucleotide sequence. Preferably, the probe is single stranded for maximum efficiency in hybridization. The probe is preferably a deoxyribonucleotide.

The term "single nucleotide polymorphism " (SNP), as used in the description of the present invention, is a single base-pair variation in DNA between individuals of the same species, It is an existing form. SNPs present in the transcriptional regulatory sequences such as the promoter can regulate the amount of the gene being expressed and can be used to determine the presence of nucleotide sequences at the exon-intron boundaries that affect RNA splicing, SNPs may affect RNA stability or translation performance.

As used in the description of the present invention, the term "muscle fiber" is a fibrous cell having shrinking property as a unit constituting muscle, and forms a hierarchical structure.

Muscle fiber in pigs is divided into three types according to the type of myosin-heavy chain that is responsible for ATPase activity (Brooke and Kaiser, 1970). In the case of muscle fiber type I, it is slowoxidative, which slows down the post-metabolism rate and has a positive effect on meat quality. On the contrary, type II b (type IIb) (Pale, soft, exudative; PSE), which is characterized by fast-glycolytic properties and rapid parenteral metabolism. ) Or more (Klont et al., 1998). The other type IIa (type IIa) has the property of slow-glycolytic, which is an intermediate property between the two. Muscle fiber composition is determined according to these three types of muscle fiber type, and the longissimus dorsi of pig is mostly white muscle root type and the ratio of type II b is about 80%.

As used in the detailed description of the present invention, the term MYH4 gene refers to the Myosin heavy chain 4 gene, which is one of the genes expressing the myosin heavy chain isoform, There is a connection.

As used in the detailed description of the present invention, the meat quality of pigs is graded according to pH, color, intramuscular fat, fat color, texture, maturity, etc. Especially, pH and meat color are the meat quality of pork It is an important criterion for representing Since the price of pork has recently surged, it is important to develop high quality meat with high quality by selecting pigs with excellent meat quality, breeding and producing them. Therefore, using the gene markers of the present invention, And it is possible to easily select the high quality meat with improved meat quality by excluding it from the sorting of the seeds.

According to one aspect of the present invention, in the nucleotide sequence shown in SEQ ID NO: 1, there can be provided a genetic marker for porcine muscarinic forms consisting of 10 to 100 consecutive bases containing a base at the -1398th SNP position.

The present inventors have found SNPs related to muscle fiber composition in pigs in the 5 'regulatory region of MYH4 gene shown in SEQ ID NO: 1 and analyzed the relationship between SNPs and muscle fiber composition in pigs. The gene marker includes, as part of the sequence of the MYH4 gene of pigs, a SNP site in which a base is substituted with G or T at a specific site (position -1398 position in the nucleotide sequence shown in SEQ ID NO: 1).

In the case of using a gene marker having a statistical correlation with the amount of myxobasia type IIa according to the present invention, it is possible to produce meat with excellent meat quality, It is possible to select a breed.

More specifically, as the -1398 th SNP position in the nucleotide sequence shown in SEQ ID NO: 1 is substituted from G to T, the expression of the gene, that is, the expression of the MYH4 gene is differentiated. As a result, Is reduced. Thus, the expression of MYH4 gene and the ratio of muscle fiber type IIa were found to have a negative correlation. As a result, muscle fiber type Ⅱ a is decreased in the genotype TT type, thereby affecting meat quality improvement.

According to another aspect of the present invention, there is provided a polynucleotide comprising a polynucleotide consisting of 10 to 100 consecutive bases or a complementary polynucleotide thereon in the nucleotide sequence shown in SEQ ID NO: 1, A composition for diagnosing swine fibrosis form can be provided.

The polynucleotide or complementary polynucleotide for the polynucleotide is a polymorphic sequence including a -1398th polymorphic site in the nucleotide sequence of SEQ ID NO: 1, and the polynucleotide of the present invention is DNA or RNA.

Preferably, the polynucleotide for swine muscle fiber type diagnosis comprising the base at the SNP position according to the present invention or the complementary polynucleotide for them is composed of at least 10 consecutive bases. In particular, in the case of 15 to 30 bases, it can be used as a probe or a primer for detecting the SNP, and in the case of a base having a larger size, it can be used for detecting by the PCR_RFLP method.

Polynucleotides for the diagnosis of porcine muscle fiber type comprising the SNPs according to the present invention or polynucleotides that specifically hybridize with complementary polynucleotides thereto are allele-specific polynucleotides.

The term " allele-specific polynucleotide " refers to hybridizing specifically to each allele, and specifically refers to hybridizing the polynucleotide so that the base of the polymorphic site can be specifically discriminated.

The present invention also relates to a polynucleotide consisting of 10 to 100 consecutive bases comprising a base at the -1398th SNP position in the nucleotide sequence of SEQ ID NO: 1 for the preparation of a microarray or kit for the diagnosis of porcine myofiber, The present invention provides the use of a composition for diagnosing porcine musculoskeletal shape comprising complementary polynucleotides for these.

According to another aspect of the present invention, there is provided a microarray for diagnosing porcine myofascial form comprising the polynucleotide or a complementary polynucleotide for the polynucleotide.

The microarray may comprise DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Methods for producing microarrays by immobilizing probe polynucleotides on a substrate are well known in the art. The term "probe polynucleotide" refers to a polynucleotide capable of hybridization, and refers to an oligonucleotide capable of specifically binding to a complementary strand of a nucleic acid. Such probes include peptide nucleic acids as described in Nielsen et al., Science, 254, 1497-1500 (1991). The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions must be sufficiently stringent to hybridize to only one of the alleles, showing significant differences in the hybridization intensity between alleles. This can lead to significant hybridization differences between different allelic forms.

Immobilization on the substrate of the probe polynucleotide associated with porcine myofiber form diagnosis of the present invention can also be easily prepared using this conventional technique. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. The detection may be performed by marking with a labeling substance capable of generating a detectable signal including a fluorescent substance such as Cy3 or Cy5, and then hybridizing on the microarray and detecting a hybridization result by detecting a signal generated from the labeling substance .

According to another aspect of the present invention, there is provided a kit for diagnosing porcine myofascial form comprising a polynucleotide or a complementary polynucleotide therefor.

The pig muscle fiber type diagnostic kit can be produced by a conventional method known to those skilled in the art. The kit may contain, in addition to the polynucleotide of the present invention, a reagent necessary for the polymerization reaction, for example, dNTP, various kinds of polymerase and coloring agent.

According to another aspect of the present invention, in the nucleotide sequence shown in SEQ ID NO: 1, when the -1398th SNP position is the TT genotype, it is judged that the ratio of the porcine myofiber type IIa is lower than that of the GG and GT genotype A method for diagnosing a type of swine fibrosis can be provided.

There is no particular limitation on the method for identifying the single nucleotide polymorphism, and a method commonly used in the art can be used. Specifically, SNP analysis can be performed using PCR as in the embodiment of the present invention, or through determination of the nucleotide sequence of a direct nucleic acid by the dideoxy method, or a probe containing a sequence of a SNP site or A nucleotide sequence of a polymorphic site can be determined by hybridizing a complementary probe with the DNA and measuring the degree of hybridization obtained therefrom, or an allele-specific probe hybridization method, an allele-specific amplification method Specific amplification, sequencing, 5 'nuclease digestion, molecular beacon assay, oligonucleotide ligation assay, size analysis method, size analysis and single-stranded conformation polymorphism, And the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. It should be understood, however, that these examples are for illustrative purposes only and are not to be construed as limiting the scope of the present invention.

Example 1

Disclosed animal and trait investigation

A total of 117 pigs of 5 varieties (Landrace, Yorkshire, Durok, Berkshire, and Native pigs) were used to identify SNPs in the 5 'regulatory region of MYH4 gene. 40 kelp seeds, 93 female kelp seeds) were used. All pigs were raised on the same farm through the same specification until their average weight was 110 kg.

The pigs were slaughtered according to Korean standard procedures. As reported previously, the characteristics of myofibers were obtained after 45 minutes of post-mortem examination at the eighth vertebrae (Kim et al., 2010). The morphology of the muscle fibers was confirmed by histochemical analysis of each sample, and the analysis of the general components of meat was carried out at the same time.

SNP discovery and genotyping

Genomic DNA was isolated from the EDTA-treated blood samples using a DNA isolation kit (Promega), and the genomic DNA was amplified by PCR using the primers shown in Table 1 below, in the size of about 2 kb of the porcine MYH4 5 'regulatory region for SNP digestion PCR was performed in 117 cultivars of 5 cultivars. The PCR was performed with 20 ng of total genomic DNA, 2 μl of 0.25 mM dNTP, 2 μl of 10 × PCR buffer, 2 μl of 10 pmol primer, and 0.25 U of DNA polymerase.

Name of the primer The sequence (5 '- > 3') apply MYH4 F GCAGCAGGAGATTTCTGACC Real-time PCR R CAAGTTGGATGCGAAGGATT Real-time PCR P1F TCACATCTCTCCTCCCACCT Promoter sequencing P1R CGGGAGTTCTTTAAGACTTAGCA Promoter sequencing P2F CAAGGCTCTCTGACCCACTC Promoter sequencing P2R ACCGCATAATGATGGAAGGA Promoter sequencing GAPDH
F GCAAAGTGGACATTGTCGCCATCA Real-time PCR R TCCTGGAAGATGGTGATGGCCTTT Real-time PCR

The reaction conditions were 5 min at 94 ° C, 30 sec at 94 ° C, 30 sec at 62 ° C, 1 min at 72 ° C, and finally 35 min at 72 ° C for 10 min using DNA Engine Tetrad ^® 2Thermal Cycler. The amplified PCR products were sequenced using an ABI 3730 sequencer.

The SNP was confirmed using the SeqMan program. One SNP was identified in the -1389th nucleotide sequence, and genotyping analysis was carried out using 133 primer sets P2 shown in Table 1, by sequencing in a land race.

In addition, TFSEARCH V1.3 (http://www.cbrc.jp/research/db/TFSEARCH.html) and TESS (http: / /) were used to infer the transcription factor binding region of the MYH4 5 ' /www.cbil.upenn.edu/cgi-bin/tess/tess).

Statistical analysis

Relevance statistical analysis was performed using SAS 9.13 software and GLM analysis was performed using the following formula.

(= General average, G _i = genetic effect, S _j = sex effect, P _k = slaughter timing _, e _ijkl , = random error)

GLM analysis was used to analyze expression levels in gene expression analysis. The formula included genotype, sex and slaughter duration as a fixed effect of the statistical model. All data were expressed as mean ± SE and were considered significant at P <0.05.

Analysis of gene expression by SNP genotype in the regulatory region of the porcine MYH4 gene 5

Samples for gene expression analysis consisted of 73 pig samples, totaling GG type 8, GT type 35, and TT type 30. TRIzol was used for total RNA isolation, and cDNA was synthesized using a total of 1 ㎍ of RNA. cDNA synthesis was performed in a total volume of 20 μl containing 1 μl of 5 × First-Strand buffer, 1 μl of 0.1M DTT, 1 μl of 10 mM dNTP, 1 μl of recombinant RNasin ^® Ribonuclease Inhibitor, 200 μ of SuperScript III reverse transcriptase, 0.25 μg of random primers, And the reaction was allowed to proceed at 50 ° C for 60 minutes.

The synthesized cDNA was subjected to gene expression analysis in porcine sirloin tissue using an ABI 9700 real-time PCR machine using specific primers based on the porcine MYH4 gene. At this time, the pig GAPDH gene was used as a standard gene.

SNP detection and genotype frequency

The pig's MYH4 gene was found to be present on pig chromosome 12 by a previous paper (Davoli et al., 2002). In this study, the MYH5 5 'regulatory region of pigs was estimated by GenBank (Acc. No. NC_010454). MYH4 5 'regulatory region was amplified using PCR technique and genomic DNA isolated from 5 different cultivars (Landrace, Yorkshire, Dorok, Berkshire, and Pork) In the land race, it was found that the -1398th base was changed from G to T in the 5 'control region.

SNP could not be confirmed in the other 4 varieties except Landrace. Davoli et al. (2003) reported that the 28th base of the MYH4 gene was altered and correlated with the daily gain in pigs (Davoli et al., 2003). However, no results have been reported so far that confirmed SNPs in the 5 'regulatory region of MYH4. The frequency of SNP genotypes in the MYH4 5 'regulatory region was found to be genetically polymorphic only in the landrace of the five cultivars and in one genotype in the other four varieties.

Table 2 below shows the SNP genotype frequencies of MYH4 5 'regulatory regions isolated from 5 varieties (Landrace, Yorkshire, Dorok, Berkshire, and native pig) pigs.

Bell

SNP position
Number (n)
genotype Allele frequency GG GT TT G T Land race -1398G / T 10 0.36 0.41 0.23 0.26 0.44 Yorkshire 26 1.00 0 0 1.00 0 Berkshire 26 1.00 0 0 1.00 0 Drum 26 1.00 0 0 1.00 0 A traditional pig 13 1.00 0 0 1.00 0

Referring to Table 2, in the land race, the genotype frequencies were 0.41 for GG type, 0.23 for GT type, 0.36 for TT type, 0.56 for G allele and 0.44 for T allele.

Association analysis

The relationship between the SNP of the MYH4 5 ' regulatory region of the landrace pig, muscle fiber characteristics and meat quality traits is shown in Table 3 below.

characteristics
genotype P value GG
(n = 48) GT
(n = 54) TT
(b = 31) 1. Muscle traits (1) Total number of muscle fibers (× 10 ³ ) 1,201 (51.3) ¹ 1,161 (39.4) 1,175 (66.8) NS (2) Average cross-sectional area of muscle fiber (탆 ² ) 4,443 (148.2) 4,349 (103.4) 4,274 (162.0) NS (3) Total muscle fiber density (/ mm2) 233.7 (8.37) 234.3 (5.85) 239.63 (9.15) NS (4) Myofiber composition (%) Type I 8.83 (0.92) 10.04 (0.64) 10.82 (1.00) NS Type IIa 13.66 ^a (0.89) 11.28 ^b (0.62) 8.71 ^c (0.97) 0.004 Type IIb 77.55 (1.38) 78.70 (0.96) 80.48 (1.50) NS (5) Muscle fiber area (%) Type I 5.81 (0.60) 6.77 (0.42) 7.05 (0.65) NS Type IIa 7.93 ^a (0.65) 7.07 ^a (0.45) 5.50 ^b (0.70) 0.061 Type IIb 86.25 (0.98) 86.17 (0.67) 87.45 (1.06) NS 2. Meat quality The acidity (pH _{45 min} ) 6.08 (0.06) 5.99 (0.04) 6.03 (0.06) NS L * 48.51 (0.55) 48.86 (0.42) 49.27 (0.63) NS a * 6.56 (0.22) 6.24 (0.17) 6.61 (0.25) NS b * 3.00 (0.18) 2.88 (0.14) 3.20 (0.20) NS Water loss (%) 5.99 (0.45) 5.15 (0.35) 5.20 (0.53) NS Filter paper liquid
Absorption amount (FFU) (mg) 65.74 ^a (4.60) 52.05 ^b (3.56) 59.73 & lt ^{; /} RTI & gt ^{; ab} (5.32) 0.047 Poultry meat (PSE) (n) 17 ² 9 2

In Table 3 above, n represents the number of pigs, superscript 1 represents the least squares mean and standard error, superscript 2 represents the chi-square test of the frequency of fish meal (p <0.001 ), Superscripts a, b, and c represent the least-squares mean of the same row in different subscripts.

According to the genotype of the 1398th nucleotide sequence, the number of myofiber type IIa and the total number of fibers were found to be 1,202x10 ³ in the GG genotype and the average cross-sectional area of the cross- sectional area), the GG genotype was 4,443, which was broader than the GT and TT genotypes. The ratio of muscle fiber type Ⅱ a in GG genotype was the highest at 13.66% and the area of muscle fiber type Ⅱ a was 7.93% in GG genotype. On the contrary, the ratio and area of muscle fiber type Ⅱ a were lowest in TT genotype.

Since the myosin family is a protein that constitutes muscle fibers, it is known to be highly related to the quality of pork (Karlsson et al., 1999; Brocks et al., 2000). The post pH of pigs varies with the type of muscle fibers, It is known that Ⅱ b mainly contributes to the decrease of acidity by controlling the rate of action (Candek-Potokar et al., 1999; Ryu and Kim, 2006). In addition, recent studies have reported that the characteristics of muscle fibers in cows and pigs are related to meat quality (Ozawa et al., 2000; Hwang et al., 2010; Karlsson et al., 1999; Eggert et al., 2002;

Therefore, it can be confirmed that the TT type genotype can produce meat of superior quality than the genotype type pig of GG and GT type by referring to the results and research results according to the present invention.

Example 2 Production of Microarrays Fixed with SNP According to the Present Invention

In the nucleotide sequence shown in SEQ ID NO: 1, a polynucleotide consisting of 20 consecutive bases containing a base at the SNP position (-1398th) (the SNP is located at the 11th position of the 20 consecutive bases) . Since there are two alleles in the SNP position, two polynucleotides are immobilized on the substrate for each sequence.

First, the N-terminal of each of the polynucleotides was replaced with an amine group and then spotted on a silylation slide (Telechem), wherein the spatting buffer was 2SSC (saline-sodium citrate, pH 7.0). After spotting, the binding was induced by placing in a dryer, followed by washing with 0.2% SDS (sodium dodecyl sulfate) for 2 minutes and then with tertiary distilled water for 2 minutes to remove unbound oligos. The slides were treated at 95 for 2 min to induce denaturation and then blocked with blocking solution (1.0 g NaBH ₄ , PBS (pH 7.4) 300, EtOH 100) for 15 min, 0.2% SDS solution for 1 min, Minute, respectively, and dried at room temperature to prepare a microarray.

Example 3: Determination of pork weight using a microarray with a SNP fixed according to the present invention

The present inventors separated the target DNA from the blood of a pig to diagnose the sasang constitution, and fluorescently labeled with Cy3-dUTP (Metabion). Hybridization of the microarray prepared in Example 2 with the fluorescently labeled target DNA under UniHyb hybridization solution (Telechem) was carried out at 42 for 4 hours. 2SSC for 5 minutes at room temperature and then dried in air. After drying, the slides were scanned with Scan Array 5000 (ScanArray 5000: GSI Lumonics) and the results were analyzed by QuantArray (GSI Lumonics) and ImaGene software (BioDiscover) , Thereby diagnosing the meat-related traits of the pigs, particularly the myofiber forms in the pigs' muscles.

That is, the present invention provides a gene marker for diagnosing myofibers, one of the meat quality traits of pigs, by using SNPs present on the 5 'regulatory region of MYH4 (Myosin heavy chain 4) gene, According to the present invention, it is possible to analyze at the molecular level the myofiber form, one of the meat quality traits of pigs, by using a gene marker for detecting the shape of the muscle of the pig, Is a molecular marker that can diagnose the shape of muscle fibers. It can be used to improve meat quality of pork by diagnosing the type of muscle fibers that are closely related to the meat quality of pork.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> RURAL DEVELOPMENT ADMINISTRATION <120> Genetic marker for diagnosis of muscle fiber type within porcine          muscle and diagnosis method using the same <130> NPF-22580 <160> 1 <170> PatentIn version 3.2 <210> 1 <211> 2018 <212> DNA <213> Sus scrofa <400> 1 gtccactgga atatcatggt ttcttttaga gactttaaga actgaatgag gaggtctcgt 60 cgtggctcag cagaaatgaa cccaactagg aaccatgagg ttgcagtttc aatccatggc 120 ctcctggctc ggtgggttaa gggtccagca tcatcatgag ctgtggtgta ggtcgcagac 180 acggctcaga tcccacactg ctgtccctgt ggggtaggca ggggctacag ctttgatttg 240 acccctagcc tgggaacctc catatgccat gggtacggcc ctaaaaagac aacaacaaca 300 aaaaatcctc attagctgta ctgtgtaact cagcctatgc gtcttggtct catccgtgat 360 ttcttctttt aactttcagt tccaaagata gcacatgcgt ctgataatat ttatgtttat 420 aatgtagaca ttaagtttca aaaggagtaa aaataaatga gttgtgaaat cttaaattag 480 agaaaaatca gaagacatct cttctttctg gcttagagcc taacactttg ggtaagtcac 540 taaacttctg tgaatcattt ccatggagac tggggggaaa aaaaaagcct gatcatctat 600 tccacagtat tgtatcaaaa gaaataaaaa ctataaaaga ttcaatctct gaaggtatga 660 aaaagaaatt ctatgtcagt aggatgcttg caaacagtga tcatattagt cagtaactta 720 agctaggaga tgacagccaa aaatattaca tcagatctag gtgacacact tagcgtggac 780 agatttgctg ttacattcag cagcagctgt gtctgtggca aaaccaccaa aacccaattt 840 acaagcatcg tgggcatatg tgatagcccc cttatgttct caacccacaa agagtcctgt 900 gggtatcaca tctctcctcc caccttaaat aaaaatacgt attacccacc tcattagagc 960 tactgctagt catgaggatt tgcctgtgaa ctaggaatgc atattgatgc ctccttccat 1020 cattatgcgg tagaaacaca catagaacat cacacggact cctgcagtcc ccccagtgaa 1080 aacatgtgag ctcaagacag ccacggcaag ctctccagaa aaggaaaaga agtgtttcta 1140 tctattctaa atcccttatg gctcccccac tggtctgtca ccatggctta gcccgagaat 1200 ctgcctaaac tttctccttc atgcttagtc ttttagactt taaaaaaatc tatcatcagt 1260 atttctaaaa tccagaccca ggctaggagt tttctgcttt aataccaatc atgttgtcag 1320 agctaaaact catcccagct cctcaatggc cctaagcact aacaaatcaa ttagttctca 1380 actcctcgtg tctggctcat tctgtcggac caattttaca ggcaggagag taagtgggaa 1440 cctggctttc aactcagtga tgaatgatgg aacagcaaag ctggagaaat agccttagaa 1500 gccctgaatc tccatcccta tcaaatgcct caaaagaacc ctagatgatc ctctgtcaaa 1560 ttatttatag gtgtcaagaa atatttctaa ttatatccat tcacagccac agtcagtgaa 1620 tattgtgcaa agagattgcc aaaaaaggtt tgccaagtag gttcccagct gggacagctg 1680 aggtggctgc tgtgtttgca aaatggtctc tataaaagtg gagctgagat gcctctgtcc 1740 tgtccttcct caaaacactt taaggtatgt atatgtagaa gaacacttgg ctagctttgc 1800 atccctcaca caaacaatta ttcacttaag ggagatggcc actgtttccc aaattttaat 1860 ttttctttct aacattccta aggatgacgt catacacaat atagtttcta gtactatgtg 1920 attaaaatgg aaaaaataaa ataaaagaat ccacattctc ttgtttgttt tttctttcaa 1980 cagtagttgt ctgccttgag cctgccaccg tcttcatc 2018

Claims (5)

A genetic marker for porcine musculoskeletal diagnoses consisting of 10 to 100 consecutive bases comprising a base at the -1398nd SNP position in the nucleotide sequence shown in SEQ ID NO:
A polynucleotide consisting of 10 to 100 consecutive bases or a complementary polynucleotide thereon, wherein the polynucleotide is a polynucleotide consisting of 10 to 100 consecutive bases comprising a base at the -1398 &lt; th &gt; SNP position in the nucleotide sequence shown in SEQ ID NO: 1.
10. A microarray for the diagnosis of porcine musculoskeletal form comprising the polynucleotide of claim 2 or a complementary polynucleotide therefor.
A kit for the diagnosis of porcine muscle fiber small form comprising the polynucleotide of claim 2 or a complementary polynucleotide thereto.
The method for diagnosing porcine muscle fibrosis type in which the expression level of porcine myofascial type IIa is judged to be lower than that of GG and GT genotype when the -1398th SNP position is the TT genotype in the nucleotide sequence shown in SEQ ID NO: 1.

Images