KR100961677B1 - Method for detecting cattle with high marbling - Google Patents

Abstract

The present invention relates to a method for screening a cow having excellent intramuscular fat, and more particularly, to a B genotype shown by a growth hormone secretion stimulating hormone (GHRH) receptor and a nucleotide sequence substitution in a bovine (for example, Hanwoo). It is a method of selecting individuals with high intramuscular fat by using.

According to the present invention, it is possible to distinguish between high and low intramuscular fat groups and early selection for breeding beef cattle required from immature cows, thereby enabling economic and efficient breeding.

Beef, selection method, intramuscular fat map

Description

Method for detecting cattle with high marbling

The present invention relates to a method for testing a cow having excellent intramuscular fat, and more preferably, a method for testing a group having a high degree of intramuscular fat deposition related to meat in a cow, and amplifying the intramuscular fat-related gene in the DNA obtained from the cattle. By treating the restriction enzyme BspHI to identify intramuscular fat-specific DNA markers, and using the same to determine the meat quality of the cattle, it is more easy to use the method for early selection.

Polymerase chain reaction (PCR) was first introduced in 1986 by Kary Mullis. Due to the development of PCR method, it is revolutionary to know the status of target gene using small amount of DNA. Started by Watson and Crick in 1953 to explain the structure of DNA helix, the world of DNA molecular biology began a new development 20 years later with the discovery of restriction enzymes, the development of DNA cloning, and sequence determination. Recent developments in molecular genetics have led to the development of genetic markers at the DNA level. In particular, the polymorphism of DNA enables the development of markers by key genes and quantitative trait loci (QTL) that determine important transgenic traits, linkage analysis, genetic maps, and paternity. It has been used as a powerful device to analyze discrimination testing, distinction of breeds, pedigree analysis, genetic divergence and relationship.

In particular, in the field of heredity and breeding, animal polymorphism is used to improve breeding by using genes as marker genes. That is, the results of DNA polymorphism can be used as a useful technique for analyzing the origin and evolution of livestock, genetic characteristics of breeds and their association with specific traits. In particular, screening techniques using DNA markers have been used as a way of increasing the heredity of livestock, dramatically beyond the limits of traditional screening methods. Such genetic engineering techniques include Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Single Strand Conformational Polymorphism (SSCP), and Restriction Fragment Length Polymorphism (RFLP). Among them, RFLP technique, which is a technique for analyzing polymorphism by restriction enzyme treatment, is widely used as a highly reproducible and efficient method.

Beef consumption has accelerated since the 1990s, and beef imports have continued to increase. Therefore, in order to enhance the competitiveness of domestic beef, it is urgent to improve the quality of meat in the direction that the changing consumption is reviving the preference. Meat side characteristics of beef include marbling, meat color, fat color, texture texture, and firm firmness. Among the characteristics that show the meat quality, intramuscular fat is ranked highest.

Intramuscular fat refers to the fat between the 1st and 2nd muscles of the muscle fat, also called 'Marbling' or 'upstream fat', and the lean meat is shaped like frost. Because it looks or looks like marble. Intramuscular fat is an important factor in determining meat quality (meat quality) and is closely related to meat taste. Meat with a good level of muscle fat is delicious and tender.

The reason for this is, firstly, because the internal melting point of fat during heating and cooking is low, it melts quickly and forms a film on the surface of the meat to suppress water evaporation, and at the same time, decreases the production of water due to the degeneration of meat protein, thereby making it more succulent. Second, oleic acid, which constitutes intramuscular fat, acts as a substance that improves flavor. Third, the intramuscular fat accumulates around the mesial membrane, weakening the strength of meat and making it feel softer when chewing meat because it is less dense than lean meat.

According to the report of Lee Gye-im, Lee Gye-im, Choi Ji-hyun, Lee Chul-hyun, and Ahn Byung-il. Changes in meat consumption structure and outlook, 1999. 12. Report of Rural Economics, Meridian price increased by 1.297% Was analyzed. In order to enhance the competitiveness of Hanwoo, Korea's indigenous resource, Hanwoo's ability to improve its core economic traits is the most reliable means of securing competitiveness, and many studies have been conducted to efficiently improve meat quality. In the conventional case, a very inefficient method of measuring after slaughter has been used to check meat quality. Therefore, there is an urgent need for a method of discriminating the quality of beef cattle for preservation and breeding of excellent beef cattle resources.

The present invention has been made in view of the above necessity, and an object of the present invention is to select a population having a high degree of deposition of muscle fat associated with meat by using DNA extracted from bovine based on PCR-RFLP technique by restriction enzyme treatment. To provide.

In order to achieve the above object,

a) separating DNA from bovine blood or tissue;

b) using the forward primer of SEQ ID NO: 1 having the nucleotide sequence of CAGACTTCACCTCGCCATCC in the 5 'to 3' direction and the reverse primer of SEQ ID NO: 2 having the base sequence of TGTTGTCACCGCTGCCAGCA in the 5 'to 3' direction Performing a PCR (PCR) reaction;

c) subjecting the amplified product to the product amplified by the PA reaction;

d) provides a test method for a cow with high intramuscular fat, characterized in that to observe the genetic variation of the restriction enzyme-treated section.

In one embodiment of the present invention, the cattle varieties are Hanwoo cattle, cows (Holstein), Angus (Angus), Hereford, Charolais, Brown Swiss, Smentmenthal and Limousin (Limousin) is preferably selected from the group consisting of, more preferably, the cattle breed is Hanwoo, but is not limited thereto.

In addition, in one embodiment of the present invention, the PCAL amplified product preferably comprises a transcriptional regulatory region of the growth hormone secretion stimulating hormone (GHRH) receptor gene, more preferably the PCAL amplified product is NCBI And the 83rd base in the transcriptional regulatory region of the Growth Hormone Secretion Stimulating Hormone (GHRH) Receptor Gene, which has the gene accession number GenBank: AF267729.1.

The restriction enzymes used in the method of the present invention is preferably a BspH I.

In another aspect, the present invention provides a label for the selection of cattle excellent in intramuscular fat in the DNA sequence of SEQ ID NO: 3, wherein the 83rd DNA comprises a DNA fragment consisting of 20 to 200 consecutive sequences containing thymine (T) base It provides a printing composition.

In the present invention, the cattle varieties include Hanwoo cattle, cows (Holstein), Angus (Angus), Hereford, Charolais, Brown Swiss, Simmenthal and Limousin. It is preferably selected from the group consisting of, more preferably the cattle breed is not limited to Hanwoo.

Hereinafter, the present invention will be described.

The present invention is designed to breed economically and efficiently by early selection of cattle with high intramuscular fat, preferably Korean cattle, and more particularly, the present invention provides a gene marker for bovine growth hormone secretion stimulating hormone receptor (GHRH). It provides a selection method of Korean beef with high intramuscular fat.

The present invention uses DNA isolated from bovine blood or tissue, to amplify a large amount of GHRH receptor gene by PCR method, and then select individuals with high intramuscular fat through polymorphism after cleavage using Bsp HI restriction enzyme. have.

The present invention provides a method for selecting bovine sarcoma by early diagnosis of myocardial fat, which has a major effect on meat quality, through a DNA marker.

As can be seen from the above configuration, according to the present invention, the BB genotype with high intramuscular fat and significant significance was used as a DNA marker, so that it was effective for early selection and breeding of immature cows (for example, Korean cattle). For example, it provides a labeling factor for improving meat quality of Hanwoo.

Hereinafter, the present invention will be described in more detail with reference to non-limiting examples.

(1) Preparation of Sample

112 Hanwoo cattle, cows (Holstein), Angus, Hereford, Charolais, Brown Swiss, Simmenthal and Limousine (Limousin) was obtained by 53, 29, 28, 13, 24, 24 and 28 individuals, respectively, and the blood of the cows was collected.

(2) Isolation and Purification of Genomic DNA

400 μl of blood extracted from cattle and 200 μl of Lysis buffer (3M NaCl, 200mM Tris-HCl, pH 8.6, 100mM EDTA) were mixed in a 1.5ml tube and allowed to react at 68 ° C. for 5 minutes. After adding 600 µl of choloroform to the reaction tube, centrifuge at 10,000 rpm for 2 minutes, and transfer only the supernatant to a new tube. 600 μl of distilled water and 70 μl of 5% CTAB solution (5% CTAB, 0.4M NaCl) were added to the supernatant, mixed well, and centrifuged again at 10,000 rpm for 2 minutes. 300 M of 1.2 M NaCl solution was added to the precipitate to dissolve it, 750 μl of 100% ethanol was added thereto, followed by centrifugation at 10,000 rpm for 10 minutes, and the resulting precipitate was washed with 70% ethanol and 40 μl of TE. It was dissolved in buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA).

(3) primer preparation and genotyping

Based on the nucleotide sequence (Fig. 1) for the PCR reaction was prepared the following primer.

GHRHR-1 (SEQ ID NO: 1): 5′-CAGACTTCACCTCGCCATCC-3 ′

GHRHR-2 (SEQ ID NO: 2): 5′-TGTTGTCACCGCTGCCAGCA-3 ′

PCR reaction was performed using the synthesized primers. PCR reaction was performed by adding 50 μl / μl of DNA and primer to each of 10pmol, 10 × Buffer (100mM Tris-HCl, pH8.3, 500mM KCl, 15mM MgCl ₂ ), and 200μM 4dNTP, 1 unit of Taq polymerase. Was made to 50 μl. PCR reaction conditions were initially denatured at 95 ° C for 5 minutes, denaturation reaction at 95 ° C for 1 minute, polymerization reaction at 59 ° C for 1 minute, and synthesis reaction at 72 ° C for 1 minute 30 times, and finally 72 ° C. After 10 minutes of extended synthesis, the PCR reaction was terminated.

Restriction enzyme of Bsp HI was mixed with 605bp product generated by PCR reaction and reacted for 3 hours at 37 ° C. The reaction product was electrophoresed in 3% agarose, and after electrophoresis was dyed in ethidium bromide and observed by UV irradiation. Polymorphism caused by restriction enzymes can be confirmed that the 83rd base in the GHRH receptor gene transcription control region is replaced by cytosine (A genotype) to thymine (B genotype). The relationship with Genotype frequencies between cattle breeds are shown in Table 1.

Table 1. Genotype Frequency of Korean Cattle and Foreign Cattle Breeds

Breed No. of
animal Genotypes Allele frequencies AA AB BB A B Hanwoo 112 30 45 37 0.47 0.53 Angus 29 One 6 22 0.14 0.86 Brown swiss 24 0 4 20 0.08 0.92 Charolais 13 0 2 11 0.08 0.92 Hereford 28 0 One 27 0.02 0.98 Holstein 53 0 6 47 0.06 0.94 Limousin 28 One 9 18 0.20 0.80 Simmetal 24 2 7 15 0.23 0.77

(4) Analysis of the relationship between genotype and economic traits

In order to evaluate heritability for each carcass trait, the relationship between individuals was obtained by using the individual's lineage information, and the environmental effects were treated as fixed effects. For the individuals, the additive effects considering the relationship between the individuals (direct The additive effect and the parent additive effect on all the traits before weaning were set to a population model that considered random variables.

Carcass morphology was set as co-variate for additive effects and slaughter age, and the MTDFREML program was used to estimate the variance of all traits.

The analysis model for each trait is as follows.

Carcass weight (CW), back fat thickness (BF), intramuscular fat degree (MS)

Y _ijkl = μ + YS _i L _j + D _ijkl + A _ijkl + e _ijkl

Where Y _ijkl is the observed value, μ is the overall mean, is the i-year-seasonal effect, S _j is the j-sex effect, L _k is the k-birth region effect, AGE _l is the l-mother age effect, A _ijkl Is an additive effect, M _ijk is the parent effect, and e _ijkl is the error.

In addition, gene effects on two genotypes, namely A and B genotypes and respective carcass traits represented by restriction enzymes, were analyzed by the General Linear Model (GLM) based on the SAS general linear model. same.

Y _ij = μ + g _i + e _ij

In the above, Y _ij is a measured value, μ is an overall mean, g _i is a growth hormone variant genotype, and e _ij is an error.

As a result of analyzing the association between each genotype and trait using SAS general linear model, it can be seen that BB genotype is thinner than the AA genotype or AB genotype, and the intramuscular fat is high as shown in Table 2 and Table 3. have.

Table 2. Carcass breeder value of Hanwoo analyzed (carcass weight, back fat thickness, intramuscular fat map)

Conductor shape Average Standard Deviation Minimum value Maximum value Conductor weight (kg) 2.418 7.969 -21.940 24.493 Back fat thickness (cm) -0.001 0.079 -0.219 0.286 Intramuscular fat degree (point) ^a 0.121 0.427 -0.823 1.767

a: Intramuscular fat shows the highest intramuscular fat with 1-7 points and 7 points

Table 3. Least-squares mean and standard deviation of genotype and carcass trait of Hanwoo GHRH receptor gene

genotype Analysis Conductor shape Conductor weight (kg) Back fat thickness (cm) Intramuscular fat degree (point) ^a AA 30 2.441 ± 1.450 0.022 ± 0.014 0.025 ± 0.075 ^b AB 45 3.698 ± 1.184 0.005 ± 0.011 0.053 ± 0.061 ^b BB 37 0.843 ± 1.306 -0.025 ± 0.012 0.281 ± 0.068 ^c

a: Intramuscular fat shows the highest intramuscular fat with 1-7 points and 7 points

^bc Significant difference between different notations (P <0.05)

These results can be used to analyze genotypes from immature individuals using genotypes of growth hormone secretion stimulating hormone receptor genes, and to predict the deposition effect of intramuscular fat according to the genotypes. It can be used as a marker.

1 is a nucleotide sequence of the transcriptional regulatory region of the GHRH receptor.

Figure 2 is a photograph showing the gene polymorphism of the GHRH receptor. If you see a fragment of 605bp in the picture has a type A gene, when the 83rd gene is substituted with thymine and the restriction site is formed and cut, it is separated into fragments of 531bp and 74bp. It can be said to have. In other words, if only 605bp fragments are seen in the picture, AA fragments, 605bp and 531bp, 74bp, if there are three fragments can be identified as the type BB, 531bp and 74bp.

<110> Konkuk University Industrial Cooperation Corp. <120> Method for detecting cattle with high marbling <160> 3 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer <400> 1 cagacttcac ctcgccatcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer <400> 2 tgttgtcacc gctgccagca 20 <210> 3 <211> 671 <212> DNA <213> Artificial Sequence <220> <223> GHRH Receptor <400> 3 tcccttcaga cttcacctcg ccatccagac tggtatcctt gctgggaaca aagacaaggt 60 tttgctgaaa ctattatctt cacgaccagc cgatggggat gcatgggaac ttatgattgt 120 gcgtcctttt ctaagattcc tgttgtccag actctactga caccctatcc acttctgctg 180 ggtccccagg gctccgaact catccttcag cccggtggat gaggctgaga tcacaactaa 240 actggggtcc ccgagtgtgg actcaggcct tctttgctga gtctccttca tttggggggc 300 ctcagagggc tgggctcaga gaagaaaatt atataaagaa tagtgaccta ctggggcaag 360 aggtgtcctg cagctgccat ttgtctgtga ccttggtaat gttaggacag acatgggcag 420 acttacagac gaagtcaagc ccttcccgcc aggaatgcag agttctaccc tgaggctgtg 480 gcggagctgg gcatggtgtt ctgaaatcct ggtgaatatt cagtgggttc tgtccccttc 540 actagctcct gtctatgcaa acagccacct gggaaggaga agcagagggt gtgctggcag 600 cggtgacaac aggggacagt ggaaggaacg cagggtcacc gaggctgacc caggcagctg 660 tcgccgagct c 671  

Claims (9)

a) separating DNA from bovine blood or tissue; b) using the forward primer of SEQ ID NO: 1 having the nucleotide sequence of CAGACTTCACCTCGCCATCC in the 5 'to 3' direction and the reverse primer of SEQ ID NO: 2 having the base sequence of TGTTGTCACCGCTGCCAGCA in the 5 'to 3' direction Performing a PCR (PCR) reaction; c) treating the restriction enzyme Bsp HI with the amplified product through the PCAL reaction; d) A method for testing a high intramuscular fat, characterized by observing the polymorphism of the growth hormone secretion stimulating hormone (GHRH) receptor gene transcription control region of the restriction enzyme-treated NCBI gene registration number GenBank: AF267729.1. The method of claim 1, wherein the breed of cattle is Hanwoo cattle, dairy cows (Holstein), Angus (Heregus), Hereford (Charolais), Brown Swiss, Simmenthal and Limousin Inspection method, characterized in that selected from the group consisting of. 3. The test method according to claim 2, wherein the breed of cattle is Korean cattle. The method of claim 1, wherein the product is amplified product comprising a transcriptional regulatory region of the growth hormone secretion stimulating hormone (GHRH) receptor gene. The test method according to claim 4, wherein the PSA amplified product comprises the 83rd base in the transcriptional regulatory region of the growth hormone secretion stimulating hormone (GHRH) receptor gene of SEQ ID NO: 3. delete The labeling factor composition for bovine selection excellent in intramuscular fat in the DNA sequence of SEQ ID NO: 3, wherein the 83rd DNA comprises a DNA fragment consisting of 20 to 200 consecutive sequences containing thymine (T) bases. The method of claim 7, wherein the cattle breed is Hanwoo cattle, cows (Holstein), Angus (Heregus), Hereford (Charolais), Brown Swiss (Simmenthal) and Limousin (Limousin) Labeling factor composition, characterized in that selected from the group consisting of). 9. The labeling factor composition according to claim 8, wherein the breed of cattle is Hanwoo.

Images