KR101496022B1 - Single nucleotide polymorphism marker in LPL gene for diagnosis of meat quality in Hanwoo and method for diagnosis of meat quality in Hanwoo using same marker - Google Patents

Abstract

The present invention relates to a monoclonal polymorphism marker for Korean flesh and mortality diagnosis in a LPL gene and a diagnostic method for a Korean beef cattle quality using the same, wherein the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, A polynucleotide consisting of 10-100 consecutive DNA sequences comprising at least one nucleotide selected from the group consisting of the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: 5, or a complementary polynucleotide thereof, To provide a base polymorphism (SNP) marker composition. Further, the present invention provides a diagnostic method and a diagnostic kit for Korean beef cattle using the SNP marker. Based on this, Hanwoo varieties with superior meat quality can be usefully used for early selection and improvement.

Description

[0001] The present invention relates to a single nucleotide polymorphism marker (LPL gene) for diagnosis of Korean males and females using Hanwoo polymorphism marker,

The present invention relates to a monoclonal polymorphism marker for the diagnosis of Korean flesh and blood in a LPL gene and a diagnostic method for the Korean flesh and meat using the same.

Lipoprotein lipase (LPL) gene is found in many adipose tissues and plays an important role in the regulation of lipid metabolism. This enzyme breaks down fatty acids and glycerol from chylomicron, a fat protein complex formed by binding to triglyceride and cholesterol and phosphoprotein of phospholipid, which is the main energy storage form in the body, Is the main enzyme that plays a role in delivering

In animal experiments using transgenic mice and rabbits, most of the LPL genes were expressed in adipose tissue and muscle tissue, and abnormal imbalances such as obesity or weight loss were observed according to the abnormal expression level. In vitro experiments showed that LPL LPL is a factor that regulates the accumulation of fat in adipose tissue because activity indicates that triglycerides are highly correlated with adipocyte entry.

Recently, animal experiments using transgenic rabbits have shown that fat accumulation is reduced when LPL activity is increased, and it has been reported that LPL gene can be used for gene therapy for the treatment of diseases such as obesity caused by fat accumulation. These results support that LPL gene plays an important role in fat metabolism and is a strong candidate gene related to fat accumulation.

The grade of beef is divided into meat grade and meat grade. The meat grade is determined as 1 ++, 1+, 1, 2 or 3 grade according to muscle fat, meat color, local color, texture and maturity The meat grade is determined as A, B, C and D (outside of the class) by integrating the carcass weight, backfat thickness, and the sillicomic cross section of the carcass. In case of Hanwoo, it is important to firmly establish quality image as a high quality meat by selecting and producing Hanwoo which is superior in meat quality and meat quality because it is much higher price than other imported meat, domestic cow meat and beef cattle.

Korean Patent Laid-Open No. 10-2012-0011728 discloses a single base polymorphism marker useful for early selection of meat or meat quality of Korean beef cattle, Discloses SNP markers useful for determining meat quality, but there is no mention of SNPs in the LPL gene of the present invention.

The object of the present invention is to provide a method for producing a nucleic acid comprising the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: (SNP) marker composition comprising a polynucleotide consisting of 10-100 consecutive DNA sequences comprising the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or a complementary polynucleotide thereof.

It is another object of the present invention to provide a diagnostic method and a diagnostic kit for a Korean beef cattle using the SNP marker.

In order to accomplish the above object, the present invention provides a nucleic acid comprising a nucleotide sequence selected from the group consisting of the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: (SNP) marker composition comprising a polynucleotide consisting of 10-100 consecutive DNA sequences containing one or more selected nucleotides or a complementary polynucleotide thereof.

Specifically, the genotype of the 259th nucleotide of SEQ ID NO: 1 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 2 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 3 is GG, the 251st nucleotide of SEQ ID NO: And the genotype of the 251 < th > nucleotide of SEQ ID NO: 5 is CT.

In detail, the Korean beef cattle diagnosis is characterized by diagnosing muscle fat level and unsaturated fatty acid content. In addition, the unsaturated fatty acid is characterized by being oleic acid and monounsaturated fatty acid.

The polymorphic SNP variation in a polynucleotide comprising the 259th nucleotide of SEQ ID NO: 1 can be described by g.6960 A > T.

The polymorphic SNP variation in a polynucleotide comprising the 251st nucleotide of SEQ ID NO: 2 can be described as g. 6997 G > A.

The polymorphic SNP variation in a polynucleotide comprising the 251st nucleotide of SEQ ID NO: 3 can be described by g.21604G > A.

The polymorphic SNP variation in a polynucleotide comprising the 251 < th > nucleotide of SEQ ID NO: 4 can be described by g.22488 G > T.

The polymorphic SNP variation in a polynucleotide including the 251 < th > nucleotide of SEQ ID NO: 5 can be described as g.25670 C > T.

The SNP markers are also useful as markers for diagnosing the quality of Korean beef cattle. The more the number of markers is combined with the combination of the markers, the higher the accuracy of the meat quality diagnosis can be.

On the other hand, the SNP marker has a nucleotide sequence of G.6960 A> T (259th base of SEQ ID NO: 1), g.6974 G> A (251 base of SEQ ID NO: 2), g.21604 G> A (251st base in SEQ ID NO: 4) and g.25670C > T (251st base in SEQ ID NO: 5) can be used as markers for determining the quality of Korean beef, The haplotype combination of the SNPs can serve as a better marker because it constitutes an association disequilibrium between SNPs.

As used herein, the term Linkage Disequilibrium refers to a non-random association of alleles in two or more loci that are not necessarily on the same chromosome in population genetics.

As used herein, the term "nN> M ", wherein n is an integer and N and M are each independently A, C, T or G, Substituted " In the meantime, the nucleotide sequences of SEQ ID NOS: 1 to 5 of the present specification are prepared in accordance with the multi base type method, respectively.

(1) obtaining a DNA sample from an individual; (2) performing PCR using a primer capable of amplifying the SNP marker using the DNA obtained from the step (1) as a template; (3) a DNA fragment comprising a nucleotide sequence selected from the group consisting of the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: Identifying the genotype of the selected one or more nucleotides; And (4) diagnosing the content of the intramuscular fat and the unsaturated fatty acid in the genotype.

Specifically, the diagnosis of the intramuscular fat level and the content of the unsaturated fatty acid in the step (4) is performed such that the genotype of the 259th nucleotide of SEQ ID NO: 1 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 2 is AA, the 251st nucleotide of SEQ ID NO: The genotype of the 251st nucleotide of SEQ ID NO: 4 is GG, and the genotype of the 251st nucleotide of SEQ ID NO: 5 is CT.

The supply site of the DNA is not particularly limited and can be obtained from, for example, muscles, epidermis, blood, bone, organs, preferably from muscle or blood. In one example of the present invention, when the starting material is gDNA, the separation of gDNA can be performed according to a conventional method known in the art (see Rogers & Bendich (1994)). When the starting material is mRNA, Can be synthesized with cDNA using reverse transcriptase.

The present invention also provides a method for producing a nucleic acid comprising the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: And a primer capable of amplifying a polynucleotide consisting of 10-100 consecutive DNA sequences containing the above nucleotides or a complementary polynucleotide thereof.

Specifically, the primer is any one or more primers selected from the group consisting of SEQ ID NO: 6 to SEQ ID NO: 20.

The diagnostic kit may contain not only primers capable of amplifying the marker for meat quality diagnosis of the present invention, but also reagents necessary for the polymerization reaction such as dNTPs, various kinds of polymerase and coloring agents.

The term "amplifiable primer" refers to a template-directed DNA synthesis under appropriate conditions in an appropriate buffer (for example, four different nucleoside triphosphates and polymerase such as DNA, RNA polymerase or reverse transcriptase) Quot; oligonucleotide " The appropriate length of the primer may vary depending on the intended use, but is usually 15 to 30 nucleotides. Short primer molecules generally require a lower temperature to form a stable hybrid with the template. The primer sequence need not be completely complementary to the template, but should be sufficiently complementary to hybridize with the template.

The 251st nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4, and the 251st nucleotide of SEQ ID NO: , Or complementary polynucleotides thereof, is an accurate and useful Hanwoo meat quality diagnostic polymorphism (SNP) marker associated with beef tastes and is used for selecting and cultivating high quality meat of Hanwoo. It is possible to early selection regardless of age and gender, so that generation interval can be shortened, accuracy of selection can be increased, selection intensity can be increased, and plan crossbreeding can be made. will be.

Figure 1 shows 107 polymorphic SNPs of the LPL gene in Hanwoo.
Figure 2 shows the incidence of ¹⁺ grade abnormal SNPs and oleic acid content of the LPL gene.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the present invention is not limited by these examples.

< Example  1> LPL  A candidate for a gene SNPs  Identify location and genetic information

1. Experimental animals (Hanwoo)

According to the guidelines for the management of the Korean Hanwoo Specification, 513 genomic DNA samples, ability data, and individual samples from 26 to 33 months of age were collected from 14 cities and counties in Gyeongbuk province. Were used.

The sirloin of Korean beef cattle used in the present invention was taken from the thoracic spine 13, lumbar spine segment 1 and segment 38, and each tissue was stored at -80 ° C after removing fat.

2. The target trait

In the present invention, to analyze the correlation between economic traits and fatty acid composition and candidate SNPs of Korean beef cattle, the marbling score Backfat thickness, and carcass weight were analyzed.

Dimensions for experimental traits Shape Measurement standard Conductor Weight measured by the slaughterhouse Backfill thickness Measure the back room in mm 2/3 of the stomach area along the right side of the stomach muscle cross section in the grading area (1mm if the backing thickness is less than 1mm) Intramuscular fat map Degree of fat distribution on the cross section of the stomach muscle

[Source: Ministry of Agriculture and Forestry Notification No. 2009-344]

As shown in Table 1, the degree of fat distribution was determined by comparing the degree of fat distribution on the cross section of the stomach muscle at the grading site with that of the intramuscular fat level, and the back thickness was 2/3 toward the abdomen along the right side of the stomach muscle cross section The back room of the branch was measured in mm.

On the other hand, fatty acid composition was measured for myristic acid (C14: 0), palmitic acid (C16: 0) and stearic acid (C18: 0) (C14: 1), palmitoleic acid (C16: 1), and oleic acid (C18: 1), which are mono-unsaturated fatty acids, Fatty acids.

3. Fatty Acid Analysis

Approximately 450 g of sirloin tissue was sampled from 513 Korean beef cattle and finely pulverized. Each of them was finely pulverized, and 5 ml of chloroform: methanol (2: 1) was added with 2 ~ 3g of Folch method (Folch et al., 1957) The mixture was pulverized at 11,000 rpm for 2-3 minutes using a homogenizer (Polytron PT-MR-2100, Switzerland), and then filtered using a filter paper in a water bath (40 ° C).

The filtrate was mixed with distilled water, and the methanol and the water layer were removed. The chloroform and the lipid layer were removed by using nitrogen gas, and then BF3-methanol (14%) was treated and analyzed by transmetylation at 65 ° C. The total fatty acid composition was analyzed by gas chromatography (Perkin-Elmer CO, USA).

4. Melting point analysis

10 to 20 g of chopped Korean beef cattle, beef cattle, cows, beef cattle, Australian and American beef cattle were chopped and then placed in a 105 ° C dry- oven; Johnsam, Korea) for 4 hours.

1 cm of the extracted fat was placed in a capillary tube (tubes, capillary, 100 mm, open) and placed in a freezer (-20 ° C) for 24 hours. The melting point of the fat was measured while increasing the temperature by 1 ° C over 2 minutes on a hot stirrer.

5. Genomic DNA extraction

Genomic DNA extraction was performed by adding about 300 μl of Cell Lysis Solution (AL Buffer) to a 1.5 ml tube containing about 12 mg of Hanwoo tissue. Proteinase K (10 mg / Ml, Promega Co, USA) was added at a ratio of 1/100 of the total volume, and the plate was incubated at 37 ° C for 12 hours.

After the incubation, the same amount of TE (Tri-EDTA): phenol (1: 1) was added for protein precipitation and the DNA solution layer was collected by centrifugation at 3,000 rpm for 10 minutes The same amount of phenol: chloroform: iso-amylalchol (25: 24: 1) was added again, and the mixture was centrifuged at 3,000 rpm for 10 minutes, and then the DNA aqueous solution layer was collected again.

A double volume of ethyl ether was added and the white DNA aqueous solution layer was shaken until it became transparent, then centrifuged at 3,000 rpm for 5 minutes and ethyl ether was removed by volatilization. The DNA was condensed by adding 3M sodium acetate (pH 5.2) 1/10 times the total volume and 100% ethanol. The DNA was washed with 70 ml of ethanol (20 ml) Respectively.

After completely removing the ethanol, the DNA was dissolved by adding about 1 to 2 ml of TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) and stored at 4 ° C.

6. DNA quantitative analysis

Completely dissolved and then added to the quantitative analysis of DNA 50㎕ in the distilled water was diluted 20-fold 950㎕ spectrophotometer the DNA; and using (spectrophotometer SHIMADZU, Japan) measured in the 260nm and 280nm absorbance OD ₂₆₀ / OD ₂₈₀ ratio of about 1.8 to 2.0 was used.

7. SNP genotyping (genotyping)

SNP genotyping in the present invention Analysis (genotyping) was used for SBE (single-based extension, such as ^{Vreeland, 2002) ABI PRISM ® SNaPshot TM} Multiplex Kit (Applied Biosystems, Foster City, CA) using the method.

First, the NCBI database ( http://www.ncbi.nlm.nih.gov/ ) was used to identify candidate SNPs. Primers used in SNPs were primer3 software (http://frodo.wi.mit.edu/cgi- bin / primer3 / primer3_www.cgi). PCR was performed using the extracted DNA, and the conditions were as follows.

20ng genomic DNA, 0.25U Taq polymerase (Solgent Co., Ltd, South Korea), 1x buffer, 0.2mM dNTP, 5pmol primer (forward / reverse) The reaction was carried out at 35 ° C for 1 minute, 1 minute at 94 ° C for 30 seconds, 30 seconds at the synthesis temperature, 1 minute at 72 ° C, and 1 cycle at 72 ° C for 3 minutes. 1 [mu] l of the resulting PCR product was electrophoresed to confirm the product.

5U SAP (shrimp alkaline phosphatase) and 2U Exo I (exonuclease I, E. coli ) were added to the PCR products, mixed well and reacted at 37 ° C for 1 hour. After the reaction was completed, the mixture was inactivated at 75 DEG C for 15 minutes.

The ABI PRISM ^® SNaPshot ^™ Multiplex Kit (Applied Biosystems, Foster City, Calif.) Was used for the SBE reaction. 1 μl of the purified PCR product, 1 μl of the SNaPShot multiplex ready reaction mix, and 1 μl of 5 pmol SNaPShot primer were added to make a total of 10 μl. The mixture was mixed well at 96 ° C. for 10 seconds, 50 ° C. for 5 seconds, and 60 ° C. for 30 seconds 25 cycles. 1 U of SAP was added to the reacted PCR products, followed by incubation at 37 ° C for 1 hour and inactivation at 75 ° C for 15 minutes.

1 μl of the final PCR product was mixed with 0.25 μl of GeneScan-120 LIZ size standard (Applied Biosystems, Foster City, Calif.) And 9.5 μl of Hi-Di formamide (Applied Biosystems, Foster City, CA) Denatured at 95 ° C for 5 minutes, and then electrophoresed on an ABI PRISM 3130XL Genetic Analyzer. After the electrophoresis, the PCR product was subjected to automatic analysis by inputting data into GeneMapper v4.0 software (Applied Biosystems, Foster City, CA).

8. Statistical analysis method

Heterozygosity is the ratio of heterozygous individuals to the markers when randomly selected for a particular marker, and the value is between 0 and 1.

The larger the heterozygosity value, the greater the polymorphism of the marker and the higher the usefulness of the marker. The heterozygous ratio values are defined as follows.

H = 1 -? P _i ²

H = heterozygous ratio

P _i = the measured frequency value from the ith allele

However, within the gene, the Hardy-Weinberg equilibrium of the allele should be maintained, and the heterozygosity ratio has a maximum value when the allele frequency of the allele in the population is maintained.

9. Minor allele frequency

Haploview v4.2 (Barrett et al., 2005) program was used to investigate the heterozygosity rate and Minor allele frequency to see if the group has SNP efficiency. Minor allele frequency refers to the allele that indicates the lowest frequency of the SNP allele in the population. The heterozygosity ratio is the predicted heterozygosity value of the SNP. The model is as follows.

PredHET = 2 占 MAF 占 (1-MAF)

Here, MAF is the frequency of the minor allele.

10. Hardy-Weinberg equilibrium analysis

In the present invention, Haploviewer v4.2 (Barrett et al., 2005) was used to analyze the Hardy-Weinberg law and associated imbalance. Hardy-Weinberg equilibrium means that both genetic and genotypic frequencies will be equilibrated if external factors do not work. The group that satisfies this will have independence of allelic genotypes.

Therefore, the independence test within the locus was performed using the actual observation frequency and the expected frequency for each genotype category by the fit test using the χ ² statistic.

Where n is the number of observations, O is the observation frequency, and E is the expected frequency.

11. Association analysis of single genes

The association analysis of each SNPs was performed using SPSS v19.0 (SPSS Inc., Chicago, IL) as a measurement record of backfat thickness, intramuscular fat content and fatty acid composition among 513 conductors of general farmers belonging to the main product Hanwoo The following statistical models were used for the analysis of co-variance and significance.

Y _ijkl = μ + P _i + GS _j + SNP _k + β age _l + e _ijkl

Y _ijl = phenotype of carcass traits and fatty acid content,

μ = overall mean for each trait,

P_i = Fixed effect of place of delivery,

GS _j = The effect of fertilizer on seeds,

SNP _k = fixed effect of marker genotype,

βage _l = Covariance to slaughter age,

e _ijkl = inference error.

12. Genetic information of candidate SNPs of the LPL gene

The SNP selection for LPL was selected from 107 SNPs with genomic DNA exon, intron and 3 'UTR mutations in Genbank Number NC_007306, The location of the SNPs is detailed in FIG.

The LPL gene is composed of 9 exons, especially the exon2 region g.6960 A> T SNPs, because the base is changed from A to T CA region, the amino acid sequence is replaced by serine from threonine Is a non-synonymous SNP.

The polymorphisms of 107 candidate SNPs were confirmed and polymorphism was confirmed in 49 SNPs. To investigate the informativeness and diversity as SNP markers and the ratio of the same genotype to the next generation, H, MAF and HWE values Respectively.

Genotype and frequency of 49 polymorphic SNPs in LPL gene in Hanwoo SNP location Genotype (head count)
frequency H ¹ MAF ² HWE ³ g.337 C> T Intron CC (25) CT (17) TT (2) N ⁴ (44) 0.363 0.239 0.675 0.568 0.386 0.045 One g.1234 G> T GG (2) GT (14) TT (28) N (44) 0.325 0.205 0.883 0.045 0.318 0.636 One g.3844 C> T CC 23 CT (17) TT (4) N (44) 0.407 0.284 0.739 0.523 0.386 0.091 One g.4335 G> A GG (40) GA (2) AA (2) N (44) 0.127 0.068 0.000 0.909 0.045 0.045 One g.5386 A> T AA (2) AT (12) TT (30) N (44) 0.297 0.182 0.580 0.045 0.273 0.682 One g.6960 A> T Exon2 AA (9) AT (24) TT (11) N (44) 0.498 0.390 0.536 0.205 0.545 0.250 One g.6974 G> A GG (26) GA (15) AA (3) N (44) 0.363 0.239 0.681 0.591 0.341 0.068 One g.7342 C> T Intron CC (2) CT (16) TT (26) N (44) 0.351 0.227 0.814 0.045 0.364 0.591 One g.7372 C> A CC (17) CA (25) AA (2) N (44) 0.441 0.386 0.057 0.386 0.568 0.045 One g.7377 G> C GG (2) GC 16 CC 26 N (44) 0.351 0.227 0.814 0.045 0.364 0.591 One g.7458 G> T GG (38) GT (4) TT (2) N (44) 0.165 0.091 0.003 0.864 0.091 0.045 One

SNP location Genotype (head count)
frequency H ¹ MAF ² HWE ³ g.10437 C> T Intron CC 23 CT (19) TT (2) N (44) 0.386 0.261 0.432 0.523 0.432 0.045 One g.11162 C> T CC (14) The CT (26) TT (4) N (44) 0.474 0.386 0.102 0.318 0.591 0.091 One g.12326 G> A GG (22) GA (14) AA (8) N (44) 0.449 0.341 0.052 0.500 0.318 0.182 One g.12359 G> A GG (22) GA (18) AA (4) N (44) 0.416 0.295 0.908 0.500 0.409 0.091 One g.12482A> G AA (15) AG (18) GG (11) N (44) 0.495 0.455 0.245 0.341 0.409 0.250 One g.12795A> G AA (23) AG (19) GG (2) N (44) 0.386 0.261 0.432 0.523 0.432 0.045 One g.13219 C > T CC (5) CT (18) TT (21) N (44) 0.433 0.318 0.705 0.114 0.409 0.477 One g.13662 C> A CC (24) CA (18) AA (2) N (44) 0.375 0.250 0.546 0.545 0.409 0.045 One g.13775 T> G Exon3 TT (19) TG (22) GG (8) N (44) 0.474 0.294 0.703 0.432 0.500 0.068 One g.13915 C> T Intron CC 23 CT (19) TT (2) N (44) 0.386 0.261 0.432 0.523 0.432 0.045 One g.13949 G> A GG (2) GA (19) AA (23) N (44) 0.386 0.261 0.432 0.045 0.432 0.523 One g.14095 A> T AA (4) AT (7) TT (33) N (44) 0.282 0.170 0.003 0.091 0.159 0.750 One g.14220 A> C AA (15) AC (17) CC (12) N (44) 0.497 0.466 0.137 0.341 0.386 0.273 One g.14240 C> T CC 23 CT (19) TT (2) N (44) 0.386 0.261 0.432 0.523 0.432 0.045 One g.14606 C > T CC (2) CT 21 TT (21) N (44) 0.407 0.284 0.250 0.045 0.477 0.477 One g.14832 G> T GG (2) GT (14) TT (28) N (44) 0.325 0.205 0.882 0.045 0.318 0.636 One

SNP location Genotype (head count)
frequency H ¹ MAF ² HWE ³ g.17103 G> A Intron GG (18) GA (24) AA (2) N (44) 0.433 0.318 0.088 0.409 0.545 0.045 One g.17274 G> A GG (31) GA (9) AA (4) N (44) 0.311 0.193 0.022 0.705 0.205 0.091 One g.19614 G> C GG (2) GC (25) CC (17) N (44) 0.442 0.330 0.058 0.045 0.568 0.386 One g.19706 C> T CC (5) CT (17) TT (22) N (44) 0.425 0.307 0.543 0.114 0.386 0.500 One g.19789 C> T CC 31 CT (11) TT (2) N (44) 0.283 0.170 0.442 0.705 0.250 0.045 One g.21199 G> A GG (21) GA (17) AA (6) N (44) 0.442 0.330 0.404 0.477 0.386 0.136 One g.21604 G> A GG (14) GA (14) AA (16) N (44) 0.498 0.477 0.016 0.318 0.318 0.364 One g.22076 G> A GG (26) GA (16) AA (O) N (42) 0.308 0.193 0.127 0.591 0.364 0.000 One g.22488 G> T GG (18) GT (8) TT (18) N (44) 0.500 0.250 0.066 0.409 0.182 0.409 One g.22505 C> T CC 23 CT (18) TT (2) N (43) 0.380 0.500 0.514 0.523 0.409 0.045 One g.22550 C> T CC 22, CT (19) TT (3) N (44) 0.406 0.284 0.682 0.500 0.432 0.068 One g.22649 G> A Exon9 GG (22) GA (16) AA (6) N (44) 0.434 0.318 0.283 0.500 0.364 0.136 One g.23624 G> A Intron GG (23) GA (19) AA (2) N (44) 0.386 0.261 0.432 0.523 0.432 0.045 One g.23735 C> T CC (2) CY (18) TT (24) N (44) 0.375 0.250 0.546 0.045 0.409 0.545 One g.24660 C > T CC (2) CT (24) TT (18) N (44) 0.433 0.318 0.089 0.045 0.545 0.409 One g.25478 A> T 3'UTR AA (23) AT (15) TT (6) N (44) 0.425 0.307 0.187 0.523 0.341 0.136 One g.25670 C > T CC 20, CT (10) TT (14) N (44) 0.491 0.500 0.758 0.454 0.227 0.319 One g.25736 C> T CC (2) CT (19) TT (23) N (44) 0.386 0.261 0.432 0.045 0.432 0.523 One g.26274 G> T GG (18) GT (15) TT (11) N (44) 0.487 0.420 0.046 0.409 0.341 0.250 One g.26310 C> T CC 35 CT (7) TT (2) N (44) 0.218 0.125 0.070 0.795 0.159 0.045 One g.26667 C> T CC (19) CT (15) TT (10) N (44) 0.479 0.398 0.055 0.432 0.341 0.227 One g.26710A> G AA (19) AG 23, GG (2) N (44) 0.425 0.307 0.128 0.432 0.523 0.045 One

¹ heterozygosity, ² minimum allele frequency, ³ Hardy-Weinberg values, ⁴ whole heads

Because 49 HSPE polymorphism SNPs in the LPL gene were not 0, all 49 candidate SNPs with polymorphism were selected and the minor allele frequency of 49 selected SNPs Higher than 0.100.

To identify the SNPs associated with beef tastes, we first selected 44 SNPs with a high content of oleic acid (C18: 1) and 44 SNPs with low specificity, 7.

The frequency of high and low groups of fatty acids in 49 polymorphic SNPs of LPL gene in Hanwoo SNP location Frequency of genotype (number) Note
Probability ¹ all High fatty acid group Low Fatty Acids Group frequency frequency g.337 C> T Intron CC (12) CT (9) TT (1) CC (13) CT (8) TT (1) 0.952 N ² (44) 0.545 0.409 0.045 0.591 0.364 0.045 One g.1234 G> T GG (1) GT (7) TT (14) GG (1) GT (7) TT (14) 1,000 N (44) 0.450 0.318 0.636 0.450 0.318 0.636 One g.3844 C> T CC (11) CT (9) TT (2) CC (12) CT (8) TT (2) 0.950 N (44) 0.500 0.409 0.091 0.545 0.364 0.091 One g.4335 G> A GG (20) GA (1) AA (1) GG (20) GA (1) AA (1) 1,000 N (44) 0.909 0.045 0.045 0.909 0.045 0.045 One g.5386 A> T AA (1) AT (6) TT (15) AA (1) AT (6) TT (15) 1,000 N (44) 0.045 0.273 0.682 0.045 0.273 0.682 One g.6960 A> T Exon2 AA  (8) AT  (12) TT  (2) AA  (One) AT  (12) TT  (9) 0.015 N (44) 0.365 0.545 0.090 0.045 0.545 0.410 One g.6974 G> A GG  (17) GA  (5) AA  (0) GG  (9) GA  (10) AA  (3) 0.028 N (44) 0.773 0.227 0.000 0.409 0.455 0.136 One g.7342 C> T Intron CC (1) CT (7) TT (14) CC (1) CT (9) TT (12) 0.817 N (44) 0.045 0.318 0.636 0.045 0.409 0.545 One g.7372 C> A CC (8) CA (13) AA (1) CC (9) CA (12) AA (1) 0.952 N (44) 0.364 0.591 0.045 0.409 0.545 0.045 One g.7377 G> C GG (1) GC (8) CC (13) GG (1) GC (8) CC (13) 1,000 N (44) 0.045 0.364 0.591 0.045 0.364 0.591 One g.7458 G> T GG (19) GT (2) TT (1) GG (19) GT (2) TT (1) 1,000 N (44) 0.864 0.091 0.045 0.864 0.091 0.045 One g.10437 C> T CC (11) CT (10) TT (1) CC (12) CT (9) TT (1) 0.953 N (44) 0.500 0.455 0.045 0.545 0.409 0.045 One g.11162 C> T CC (7) CT (13) TT (2) CC (7) CT (13) TT (2) 1,000 N (44) 0.318 0.591 0.091 0.318 0.591 0.091 One g.12326 G> A GG (10) GA (8) AA (4) GG (12) GA (6) AA (4) 0.792 N (44) 0.455 0.364 0.182 0.545 0.273 0.182 One g.12359 G> A GG (10) GA (10) AA (2) GG (12) GA (8) AA (2) 0.817 N (44) 0.455 0.455 0.091 0.545 0.364 0.091 One g.12482A> G AA (7) AG (9) AG (6) AA (8) AG (9) GG (5) 0.924 N (44) 0.318 0.409 0.273 0.364 0.409 0.227 One

SNP location Frequency of genotype (number) Note
Probability ¹ all High fatty acid group Low Fatty Acids Group frequency frequency g.12795A> G Intron AA (11) AG (10) GG (1) AA (12) AG (9) GG (1) 0.953 N (44) 0.500 0.455 0.045 0.545 0.409 0.045 One g.13219 C > T CC (3) CT (9) TT (10) CC (2) CT (9) TT (11) 0.884 N (44) 0.136 0.409 0.455 0.091 0.409 0.500 One g.13662 C> A CC (12) CA (9) AA (1) CC (12) CA (9) AA (1) 1,000 N (44) 0.545 0.409 0.045 0.545 0.409 0.045 One g.13775 T> G Exon3 TT (19) GT (2) GG (1) TT (19) GT (2) GG (1) 1,000 N (44) 0.864 0.091 0.045 0.864 0.091 0.045 One g.13915 C> T Intron CC (11) CT (10) TT (1) CC (12) CT (9) TT (1) 0.953 N (44) 0.500 0.455 0.045 0.545 0.409 0.045 One g.13949 G> A GG (1) GA (10) AA (11) GG (1) GA (9) AA (12) 0.953 N (44) 0.045 0.455 0.500 0.045 0.409 0.545 One g.14095 A> T AA (2) AT (4) TT (16) AA (2) AT (3) TT (17) 0.917 N (44) 0.091 0.182 0.727 0.091 0.136 0.773 One g.14220 A> C AA (8) AC (8) CC (8) AA (7) AC (9) CC (6) 0.939 N (44) 0.364 0.364 0.273 0.318 0.409 0.273 One g.14240 C> T CC (11) CT (10) TT (1) CC (12) CT (9) TT (1) 0.953 N (44) 0.500 0.455 0.045 0.545 0.409 0.045 One g.14606 C > T CC (1) CT (11) TT (10) CC (1) CT (10) TT (11) 0.953 N (44) 0.045 0.500 0.455 0.045 0.455 0.500 One g.14832 G> T GG (1) GT (8) TT (13) GG (1) GT (6) TT (15) 0.807 N (44) 0.045 0.364 0.591 0.045 0.273 0.682 One g.17103 G> A GG (8) GA (13) AA (1) GG (10) GA (11) AA (1) 0.000 N (44) 0.364 0.591 0.045 0.455 0.500 0.045 One g.17274 G> A GG (15) GA (5) AA (2) GG (16) GA (4) AA (2) 0.931 N (44) 0.682 0.227 0.091 0.727 0.182 0.091 One g.19614 G> C GG (1) GC 13 CC (8) GG (1) GC (12) CC (9) 0.952 N (44) 0.045 0.591 0.364 0.045 0.545 0.409 One g.19706 C> T CC (3) CT (8) TT (11) CC (2) CT (9) TT (11) 0.879 N (44) 0.136 0.364 0.500 0.091 0.409 0.500 One g.19789 C> T CC (15) CT (6) TT (1) CC (16) CT (5) TT (1) 0.940 N (44) 0.682 0.273 0.045 0.727 0.227 0.045 One g.21199 G> A GG (10) GA (9) AA (3) GG (11) GA (8) AA (3) 0.948 N (44) 0.455 0.409 0.136 0.500 0.364 0.136 One

SNP location Frequency of genotype (number) Note
Probability ¹ all High fatty acid group Low Fatty Acids Group frequency frequency g.21604 G> A Intron GG  (7) GA  (11) AA  (4) GG  (7) GA  (3) AA  (12) 0.014 N (44) 0.318 0.500 0.182 0.318 0.136 0.545 One g.22076 G> A GG (12) GA (9) AA (O) GG (14) GA (7) AA (O) 0.751 N (42) 0.571 0.429 0.000 0.667 0.333 0.000 One g.22488 G> T GG  (13) GT  (4) TT  (5) GG  (5) GT  (4) TT  (13) 0.029 N (44) 0.591 0.182 0.227 0.227 0.182 0.591 One g.22505 C> T CC (11) CT (9) TT (1) CC (12) CT (9) TT (1) 0.944 N (43) 0.524 0.429 0.048 0.545 0.409 0.045 One g.22550 C> T CC (10) CT (10) TT (2) CC (12) CT (9) TT (1) 0.753 N (44) 0.455 0.455 0.091 0.545 0.409 0.045 One g.22649 G> A Exon9 GG  (10) GA  (11) AA  (One) GG  (12) GA  (5) AA  (5) 0.078 N (44) 0.455 0.500 0.045 0.545 0.227 0.227 One g.23624 G> A Intron GG (11) GA (10) AA (1) GG (12) GA (9) AA (1) 0.953 N (44) 0.500 0.455 0.045 0.545 0.409 0.045 One g.23735 C> T CC (1) CT (9) TT (12) CC (1) CT (9) TT (12) 1,000 N (44) 0.045 0.409 0.545 0.045 0.409 0.545 One g.24660 C > T CC (1) CT (10) TT (11) CC (1) CT (14) TT (7) 0.459 N (44) 0.045 0.455 0.500 0.045 0.636 0.318 One g.25478 A> T 3'UTR AA (10) AT (9) TT (3) AA (13) AT (6) TT (3) 0.609 N (44) 0.455 0.409 0.136 0.591 0.273 0.136 One g.25670 C > T CC  (12) CT  (6) TT  (4) CC  (8) CT  (4) TT  (10) 0.039 N (44) 0.545 0.273 0.182 0.363 0.181 0.456 One g.25736 C> T CC (1) CT (10) TT (11) CC (1) CT (9) TT (12) 0.953 N (44) 0.045 0.455 0.500 0.045 0.409 0.545 One g.26274 G> T GG (9) GT (8) TT (5) GG (9) GT (7) TT (6) 0.924 N (44) 0.409 0.364 0.227 0.409 0.318 0.273 One g.26310 C> T CC (17) CT (4) TT (1) CC (18) CT (3) TT (1) 0.918 N (44) 0.773 0.182 0.045 0.818 0.136 0.045 One g.26667 C> T CC (9) CT (8) TT (5) CC (10) CT (7) TT (5) 0.942 N (44) 0.409 0.364 0.227 0.455 0.318 0.227 One g.26710A> G AA (10) AG (11) GG (1) AA (9) AG (12) GG (1) 0.953 N (44) 0.455 0.500 0.045 0.409 0.545 0.045 One

¹ χ ² black, ² whole heads.

From the results of Tables 5 to 7, g. 6960 A> T and g. 6997 G> A SNPs located in the exon 2 region among the 49 candidate SNPs, g.21604 G> A SNPs in the intron region, And g.22488 G> T SNPs, g.22649 G> A SNP of exon 9, and g.25670 C> T SNP of 3'UTR. In all six candidate SNPs, high fatty acid group and low fatty acid group And the frequency difference was at least 25%. However, the remaining 43 candidate SNPs showed little difference.

G.6960 A> T in the exon 2 region showed a difference of more than 32.0% in the AA and TT genotypes in the high and low fatty acid groups (P <0.015), g.6974 G> A There was also a statistically significant difference in GG genotype frequency by 36.4% or more (P <0.025).

G.21604 G> A and g.22488 G> T of unsaturated fatty acids differ from the AA and GG genotype of SNPs between groups I and showed a 36.3%, higher than 36.4% χ ² difference test results in an intron (intron) regions And also significant differences were found in.

G.22649 G> A in exon 9 showed 27.3% difference in GA genotype frequency, but there was no significant difference.

The SNPs of g.25670 C> T in the 3'UTR showed 27.4% difference in TT genotype frequency and showed significant difference.

< Example  2> LPL  Present in a gene SNPs Fatty Acid Composition and Economic Traitability Test

1. Introns of the LPL gene and SNPs of the 3'UTR portion

In Tables 8 to 10, g.21604 G> A and g.22488 G> T in the intron region, g.25670 C> T SNPs in the 3'UTR region of the three candidate SNPs, Intramuscular fatigue The co - variance analysis was performed for each trait, the backbone thickness, and the ability of each genotype in the conductor.

First, in the conductors of Hanwoo, the most significant difference was 433.41kg and 434.33kg in G2 genotype of g.22488 G> T in the intron region and T5 genotype of g.25670 C> T in the 3'UTR region, The CT genotype of g.25670 C> T in the 3'UTR region was the lowest at 12.55mm in the thickness of the room.

On the other hand, we could see that CT genotypes of g.21604 G> A GG, g.22488 G> T GG, and g.25670 C> T were highest at 5.50, 5.57, and 5.89, respectively. On the other hand, only GG genotype of g.22488 G> T in the intron region was significantly different at 28.68 ℃ in melting point.

In the intron region g.21604 G> A and g.22488 G> T, the AA and TT genotypes were 26.55% and 27.05%, respectively, in the palmitic acid (C16: 0) (C16: 0) in the case of myristic acid (C14: 0) and stearic acid (C18: 0), which are one of the saturated fatty acids, g.21604 G> A, g. TT and TT genotypes of 22488 G> T and g.25670 C> T, respectively, and 42.17% of AA, TT and TT genotypes of these SNPs were also compared with the total content of saturated fatty acids (C14: 0) and stearic acid (C18: 0), which were 42.76% and 40.79%, respectively.

In contrast, the content of oleic acid (C18: 1), which occupies the largest percentage of the unsaturated fatty acid composition, was 44.51%, 44.95% in the CT genotype of g.22488 G> T GG and g.25670 C> T, contrary to the tendency of saturated fatty acid. (P <0.001). G. giA of G.21604 and GA genotype of GA were 44.35% and 44.69%, respectively, which were significantly higher than AA genotype.

The total content of monounsaturated fatty acids was also similar to that of oleic acid (C18: 1). G.22488 G> T GG, g.25670 C> T CT, g.21604 G> A GG, GA genotype 53.77%, 54.64 % And 53.60%, 53.83%, respectively.

GG, GT of g.22488 G> T, CC and CT of g.25670 C> T, and GG and GA genotype of g.21604 G> A at the ratio of omega 3 / omega 6 also have different genotypes The ratio of 1: 8.66, 1: 8.31 and 1: 8.08, 1: 8.35, 1: 8.33 and 1: 8.00, respectively.

Therefore, all of the three candidate SNPs are closely related to the unsaturated fatty acids affecting the taste, so they are likely to be used as markers of the auxiliary means related to the taste of beef.

characteristics g.21604 G> A GG GA AA (N = 254) (N = 216) (N = 43) LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 426.27 + - 2.67 428.95 + - 2.94 424.42 + - 7.38 ns Backing Thickness (mm) 13.63 + - 0.33 12.69 + - 0.33 13.47 + - 0.76 ns Rating (1-9) 5.50 + - 0.12 ^b 5.46 + 0.14 ^b 4.81 ± 0.28 ^a * Melting point (캜) 29.57 + - 0.65 29.95 ± 0.78 31.33 + - 1.22 ns Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.66 + 0.04 ^a 3.55 + 0.04 ^a 3.93 ± 0.11 ^b ** Palmitic acid (C16: 0) 25.69 + - 0.12 ^a 25.42 + - 0.14 ^a 26.55 ± 0.27 ^b ** Stearic acid (C18: 0) 10.46 ± 0.09 10.46 ± 0.09 10.70 ± 0.23 ns Unsaturated fatty acid Myristic acid (C14: 1) 1.24 ± 0.03 1.22 ± 0.02 1.33 + 0.06 ns Palmitoleic acid (C16: 1) 6.62 + 0.06 6.57 ± 0.06 6.73 + 0.17 ns Oleic acid (C18: 1) 44.35 ± 0.16 ^b 44.69 ± 0.18 ^b 42.07 + - 0.32 ^a *** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 3.00 ± 0.05 ^a 2.96 + 0.05 ^a 3.47 0.10 ^b *** Omega 3 (C18: 3n3) 0.36 + 0.01 ^b 0.37 + 0.01 ^b 0.23 0.02 ^a *** Omega 3 / Omega 6 1: 8.33 1: 8.00 1: 15.09 Total content of saturated fatty acids 40.62 + 0.17 ^a 40.28 ± 0.20 ^a 42.17 + - 0.42 ^b *** Total content of monounsaturated fatty acids 53.60 ± 0.18 ^b 53.83 + - 0.21 ^b 51.31 + 0.39 ^a ***

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

characteristics g.22488 G> T GG GT TT (N = 227) (N = 242) (N = 44) LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 433.41 + - 2.95 ^b 423.45 ± 2.69 ^ab 416.32 ± 6.31 ^a ** Backing Thickness (mm) 13.72 ± 0.36 12.67 + - 0.30 13.66 + - 0.81 ns Rating (1-9) 5.57 + - 0.13 ^b 5.38 ± 0.13 ^ab 4.95 ± 0.28 ^a * Melting point (캜) 28.68 ± 0.72 ^a 29.52 + 0.71 ^a 33.67 ± 1.02 ^b *** Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.61 ± 0.04 ^a 3.61 ± 0.04 ^a 3.93 ± 0.11 ^b ** Palmitic acid (C16: 0) 25.47 ± 0.13 ^a 25.57 ± 0.12 ^a 27.05 + - 0.30 ^b *** Stearic acid (C18: 0) 10.40 ± 0.09 ^a 10.43 + 0.09 ^a 11.15 ± 0.23 ^b ** Unsaturated fatty acid Myristic acid (C14: 1) 1.25 + - 0.03 ^b 1.27 + 0.02 ^b 1.07 ± 0.06 ^a ** Palmitoleic acid (C16: 1) 6.66 + 0.07 6.59 + 0.06 6.42 + 0.15 ns Oleic acid (C18: 1) 44.51 + - 0.17 ^b 44.44 + 0.16 ^b 42.45 + 0.39 ^a *** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 3.03 ± 0.05 2.99 ± 0.05 3.19 ± 0.09 ns Omega 3 (C18: 3n3) 0.35 ± 0.01 0.36 ± 0.01 0.30 0.02 ns Omega 3 / Omega 6 1: 8.66 1: 8.31 1: 10.63 Total content of saturated fatty acids 40.31 ± 0.19 ^a 40.49 + 0.17 ^a 42.76 ± 0.41 ^b *** Total content of monounsaturated fatty acids 53.77 ± 0.20 ^b 53.62 ± 0.18 ^b 51.47 ± 0.44 ^a ***

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

characteristics g.25670 C > T CC CT TT all (N = 248) (N = 97) (N = 168) (N = 513) LSmean ± SE LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 422.80 +/- 2.63 ^a 426.35 ± 4.47 ^ab 434.33 + - 3.45 ^b 427.25 ± 1.91 * Backing Thickness (mm) 12.92 ± 0.31 ^ab 12.55 + 0.42 ^a 14.04 0.45 ^b 13.22 ± 0.23 * Rating (1-9) 5.31 ± 0.12 ^a 5.89 ± 0.19 ^b 5.33 + 0.15 ^a 5.43 + 0.09 * Melting point (캜) 30.35 + 0.71 28.69 ± 0.90 30.20 ± 0.91 29.81 + - 0.48 ns Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.64 + 0.04 3.68 ± 0.07 3.61 ± 0.05 3.64 ± 0.03 ns Palmitic acid (C16: 0) 25.71 + - 0.12 25.48 + 0.24 25.66 + - 0.14 25.65 + 0.09 ns Stearic acid (C18: 0) 10.55 + 0.09 ^b 10.14 ± 0.12 ^a 10.58 ± 0.11 ^b 10.48 ± 0.06 * Unsaturated fatty acid Myristic acid (C14: 1) 1.24 ± 0.02 1.28 + 0.04 1.22 + 0.03 1.24 ± 0.02 ns Palmitoleic acid (C16: 1) 6.55 ± 0.06 ^a 6.86 ± 0.10 ^b 6.54 + 0.07 ^a 6.61 + 0.04 * Oleic acid (C18: 1) 44.31 ± 0.17 ^ab 44.95 ± 0.31 ^b 43.91 + 0.18 ^a 44.30 ± 0.12 ** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 2.99 ± 0.05 ^a 2.84 ± 0.08 ^a 3.18 ± 0.06 ^b 3.02 + 0.03 *** Omega 3 (C18: 3n3) 0.37 ± 0.01 0.34 + 0.02 0.33 + 0.02 0.35 ± 0.01 ns Omega 3 / Omega 6 1: 8.08 1: 8.35 1: 9.64 1: 8.63 Total content of saturated fatty acids 40.73 + - 0.18 ^b 39.96 + 0.32 ^a 40.79 ± 0.21 ^b 40.60 ± 0.13 * Total content of monounsaturated fatty acids 53.45 ± 0.18 ^a 54.62 ± 0.34 ^b 52.94 + 0.21 ^a 53.50 + - 0.13 ***

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

2. SNPs in the exon part of the LPL gene

In Table 11 to Table 13, g.6960 A> T, g. 6974 G> A of exon2 region and g.22649 G> A region of exon 9 region among the three candidate SNPs were analyzed in the same manner as described above Respectively.

First, in the case of the conductors, the highest difference was found between the AA genotype of g6974 G> A in the exon2 region and the GG genotype of g.22649 G> A in the exon 9 region as 441.84 kg and 431.35 kg, In the case of G. genitalia of g.6960 A> T in exon2 region and AG and GG genotype of g.22649 G> A in exon 9 region, 12.49mm, 12.51mm and 13.52mm were significantly lower have.

G.6960 A> T and g.6974 G> A AA and AA genotypes of exon2 region showed the greatest difference (5.6 and 6.31) (P <0.05). On the other hand, there was no significant difference in melting point among all three SNPs.

The total content of saturated fatty acids was 40.30%, 39.01% and 40.46% when the AG genotype of g.6960 A> T AA, g.6974 G> A AA and g.22649 G> (C18: 1) and monounsaturated fatty acids, 44.59%, 53.78% and 46.32%, 55.42%, 44.53% and 53.70%, respectively, compared to the values of saturated fatty acids I could see a point formed high.

The ratio of omega-3 / omega-6 was also 1: 8.08, 1: 5.59, and 1: 7.76. Especially, all three SNPs showed the same tendency to oleic acid (C18: 1) and monounsaturated fatty acid and grade which play a crucial role in taste.

characteristics g.6960 A> T AA AT TT (N = 201) (N = 224) (N = 88) LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 424.90 ± 3.06 428.91 + - 2.89 428.39 + - 4.62 ns Backing Thickness (mm) 12.49 + - 0.35 ^a 13.49 ± 0.34 ^ab 14.18 ± 0.58 ^b * Rating (1-9) 5.64 + 0.14 ^b 5.42 ± 0.13 ^ab 4.98 ± 0.19 ^a * Melting point (캜) 29.58 + - 0.94 29.60 ± 0.59 30.76 ± 1.20 ns Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.58 ± 0.05 3.65 + 0.04 3.74 ± 0.07 ns Palmitic acid (C16: 0) 25.42 + 0.14 25.75 ± 0.13 25.93 + - 0.20 ns Stearic acid (C18: 0) 10.49 + - 0.10 10.44 + 0.09 10.58 ± 0.16 ns Unsaturated fatty acid Myristic acid (C14: 1) 1.26 + 0.03 1.23 + 0.02 1.25 ± 0.05 ns Palmitoleic acid (C16: 1) 6.61 + 0.07 6.58 ± 0.06 6.67 ± 0.10 ns Oleic acid (C18: 1) 44.59 ± 0.20 ^b 44.39 + - 0.17 ^b 43.41 ± 0.25 ^a ** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 2.99 ± 0.05 ^a 2.98 ± 0.05 ^a 3.20 ± 0.07 ^b * Omega 3 (C18: 3n3) 0.37 + 0.02 ^b 0.35 + 0.01 ^ab 0.30 0.02 ^a * Omega 3 / Omega 6 1: 8.08 1: 8.51 1: 10.67 Total content of saturated fatty acids 40.30 ± 0.22 ^a 40.65 ± 0.18 ^ab 41.16 ± 0.29 ^b * Total content of monounsaturated fatty acids 53.78 ± 0.23 ^b 53.57 ± 0.18 ^b 52.71 ± 0.31 ^a *

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

characteristics g.6974 G> A GG GA AA (N = 425) (N = 56) (N = 32) LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 427.84 ± 2.08 ^ab 414.39 ± 5.96 ^a 441.84 + - 7.30 ^b * Backing Thickness (mm) 13.46 ± 0.26 11.64 ± 0.59 12.72 + - 0.72 ns Rating (1-9) 5.35 ± 0.09 ^a 5.54 ± 0.27 ^a 6.31 ± 0.38 ^b * Melting point (캜) 29.86 ± 0.53 29.47 ± 1.64 29.68 ± 1.52 ns Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.68 ± 0.03 ^b 3.49 ± 0.09 ^ab 3.34 + 0.10 ^a ** Palmitic acid (C16: 0) 25.80 ± 0.09 ^b 25.15 ± 0.25 ^ab 24.53 + - 0.43 ^a *** Stearic acid (C18: 0) 10.48 ± 0.07 10.57 ± 0.20 10.29 ± 0.23 ns Unsaturated fatty acid Myristic acid (C14: 1) 1.25 + 0.02 1.17 + 0.04 1.19 ± 0.06 ns Palmitoleic acid (C16: 1) 6.64 ± 0.05 6.44 ± 0.13 6.51 ± 0.15 ns Oleic acid (C18: 1) 44.02 + - 0.12 ^a 45.28 + - 0.34 ^b 46.32 + -0.57 ^c *** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 3.08 ± 0.04 ^b 2.82 ± 0.11 ^ab 2.57 ± 0.17 ^a *** Omega 3 (C18: 3n3) 0.34 + 0.01 ^a 0.38 + 0.03 ^a 0.46 + 0.04 ^b ** Omega 3 / Omega 6 1: 9.06 1: 7.42 1: 5.59 Total content of saturated fatty acids 40.79 + - 0.14 ^b 40.07 ± 0.38 ^b 39.01 ± 0.59 ^a *** Total content of monounsaturated fatty acids 53.26 + 0.14 ^a 54.28 ± 0.39 ^a 55.42 ± 0.64 ^b ***

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

characteristics g.22649 G> A AA AG GG all (N = 35) (N = 221) (N = 257) (N = 513) LSmean ± SE LSmean ± SE LSmean ± SE LSmean ± SE Conductor weight (kg) 415.11 + - 6.72 ^a 424.39 ± 2.86 ^ab 431.35 ± 2.75 ^b 427.25 ± 1.91 * Backing Thickness (mm) 15.43 + - 0.87 ^b 12.51 + - 0.33 ^a 13.52 + 0.33 ^a 13.22 ± 0.23 ** Rating (1-9) 5.11 + - 0.33 5.35 + 0.13 5.53 + - 0.12 5.43 + 0.09 ns Melting point (캜) 31.11 + - 1.85 30.13 + - 0.76 29.31 ± 0.65 29.81 + - 0.48 ns Fatty acid composition (%) Saturated fatty acid Myristic acid (C14: 0) 3.78 ± 0.12 3.60 + 0.04 3.65 + 0.04 3.64 ± 0.03 ns Palmitic acid (C16: 0) 26.50 ± 0.30 ^b 25.54 + 0.13 ^a 25.63 + - 0.12 ^a 25.65 + 0.09 * Stearic acid (C18: 0) 11.06 + - 0.30 ^b 10.49 + 0.09 ^a 10.40 ± 0.08 ^a 10.48 ± 0.06 * Unsaturated fatty acid Myristic acid (C14: 1) 1.18 ± 0.07 1.27 + 0.03 1.23 + 0.02 1.24 ± 0.02 ns Palmitoleic acid (C16: 1) 6.43 + - 0.20 6.56 ± 0.06 6.67 ± 0.06 6.61 + 0.04 ns Oleic acid (C18: 1) 43.02 + - 0.43 ^a 44.53 + - 0.18 ^b 44.27 ± 0.16 ^b 44.30 ± 0.12 ** Polyunsaturated fatty acid Omega 6 (C18: 2n6) 3.34 ± 0.12 ^b 2.95 ± 0.05 ^a 3.04 + 0.05 ^a 3.02 + 0.03 * Omega 3 (C18: 3n3) 0.27 ± 0.03 ^a 0.38 + 0.01 ^b 0.34 + 0.01 ^b 0.35 ± 0.01 ** Omega 3 / Omega 6 1: 12.37 1: 7.76 1: 8.94 1: 8.63 Total content of saturated fatty acids 42.17 + - 0.46 ^b 40.46 ± 0.19 ^a 40.51 ± 0.18 ^a 40.60 ± 0.13 ** Total content of monounsaturated fatty acids 51.98 ± 0.51 ^a 53.70 ± 0.20 ^b 53.54 ± 0.18 ^b 53.50 + - 0.13 **

^{a, b, c} forensic analysis - significant probability test with multiple comparison (P <0.05), * p <0.05, ** p <0.01, *** p <0.001, ns = no effect.

< Example  3> LPL  gene SNPs And oleic acid and meat grade distribution

One of the important economic traits in the Hanwoo industry, g.6960 A> T and g.6974 G> A in the exon2 region and g.21604 G in the intron region, > A, g.22488 G> T and g.25670 C> T in 3'UTR are shown in Table 14 and Fig.

Oleic acid and grade distribution table of polymorphic SNPs SNP location genotype Oleic acid Rating all 1 ⁺⁺ 1 ⁺ One 2 ¹⁺ g.6960 A> T Exon2 AA 44.59 ± 0.20 ^b 45 70 52 34 115 201 22.40% 34.80% 25.90% 16.90% 57.20% 100% AT 44.39 + - 0.17 ^b 31 91 62 40 122 224 13.80% 40.60% 27.70% 17.90% 54.40% 100% TT 43.41 ± 0.25 ^a 3 46 18 21 49 88 3.40% 52.30% 20.50% 23.90% 55.70% 100% g.6974 G> A GG 44.02 + - 0.12 ^a 59 171 117 78 230 425 13.90% 40.20% 27.50% 18.40% 54.10% 100% GA 45.28 + - 0.34 ^b 10 24 9 13 34 56 17.90% 42.90% 16.10% 23.20% 60.80% 100% AA 46.32 + -0.57 ^c 10 12 6 4 22 32 31.30% 37.50% 18.80% 12.50% 68.80% 100% g.21604 G> A Intron GG 44.35 ± 0.16 ^b 37 116 54 47 153 254 14.60% 45.70% 21.30% 18.50% 60.30% 100% GA 44.69 ± 0.18 ^b 39 74 66 37 113 216 18.10% 34.30% 30.60% 17.10% 52.40% 100% AA 42.07 + - 0.32 ^a 3 17 12 11 20 43 7.00% 39.50% 27.90% 25.60% 46.50% 100% g.22488 G> T GG 44.51 + - 0.17 ^b 39 96 56 36 135 227 17.20% 42.30% 24.70% 15.90% 59.50% 100% GT 44.44 + 0.16 ^b 37 93 63 49 130 242 15.30% 38.40% 26.00% 20.20% 53.70% 100% TT 42.45 + 0.39 ^a 3 18 13 10 21 44 6.80% 40.90% 29.50% 22.70% 47.70% 100% g.25670 C > T 3 'UTR CC 44.31 + - 0.17 ^a 34 100 64 50 134 248 13.70% 40.30% 25.80% 20.20% 54.00% 100% CT 44.95 ± 0.31 ^b 16 44 24 13 60 97 16.50% 45.40% 24.70% 13.40% 61.90% 100% TT 43.91 ± 0.18 ^ab 29 63 44 32 92 168 17.30% 37.50% 26.20% 19.00% 54.80% 100% all 44.30 ± 0.12 79 207 132 95 286 513 15.40% 40.40% 25.70% 18.50% 55.80% 100%

G.6960 A> T SNP located in the Exon 2 region showed that individuals with AA genotypes were 22.40% more frequently than those with other genotypes, g.6974 G> A SNP In the case of AA genotype, oleic acid (C18: 1) was the highest with 46.32% and 1 + + grade was also 31.30%.

In addition, distribution of G.21604 G> A and g.22488 G> T SNPs located in the intron region showed that the individuals with GG and GG genotypes were 60.30% and 59.50 %, And the g.25670 C> T SNP in the 3'UTR region was 61.90% when CT genotype was also higher than that of other genotypes. In the results of Tables 3 and 4, Hanwoo individuals with the highest SNPs in the total content of oleic acid (C18: 1) and monounsaturated fatty acids, which are unsaturated fatty acids, were also excellent in meat quality distribution.

These results suggest that g.6960 A> T, g. 6997 G> A SNPs located in the exon2 region of the LPL gene and g.21604 G> A, g.22488 G> T and 3'UTR Of g.25670 C> T SNPs were not only related to the unsaturated fatty acids affecting taste but also to the intramuscular fat, which is an economic trait of Korean cattle.

These results are consistent with the fact that the intramuscular fat level analyzed above is closely related to the unsaturated fatty acid, and the five markers in the LPL gene can be used as an auxiliary means to maintain taste and grade differentiation in Hanwoo industry .

< Example  4> LPL  Excellent selection among genes SNP of Monthly  analysis

Table 15 and Table 16 show the final selection of two SNPs with the best results among the six SNPs among the LPL genes in the same manner as the above-described method.

LPL genotype gogeupyuk excellent selection of SNPs (1 ⁺ rating or higher) shipments compared to age-specific changes in oleic acid (LPL g.6960 A> T SNP) genotype LPL g.6960 A> T SNP ¹⁺ grade 27-28 months 29-30 months 31 to 32 months Over 33 months Sum AA 45.40 (11) 44.78 (33) 45.09 (38) 45.99 (33) 45.29 (115) AT 43.71 (14) 44.43 (38) 45.42 (38) 45.93 (32) 45.05 (122) TT 44.14 (4) 44.14 (17) 44.02 (11) 43.63 (17) 43.94 (49) all 44.41 (29) 44.51 (88) 45.10 (87) 45.48 (82) 44.96 (286)

LPL genotype gogeupyuk of the starting solid SNPs (1 ⁺ rating or higher) compared to age-specific shipment oleic acid change (LPL g.6974 G> A SNP) genotype LPL g.6974 G> A SNP ¹⁺ grade 27-28 months 29-30 months 31 to 32 months Over 33 months Sum AA 43.41 (2) 45.07 (4) 47.80 (6) 48.27 (10) 46.52 (54) GA 45.28 (5) 44.96 (8) 45.73 (14) 46.54 (7) 44.65 (131) GG 44.27 (22) 44.43 (76) 44.73 (67) 44.94 (65) 44.51 (101) all 44.41 (29) 44.51 (88) 45.10 (87) 45.48 (82) 44.96 (286)

As can be seen in Table 15 and Table 16, g.6960 A> T showed a better result when the genotype was AA ⁺ 45.29%, and G.6974 G> A (C18: 1) in the AA genotype was the highest (46.52%).

In particular, if the AA genotype that represents 45.40% at 27-28 months is selected early in the SNP of g.6960 A> T, all the genotypes of 29-32 months, as well as excellent individuals with no difference between the average values over 33 months, You will be able to select.

On the other hand, in the case of G.6974 G> A SNP, the content of oleic acid (C18: 1) was the highest at 47.80% and 48.27% at 30 months or longer. It should be used to select top quality beef rather than the effect of selection.

If the individuals are selected early using the g.6960 A> T SNP, which has the highest selection effect among the 107 candidate SNPs, it can be used as an important auxiliary means to maintain the differentiation of taste or grade while shortening the fattening of the Hanwoo industry will be.

In the meantime, g.6960 A> T and g.6974 G> A located in the exon 2 region of the present invention, g.25607 G> A, g.22488 G> T located in the intron region, and g.25670 C Gt; &lt; RTI ID = 0.0 &gt; T &lt; / RTI &gt;

SNP gene chromosome Base sequence synthesis
Temperature primer
size g.6960 A> T NC_007306 8 F TTGGAGCACTGTCCACTTTG (SEQ ID NO: 6) 60 154 R AAAGGCATCACTGGGTTCC (SEQ ID NO: 7) E CAGCTGAGGACACTTGCCAC (SEQ ID NO: 8) g.6974 G> A NC_007306 8 F AGGAATGAGGTGGCAAGTGT (SEQ ID NO: 9) 60 289 R TGGAGCACTGTCCACTTTGA (SEQ ID NO: 10) E GTGTCCTCAGCTGTGTCTTC (SEQ ID NO: 11) g.21604 G> A NC_007306 8 F GGGGGAGAGAGGATGAGATT (SEQ ID NO: 12) 60 262 R TTCCTGCAAGCACAAAACAG (SEQ ID NO: 13) E CAGGGACTAAACCCACACCC (SEQ ID NO: 14) g.22488 G> T NC_007306 8 F ATGCTCACCAGCCAGACTTT (SEQ ID NO: 15) 60 271 R CTGACTGGAATGGCCTGAGT (SEQ ID NO: 16) E CAAATGCTTCTGTCAGGGTT (SEQ ID NO: 17) g.25670 C > T NC_007306 8 F TGATGCAACCAACCGTAGAG (SEQ ID NO: 18) 60 375 R GCACTGCATTCTGTCCTTTG (SEQ ID NO: 19) E AAAGTAGGGATTTTGATTGA (SEQ ID NO: 20)

F: forward sequence, R: reverse sequence, E: extension sequence

<110> Industry-Academic Cooperation Foundation, Yeungnam University <120> Single nucleotide polymorphism marker in LPL gene for diagnosis of meat quality Hanwoo and method for diagnosis of meat quality in Hanwoo using same marker <130> ADP-2013-0328 <160> 20 <170> Kopatentin 2.0 <210> 1 <211> 503 <212> DNA <213> HanWoo <400> 1 tggagcactg tccactttga gtacacatgg aggatcaacc attctcttgc aatccacttt 60 tttttttttt ttttttactt tagaaaacaa aaatagcatt actggtattt gcttgtgaat 120 ctaaaacaca ctagtccagc aaataaaaca aaccaccctc gaattaacct cctatccaat 180 ttttcctttt cagggattac aggaggaaaa gattttagag acattgaaag taaatttgct 240 ctcaggactc ctgaagacwc agctgaggac acttgccacc tcattcctgg agtgaccgaa 300 tctgtggcta actgtcactt caaccacagc agcaaaacct ttgtggtgat ccatggctgg 360 acggtaaggg aggctcttta ggaaggagta gactggcatg aactaagcgt tctaacaggc 420 ttgttgagag ccccgtgatg ggaacccagt gatgcctttg ctttaaactg gaataaaaac 480 agttctggct caggtgggga ttt 503 <210> 2 <211> 501 <212> DNA <213> HanWoo <400> 2 aatccccacc tgagccagaa ctgtttttat tccagtttaa agcaaaggca tcactgggtt 60 cccatcacgg ggctctcaac aagcctgtta gaacgcttag ttcatgccag tctactcctt 120 cctaaagagc ctcccttacc gtccagccat ggatcaccac aaaggttttg ctgctgtggt 180 tgaagtgaca gttagccaca gattcggtca ctccaggaat gaggtggcaa gtgtcctcag 240 ctgtgtcttc rggagtcctg agagcaaatt tactttcaat gtctctaaaa tcttttcctc 300 ctgtaatccc tgaaaaggaa aaattggata ggaggttaat tagagggtgg tttgttttat 360 ttgctggact agtgtgtttt agattcacaa gcaaatacca gtaatgctat ttttgtttct 420 aaagtaaaaa aaaaaaaaaa aaaagtggat tgcaagagaa tggttgatcc tccagtggta 480 ctcaaagtgg acagtgctcc a 501 <210> 3 <211> 465 <212> DNA <213> HanWoo <400> 3 ttgtaggccg attctttacc ttctgagcca ccaaggaggc cccattcagt gtaaaagttt 60 taaatcctct gaggctgtct atgcaattca ttttatagat ctatgtggat ttgggtgggg 120 gagagaggat gagattatct tggaatctca tccttcttga agaggttggt ttttatttta 180 ttaaaaaaaa atttggctat atctcttggc ttgtgggtta gctccccaac cagggactaa 240 acccacaccc rctgcagtgg aaacttccaa tcttaacaac tgaactgcca gggaagtcct 300 aagaggttgg ttttaatctc tgaatgtccc agtggcatca ctaaggttct ctgcataact 360 gtttgtgct tgcaggaatc aatgttaaat gagaagtcga aatttttgac gtctaatctc 420 agctttactc aatgattgtg gcaaatcagt ttatgttttc tttcc 465 <210> 4 <211> 501 <212> DNA <213> HanWoo <400> 4 catgaagcac catcccttgg agagcaagtt caagataccc agagagcctg agcccatgat 60 gctcaccagc cagactttct attcagggac ttgtcatggc atttcacaaa tatcacaggt 120 gactttcctt tctgcagata agacattttc tcccgggaac agaagatcac cctgtggaag 180 aaattgtatg tcaacacagc atattggaac aataaaaatg acttcaaaaa caaatgcttc 240 tgtcagggtt ktctgaaact cacatgattc ttctgactgt tttgatattt ccaataatta 300 actatttata ctcaggccat tccagtcaga acacatctga atcagatggt tatttgcggg 360 ctttatgcac tgttcggcaa taaagctcgt tcattaatat agattggcat acagatagcc 420 tggagcaggt ttaaaatcac caggctctta gaaaaagatg atacaagatc aactttacca 480 cttcttagtg tctgcattaa g 501 <210> 5 <211> 501 <212> DNA <213> HanWoo <400> 5 aaaggaaggg gaaatactaa accataaact gttaagttta ttaagattta attgatctca 60 actttatata tctcctttaa tttgtaactt agttatgatg caaccaaccg tagagggggt 120 ttaaaggttc agtgctttat caactctatt cttcatttct atctccaagt cactagttcc 180 tggttcactc ttggactaca ttccaatggc aagaggagag taattccaag aaagtaggga 240 ttttgattga yaagtaaacg ggtcctactc acgctgcaaa aaaacttact tcctgtattt 300 agactcagag aaaactctga gaaggttatc agtctagaaa acgcagaatc ccaattaaaa 360 atgagatttt aatcaatttt aggctatggc taaacttact acatgaagag atctgattat 420 tttatcattt taaataactc atttttttct caaaggacag aatgcagtgc ttttcatatc 480 tgttattttt ttaatgttgg a 501 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 ttggagcact gtccactttg 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 aaaggcatca ctgggttcc 19 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 cagctgagga cacttgccac 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 aggaatgagg tggcaagtgt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 tggagcactg tccactttga 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gtgtcctcag ctgtgtcttc 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 gggggagaga ggatgagatt 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 ttcctgcaag cacaaaacag 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 cagggactaa acccacaccc 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 atgctcacca gccagacttt 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ctgactggaa tggcctgagt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 caaatgcttc tgtcagggtt 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 tgatgcaacc aaccgtagag 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 gcactgcatt ctgtcctttg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 aaagtaggga ttttgattga 20

Claims (9)

The 251st nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4, and the 251st nucleotide of SEQ ID NO: (SNP) marker composition comprising a polynucleotide consisting of 10-100 consecutive DNA sequences or a complementary polynucleotide thereof. 2. The method according to claim 1, wherein the genotype of the 259th nucleotide of SEQ ID NO: 1 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 2 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 3 is GG, Wherein the genotype of the 251st nucleotide is GG and the genotype of the 251st nucleotide of SEQ ID NO: 5 is CT. The SNP marker composition according to claim 1, wherein the meat quality diagnosis is based on the diagnosis of muscle fat content and unsaturated fatty acid content. 4. The single nucleotide polymorphism (SNP) marker composition according to claim 3, wherein the unsaturated fatty acid is oleic acid and monounsaturated fatty acid. (1) obtaining a DNA sample from an individual;
(2) performing PCR using a primer capable of amplifying the SNP marker of claim 1 using the DNA obtained from the step (1) as a template;
(3) a DNA fragment comprising a nucleotide sequence selected from the group consisting of the 259th nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4 and the 251st nucleotide of SEQ ID NO: Identifying the genotype of the selected one or more nucleotides; And
(4) diagnosing the intramuscular fat level and the content of the unsaturated fatty acid in the genotype. 6. The method according to claim 5, wherein the diagnosis of the content of the intramuscular fat and the content of the unsaturated fatty acid in the step (4) comprises determining that the genotype of the 259th nucleotide of SEQ ID NO: 1 is AA, the genotype of the 251st nucleotide of SEQ ID NO: 2 is AA, Wherein the genotype of the second nucleotide is GG, the genotype of the 251st nucleotide of SEQ ID NO: 4 is GG, and the genotype of the 251st nucleotide of SEQ ID NO: 5 is CT. The method of claim 5, wherein the unsaturated fatty acid is oleic acid and monounsaturated fatty acid. The 251st nucleotide of SEQ ID NO: 1, the 251st nucleotide of SEQ ID NO: 2, the 251st nucleotide of SEQ ID NO: 3, the 251st nucleotide of SEQ ID NO: 4, and the 251st nucleotide of SEQ ID NO: A kit for the detection of a Korean beef cattle meat comprising a primer capable of amplifying a polynucleotide consisting of 10-100 consecutive DNA sequences or a complementary polynucleotide thereof. [Claim 9] The kit for diagnosing Korean flesh and taste according to claim 8, wherein the primer is any one or more primers selected from the group consisting of SEQ ID NO: 6 to SEQ ID NO:

Images