KR100827544B1 - Development of molecular marker associated with backfat thickness and marbling in Hanwoo - Google Patents

Development of molecular marker associated with backfat thickness and marbling in Hanwoo Download PDF

Info

Publication number
KR100827544B1
KR100827544B1 KR1020060097816A KR20060097816A KR100827544B1 KR 100827544 B1 KR100827544 B1 KR 100827544B1 KR 1020060097816 A KR1020060097816 A KR 1020060097816A KR 20060097816 A KR20060097816 A KR 20060097816A KR 100827544 B1 KR100827544 B1 KR 100827544B1
Authority
KR
South Korea
Prior art keywords
hanwoo
sscp
snp
present
thickness
Prior art date
Application number
KR1020060097816A
Other languages
Korean (ko)
Other versions
KR20080032674A (en
Inventor
정의룡
신성철
신기현
박종근
Original Assignee
상지대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 상지대학교산학협력단 filed Critical 상지대학교산학협력단
Priority to KR1020060097816A priority Critical patent/KR100827544B1/en
Publication of KR20080032674A publication Critical patent/KR20080032674A/en
Application granted granted Critical
Publication of KR100827544B1 publication Critical patent/KR100827544B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 한우의 등지방 두께 및 근내지방도에 관여하는 분자표지인자에 관한 것으로서, 한우의 육질형질을 지배하는 유전적 자질을 예측하고 판정하는 유전적 분자표지인자를 개발하여 육종 및 선발 프로그램에 제공하기 위한 것이다.   The present invention relates to molecular markers involved in back fat thickness and intramuscular fat of Hanwoo, and to develop genetic molecular markers for predicting and determining the genetic qualities that govern meat quality of Hanwoo and provide them to breeding and selection programs. It is to.

더욱 상세하게는, 본 발명은 한우 leptin 유전자를 대상으로 유전자 전사 시작점이자 발현량의 세기를 조절하는 등 중요한 역할을 담당하는 promoter영역의 특정 단일염기다형(SNP)를 이용하여 등지방 두께와 근내지방도가 높은 한우 조기선발에 활용 가능한 유전자 분자표지인자(SNP marker) 개발에 관한 것으로, 본 발명에서 이용한 PCR-SSCP(single strand conformation polymorphism) 기법은 신속하고 간편하며 정확성이 높아 선발의 효율성과 실용성을 극대화 할 수 있을 뿐만 아니라 한우 집단 내에서 등지방 두께와 근내지방도가 높은 한우를 조기에 진단하고 선발 육종함으로써 육질이 우수한 한우 생산에 활용하기 위한 것이다. More specifically, the present invention utilizes a specific monobasic polymorphism (SNP) of a promoter region, which plays an important role such as the gene transcription start point and expression intensity control for the Hanwoo leptin gene, and the backfat thickness and intramuscular fat profile. The present invention relates to the development of high molecular weight (SNP marker) markers for early selection of high-quality Korean cattle, and the PCR-SSCP (single strand conformation polymorphism) technique used in the present invention is quick, simple, and accurate to maximize efficiency and practicality of selection. In addition, it is intended to be used for the production of excellent quality beef by early diagnosis and selection breeding of beef having high back fat thickness and intramuscular fat within the Hanwoo population.

한우, 등지방 두께 및 근내지방도 연관 DNA 표지인자, leptin promoter, 단일염기다형마커(SNP marker), PCR-SSCP 분석 Hanwoo, backfat thickness and intramuscular fat associated DNA markers, leptin promoter, SNP marker, PCR-SSCP analysis

Description

한우의 등지방 두께 및 근내지방도 관련 분자표지인자 개발{Development of molecular marker associated with backfat thickness and marbling in Hanwoo}Development of molecular markers associated with backfat thickness and marbling in Hanwoo}

도면 1은 본 발명에서 한우 leptin 유전자 promoter의 특정 영역을 PCR로 증폭한 후 EtBr이 함유된 아가로즈젤(agarose gel)에 전기영동하여 검출한 PCR 증폭산물 사진  1 is a PCR amplification product photograph detected by electrophoresis on agarose gel containing EtBr after amplifying a specific region of the Hanwoo leptin gene promoter in the present invention

도면 2는 본 발명에서 PCR-SSCP 기법으로 검출한 한우 leptin 유전자 promoter 영역의 단일염기다형(SNP) 유전자형 마커 전기영동 사진  Figure 2 is a single nucleotide polymorphism (SNP) genotype marker electrophoresis picture of the Hanwoo leptin gene promoter region detected by the PCR-SSCP technique in the present invention

도면 3은 본 발명에서 검출한 한우 leptin 유전자 promoter 영역의 각 유전자형별 단일염기다형(SNP) 염기서열 분석 크로마토그램  Figure 3 is a single nucleotide polymorphism (SNP) sequence analysis chromatogram of each genotype of the Hanwoo leptin gene promoter region detected in the present invention

본 발명은 PCR-SSCP 기법을 이용한 한우의 등지방 두께 및 근내지방도 연관 SNP 마커를 검출하여 등지방 두께와 근내지방도가 높은 한우 조기선발에 활용 가능한 방법에 관한 것이다.  The present invention relates to a method that can be utilized for early selection of Hanwoo with high backfat thickness and intramuscular fat by detecting SNP markers related to backfat thickness and intramuscular fat of Hanwoo using PCR-SSCP technique.

한우(Hanwoo)는 한국 고유의 소품종으로서 오랫동안 한국의 기후풍토에 적응하여 그에 적합한 체질로 고정되어 온 주요 가축이다. 한우의 주요 육종개량 대상형질로서 개체의 육질형질에 영향을 미치는 육질등급 판정 항목으로는 근내지방도, 등지방 두께, 살코기의 색깔과 밝기, 살코기의 견도와 보습성 및 지방의 조성 등이 있는데 이 중에서도 등지방 두께 및 근내지방도는 육질등급을 결정하는 중요한 요인 중 하나이다.   Hanwoo (Hanwoo) is a unique prop species of Korea, which has been adapted to Korea's climate climate for a long time and has been fixed in the proper constitution. The quality classification criteria affecting the meat quality of the individual as the main breeding targets of Hanwoo are intramuscular fat, back fat thickness, color and brightness of lean meat, lubrication and moisture retention, and fat composition. Back fat thickness and intramuscular fatity are one of the important factors in determining meat grade.

일반적으로 육종개량에 있어 종래의 양적 유전학적 방법은 가축의 표현형적 기록에 의존해왔다. 즉, 후보종모우는 혈통기록과 체형 발달 등의 당대 기록으로 우선 선발하고 빈우와의 교배에 의해 생산되는 후대 검정우를 사육, 도축하여 도체 및 육질형질들을 기록하고 가축이 사육되어진 환경 요인들을 최대한 배제하면서 가축의 진정한 육종가를 추정해 내기 위한 가장 적절한 통계 모델식을 고안하여 종축을 선발하게 되는데 이러한 표현형적 관찰치를 측정하는 데는 많은 시간이 소요되므로 종축의 선발을 지연하게 되어 세대 간격이 길어지고 많은 두수의 후보 종축을 사육하게 되므로 사료비, 시설투자비 및 유지비, 인건비 등의 경제적 비용과 과도한 노동력이 소요된다. 현재 한우의 근내지방도에 대한 연간 유전적 개량량을 0.035점으로 환산할 경우 이를 1점까지 향상시키기 위해선 무려 28.5년이라는 오랜 기간이 소요된다.  In general, conventional quantitative genetic methods in breeding improvement have relied on phenotypic records of livestock. In other words, candidate cows are selected first by the current records such as pedigree records and body development, breeding and slaughtering subsequent black cattle produced by crossbreeding, recording carcass and meat traits, and excluding the environmental factors in which livestock is raised as much as possible. In order to estimate the true breeding value of livestock, we devised the most appropriate statistical model to select breeders, which takes much time to measure phenotypic observations, delaying the selection of breeders, resulting in longer generation intervals and many head counts. Since the breeder is raising a breeder's breeder, it costs economic and excessive labor such as feed, facility investment, maintenance and labor costs. At present, when the annual genetic improvement of Hanwoo's intramuscular fat degree is converted to 0.035 points, it takes a long period of 28.5 years to improve it to one point.

이와 같은 매우 비효율적인 방법으로 인해 보다 과학적이고 신속하게 우수한 육질등급의 비육우를 조기에 선발하고 사육하기 위한 한우 육질등급 판정 방법이 요구되어 왔다. 유전공학 기술의 눈부신 발달로 DNA 분자수준에서의 여러 실험기법들 의 발전이 지속적으로 이루어져 왔으며, 이러한 실험기법들의 발전을 토대로 가축의 유전적 특성이나 능력개량을 위한 다양한 DNA 분석기술들이 개발되어 동물산업에 이용되고 있다. 이러한 유전공학적 기법에는 여러 가지가 있는데, 그 중 최근에 많이 사용되고 있는 PCR(Polymerase Chain Reaction)기술을 이용한 분석방법 중 PCR-SSCP(single strand conformation polymorphism, 단일쇄형태구조다형)기법은 다음의 설명과 같은 원리를 이용한 분석법이다. 어떤 입자들의 전기장 내에서의 이동속도는 그 입자의 크기와 형태에 영향을 받는다. Single strand DNA는 non-denaturing 조건하에서 분자내의 상호작용에 의하여 2차 구조를 형성하게 되는데 이 2차 구조는 DNA의 염기서열에 의하여 결정된다. 그러므로 DNA 염기서열중 하나의 염기서열의 변화(point mutation, deletion 또는 insertion)에 의해서도 전기영동상 전개되는 속도에 영향을 받으므로 이동거리에 차이가 발생하게 된다. 이와 같은 원리를 바탕으로 1989년 Orita 등에 의하여 고안된 SSCP는 유전자의 돌연변이를 검색하는 유용한 도구로서 각 개체의 바람직한 유전자형을 보다 신속하고 정확하게 판정할 수 있는 장점이 있다.  Due to such a very inefficient method, there has been a demand for a method of determining the quality of beef cattle grades for early selection and breeding of beef cattle of high quality grades more scientifically and quickly. With the remarkable development of genetic engineering technology, the development of various experimental techniques at the molecular level of DNA has been continuously made. Based on the development of these experimental techniques, various DNA analysis techniques for improving genetic characteristics or ability of livestock have been developed and the animal industry has been developed. It is used for. There are many kinds of genetic engineering techniques. Among them, PCR-SSCP (single strand conformation polymorphism) technique among the analysis methods using PCR (Polymerase Chain Reaction) technique, which is widely used recently, It is an analysis method using the same principle. The speed of movement of some particles in the electric field is affected by their size and shape. Single-stranded DNA forms a secondary structure by intramolecular interactions under non-denaturing conditions. The secondary structure is determined by the DNA sequence. Therefore, the difference in movement distance occurs because the rate of electrophoresis is affected by the change (point mutation, deletion or insertion) of one of the DNA sequences. SSCP, devised by Orita et al. In 1989, is a useful tool for detecting mutations in genes, and has the advantage of determining the desired genotype of each individual more quickly and accurately.

본 발명에서 이용한 leptin 유전자(obese gene, 비만유전자)는 지방축적과 연관된 대표적인 유전자로서 지방세포에서 생성되어 시상하부를 조절하여 체내에 지방 축적을 억제하는 기능을 가지고 있는 것으로 알려져 있는 유전자로서 1994년에 최초로 동정되었으며, 현재까지 포유동물의 비만과 관련된 연구에 많이 이용되고 있다. 생쥐의 경우 비만유전자가 기능을 상실한 경우 보통 생쥐보다 훨씬 더 비만인 표현형을 보이는데 이 유전자는 사람의 비만을 치료할 목적으로 연구되었다. 지금 까지 육우의 근내지방도에 유전적 영향을 미치는 leptin 유전자의 일부 특정 영역의 SNP 부위가 특허등록(등록번호 제 0282246호)되어져 있으나 본 발명과는 유전자 영역이 완전히 다르다. 즉, 기존의 연구에서는 leptin 유전자의 exon 2번 영역의 특정 단일염기다형 마커(SNP marker)를 이용한 근내지방도 관련 분자표지인자에 관한 내용이지만, 본 발명은 leptin 유전자의 전사 시작점이자 단백질 발현량을 조절하는 프로모터(promoter) 영역의 특정 단일염기다형 마커를 이용한 한우 등지방 두께 및 근내지방도 관련 분자표지인자에 관한 내용이라는 점에서 이 두 가지 연구에는 확연한 차이점이 존재한다. 특히, 본 발명에서 이용한 프로모터 영역은 유전자 내에서 DNA에 전사인자와 RNA 중합효소가 결합하는 부위로서 mRNA의 전사와 조절 역할 담당하는 중요한 조절인자다. 이러한 프로모터 영역에 돌연변이가 발생할 경우 프로모터 기능의 약화 혹은 촉진에 의한 단백질 발현량의 증감 현상이 나타나므로 유전자에 있어 프로모터 부위의 SNP는 상당한 중요성을 내포하고 있는 것이다.   The leptin gene (obese gene) used in the present invention is a gene that is associated with fat accumulation and is a gene known to have a function of inhibiting fat accumulation in the body by regulating the hypothalamus produced in adipocytes. It was identified for the first time and has been widely used in studies related to obesity in mammals. Mice have a much more obese phenotype than normal mice when their obesity genes are dysfunctional, which has been studied to treat human obesity. Until now, the patent registration (Registration No. 0282246) of some specific regions of the leptin gene, which has a genetic effect on beef muscle, has been completely different from the present invention. That is, in the existing researches, the intramuscular fat related molecular markers using a specific mononucleotide polymorphic marker (SNP marker) in the exon 2 region of the leptin gene, but the present invention regulates the transcription start point and protein expression level of the leptin gene. There are significant differences between these two studies in that it relates to the molecular markers related to the thickness and intramuscular fat of Hanwoo using specific monobasic polymorphic markers in the promoter region. In particular, the promoter region used in the present invention is an important regulator that plays a role in transcription and regulation of mRNA as a site where a transcription factor and RNA polymerase bind to DNA in a gene. When mutation occurs in such a promoter region, the protein expression amount increases or decreases due to weakening or promotion of promoter function, so that the SNP of the promoter region in the gene has significant significance.

본 발명은 동물의 지방축적과 연관되어져 있는 leptin 유전자의 전사시작점이자 단백질 발현의 중요한 역할을 담당하는 promoter 영역의 특정 SNP를 이용하여 한우의 등지방 두께 및 근내지방도에 영향을 미치는 단일염기다형 마커(SNP marker)를 개발함으로써 육질이 우수한 한우를 성(性)과 연령에 관계없이 조기에 신속하고 간편하게 진단하고 선발하도록 하는 분자육종기술을 제공하는 것이다.   The present invention relates to a monobasic polymorphic marker that affects the backfat thickness and intramuscular fat of Hanwoo by using specific SNPs in the transcription region of leptin genes that are associated with fat accumulation in animals and in the promoter region that play an important role in protein expression. By developing SNP markers, we will provide molecular breeding technology to diagnose and select early-quality Hanwoo, regardless of gender and age, quickly and easily.

다음의 실시 예에 따라 본 발명을 상세히 설명한다.The present invention will be described in detail according to the following examples.

실시 예 1 : 한우 leptin 유전자 promoter 영역의 SNP 유전자형 검출Example 1 SNP Genotyping of Hanwoo Leptin Gene Promoter Regions

1. 공시재료 및 DNA 분리 정제1. Test material and DNA separation and purification

본 발명에 사용한 한우는 국가 후대검정사업에 등록하고 후대검정을 통하여 혈통기록과 도체성적을 보유하고 있는 후보 종모우 집단 총 147 두를 공시축으로 선정하였다. 각 공시축 혈액으로부터의 genomic DNA의 분리 및 정제는 Miller등 (1988)의 방법을 일부 변경하여 분리 정제하였으며 스펙트로포토메타(spectrometer)를 이용하여 DNA 농도를 측정한 후 TE buffer(10mM Tris-HCl, pH 7.4; 1mM EDTA)에 용해하여 -20℃ 냉동고에 보존하고 공시재료로 사용하였다. Hanwoo used in the present invention was registered in the National Hospitality Assurance Project, and a total of 147 candidates were selected for the public review. Separation and purification of genomic DNA from each coaxial blood was separated and refined by some modifications of Miller et al. (1988). After measuring the DNA concentration using a spectrophotometer, the TE buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA), stored in -20 ℃ freezer and used as a test material.

2. 한우 leptin 유전자 promoter 영역의 PCR 증폭 및 단일염기다형(SNP) 검출2. PCR Amplification and SNP Detection of Hanwoo Leptin Gene Promoter

한우 leptin 유전자의 SNP를 검출하기 위해 혈연관계가 없는 한우 60두의 Pooled DNA를 제작하여 PCR증폭의 templete DNA로 사용하였다.한우 leptin 유전자 promoter의 특정 영역을 포함하는 252bp 크기의 DNA 단편을 증폭하기 위한 프라이머(primer)는 GenBank 등록번호 DQ202319호에 등록된 염기서열 정보 908번째부터 1159번째까지의 염기서열을 참고로 하여 각각 설계 및 제작하였으며, 본 발명에 사용한 프라이머 염기서열은 표 1과 같다.In order to detect SNP of Hanwoo leptin gene, Pooled DNA of 60 unrelated blood cows was prepared and used as templete DNA of PCR amplification. To amplify a 252bp DNA fragment containing a specific region of Hanwoo leptin gene promoter Primers were designed and manufactured with reference to the base sequence information from 908th to 1159th base sequence information registered in GenBank Registration No. DQ202319, respectively. The primer base sequences used in the present invention are shown in Table 1 below.

한우 leptin 유전자의 PCR 증폭을 위한 프라이머 염기서열 Primer Sequences for PCR Amplification of the Hanwoo Leptin Gene 유전자gene 프라이머 염기서열(5'- 3')Primer base sequence (5'-3 ') 증폭단편의 크기(bp)Amplification fragment size (bp) 증폭영역Amplification area leptinleptin F - CGTTAAACCTAAATTTGCGA R - ATCACACCTGCCTTGATGAT F-CGTTAAACCTAAATTTGCGA R-ATCACACCTGCCTTGATGAT 252252 promoterpromoter

leptin 유전자의 PCR 증폭을 위한 반응 조건은 진엠프 시스템 9700(GenAmp PE Applied Biosystem, USA)을 이용하여 다음과 같은 조건하에 실시하였다. 즉, 반응액 조성은 0.2㎕ 튜브에 주형(template) DNA 30ng, 프라이머 각 0.05μM, dNTP 각 250μM, 10X PCR buffer, 그리고 Taq DNA 중합효소 1 unit 을 첨가하여 PCR 반응액을 총 20㎕로 조정하였다. PCR 반응조건은 최초 94℃에서 5분간 예비가열 후 94℃에서 30초, 55℃에서 30초 그리고 72℃에서 30초간의 사이클을 총 35회 반복한 다음 마지막으로 72℃에서 5분간 가열하여 DNA 증폭과정을 종료하였다. 증폭산물은 [도면 1]에 제시한 바와 같이 2.5% 아가로즈젤(agarose gel)에 전기영동 하여 DNA 증폭 성공여부를 검증하였다. Reaction conditions for PCR amplification of the leptin gene were performed using the GeneAmp System 9700 (GenAmp PE Applied Biosystem, USA) under the following conditions. In other words, the reaction solution composition was adjusted to a total of 20 μl by adding 30ng of template DNA, 0.05μM of primers, 250μM of dNTPs, 10X PCR buffer, and 1 unit of Taq DNA polymerase to 0.2μl tube. . PCR reaction conditions were pre-heated for 5 minutes at 94 ° C, followed by a total of 35 cycles of 30 seconds at 94 ° C, 30 seconds at 55 ° C and 30 seconds at 72 ° C, and finally amplified DNA by heating at 72 ° C for 5 minutes. The process was terminated. The amplification products were electrophoresed on 2.5% agarose gel as shown in [Figure 1] to verify the success of DNA amplification.

한우 leptin 유전자 promoter 영역의 DNA 증폭산물을 이용하여 direct sequencing 기법으로 염기서열을 분석한 결과 2개의 단일염기다형(SNP)을 검출하였다. 즉, GenBank 등록번호 DQ202319호의 1019번째(증폭영역 내 112번째) 염기에서 C↔G 염기치환에 의한 SNP를 검출하였고, 1024번째(증폭영역 내 117번째) 염기에서 G↔A 염기치환에 의한 SNP를 검출하였다. Two nucleotide polymorphisms (SNPs) were detected by direct sequencing technique using DNA amplification products of the Hanwoo leptin gene promoter region. In other words, SNP by C↔G base substitution was detected at 1019th (112th in amplification) base of GenBank registration number DQ202319, and SNP by G↔A base substitution at 1024th (117th in amplification) base was detected. Detected.

3. PCR-SSCP(single strand conformation polymorphism, 단일쇄형태구조다형성) 기법에 의한 한우 leptin 유전자 promoter 영역의 SNP 유전자형 분석3. SNP genotyping of Hanwoo leptin gene promoter region by PCR-SSCP (single strand conformation polymorphism) technique

검출된 한우 leptin 유전자 promoter영역의 2개 SNP에 대한 SNP marker 유전자형 분석을 위해 표 1의 primer를 이용하여 공시축 총 147두의 DNA를 모두 PCR로 증폭하고, SSCP 분석을 수행하였다.For the SNP marker genotyping of the two SNPs of the detected Hanwoo leptin gene promoter region, all 147 DNAs of the test axis were amplified by PCR using the primers of Table 1 , and SSCP analysis was performed.

PCR-SSCP 분석은 각 PCR증폭 산물 2㎕에 8㎕의 formamide dye (98% formamide, 20mM EDTA, 0.05% bromophenol blue, 0.05% xylen cyanol)를 첨가하고 95℃에서 5분간 변성시킨 후 즉시 ice에 5분간 보관하여 reannealing을 방지한 다음 10% (49:1) non-denaturation polyacylamide gel을 이용하여 250 volt에서 약 5시간 동안 전기영동을 실시 한 후 silver staining(Bassam et al., 1991)으로 SSCP의 DNA band를 검출하고 각 banding pattern에 따른 SSCP 유전자형을 결정하였다[도면 2]. 또한 [도면 3]에 제시한 바와 같이 leptin 유전자의 SSCP 분석을 통하여 검출한 각 유전자형 marker의 염기서열을 크로마토그램으로 분석 비교하여 각각의 SSCP 유전자형에 상응하는 SNP 유전자형을 판정하였다. PCR-SSCP analysis was performed by adding 8 µl of formamide dye (98% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylen cyanol) to 2 µl of each PCR amplification product, denatured at 95 ° C for 5 minutes, and immediately After storage for 10 minutes to prevent reannealing, electrophoresis was performed for 5 hours at 250 volt using a 10% (49: 1) non-denaturation polyacylamide gel, followed by silver staining (Bassam et al., 1991). Bands were detected and SSCP genotypes were determined according to each banding pattern [Fig. 2]. In addition, as shown in FIG. 3, the SNP genotype corresponding to each SSCP genotype was determined by analyzing and comparing the nucleotide sequences of the genotype markers detected by the SSCP analysis of the leptin gene by chromatogram.

이상과 같은 방법으로 검정 개체별 leptin 유전자 promoter 영역의 SNP 유전자형을 결정하기 위하여 SNP의 염기치환 부위를 포함하는 252bp 단편을 증폭하여 SSCP 분석을 수행한 결과 [도면 2]의 전기영동 사진에서 보는 바와 같이 5종류의 SSCP 유전자형이 검출되었다. SSCP 유전자형의 염기변이를 확인하기 위하여 각 유전자형의 염기서열을 분석한 결과 [도면 3]에서 보는 바와 같이 증폭부위의 112번째 염기 치환(C/G) 및 117번째 염기치환(G/A)에 의한 각 SNP 유전자형에 해당하는 AA, BB, CC, AC 및 BC의 SSCP type을 결정하였다. In order to determine the SNP genotype of the leptin gene promoter region of each assay by the above method, SSCP analysis was performed by amplifying a 252bp fragment including a base substitution site of SNP, as shown in the electrophoresis picture of [Figure 2]. Five types of SSCP genotypes were detected. As a result of analyzing the nucleotide sequence of each genotype in order to confirm the base mutation of the SSCP genotype, as shown in [Fig. 3], the 112th base substitution (C / G) and the 117th base substitution (G / A) of the amplification site were shown. SSCP types of AA, BB, CC, AC and BC corresponding to each SNP genotype were determined.

한우 집단을 대상으로 분석한 leptin 유전자 promoter영역의 각 SNP에 대한 대립유전자 빈도와 유전자형 출현율을 분석한 결과 112번째 SNP의 경우 C 와 G 대립유전자빈도는 각각 0.548 과 0.452 로 C 대립유전자 빈도가 높게 나타났으며, 117번째 SNP의 경우 G 와 A 대립유전자빈도는 각각 0.633 과 0.367 로 G 대립유전자 빈도가 높게 나타났다. 또한, SSCP 분석을 통해 검출한 SNP marker 유전자형의 출현율은 AA형 21.1%(31두), BB형 23.1%(34두), CC형 11.6%(17두), AC형 19.7% 그리고 BC형은 24.5%로 나타났으며,AB형은 검출되지 않았다.  The allele frequency and genotype prevalence of each SNP in the leptin gene promoter region analyzed in Hanwoo population showed that the C and G allele frequencies were 0.548 and 0.452, respectively. In the 117th SNP, the G and A allele frequencies were 0.633 and 0.367, respectively. In addition, the incidence of SNP marker genotypes detected by SSCP analysis was 21.1% (31) for AA, 23.1% (34) for BB, 11.6% (17) for CC, 19.7% for AC and 24.5 for BC. %, AB type was not detected.

실시 예 2 : 한우 leptin 유전자 promoter 영역의 SNP marker와 도체 및 육질관련 형질과의 연관성 분석 Example 2 Analysis of the Relationship between SNP Markers of Carcass Leptin Gene Promoter and Carcass and Meat-related Traits

한우 leptin 유전자 promoter 영역의 SNP marker 유전자형이 도체 및 육질관련 형질의 육종가 추정치에 미치는 효과를 규명하기 위하여 SASⓐ 8.1 Package/PC를 이용하여 PROC GLM으로 통계 처리하였으며, 유전자형의 효과 중 유의성이 인정된 형질들에 대해 DMRT(Duncan`s Multiple Range Test) 방법으로 각 유전자형의 least square means간의 차이에 대한 유의성 검정을 실시하였다. In order to investigate the effect of SNP marker genotype in the Hanwoo leptin gene promoter region on the estimates of carcass and meat-related traits, it was statistically treated with PROC GLM using SASⓐ 8.1 Package / PC. For this study, the significance test for the difference between least square means of each genotype was performed by the Duncan's Multiple Range Test (DMRT) method.

먼저, 본 발명을 통해 발견된 leptin 유전자 promoter 증폭 영역 내 112번째 및 117번째 SNP에 대한 각각의 SNP 유전자형과 한우의 각종 도체 및 육질형질 간의 연관성을 통계 분석한 결과 표 2와 3에서 보는 바와 같이 두 개 SNP 모두 등지방 두께 및 근내지방도 육종가 항목에 대한 유의적 연관성이 입증되었다. 즉, C↔G 염기치환에 의한 112번째 SNP에서 C/G hetero 유전자형을 가진 개체들의 등지방 두께가 각각 C/C homo 유전자형을 가진 개체들에 비해 약 0.076(11.2%)정도 높게 나타났고, G/G homo 유전자형을 가진 개체들에 비해 약 0.168(13.1%)정도 높은 것으로 나타났으며,근내지방도 육종가에서도 C/G 유전자형을 가진 개체들이 C/C 유전자형을 가진 개체들에 비해 약 0.029, 그리고 G/G 유전자형을 가진 개체들에 비해 약 0.071 정도 높은 것으로 나타났다[표 2]. 또한 G↔A 염기치환에 의한 117번째 SNP에서 G/A hetero 유전자형을 가진 개체들의 등지방 두께가 각각 G/G homo 유전자형을 가진 개체들에 비해 약 0.134(12.2%)정도 높게 나타났고, A/A homo 유전자형을 가진 개체들에 비해 약 0.118(11.9%)정도 높은 것으로 나타났으며,근내지방도 육종가에서도 G/A 유전자형을 가진 개체들이 G/G 유전자형을 가진 개체들에 비해 약 0.048, 그리고 A/A 유전자형을 가진 개체들에 비해 약 0.031 정도 높은 것으로 나타났다[표 3].First, as a result of the statistical analysis of the correlation between the SNP genotypes for the 112th and 117th SNPs in the leptin gene promoter amplification region found through the present invention and various carcass and meat quality of Hanwoo, as shown in Tables 2 and 3 All of the dog SNPs showed significant correlations with backfat thickness and intramuscular fat breeding value. In other words, the backfat thickness of individuals with the C / G hetero genotype was about 0.076 (11.2%) higher than those with the C / C homo genotype at the 112th SNP by C↔G base substitution. It was found to be about 0.168 (13.1%) higher than those with the / G homo genotype, and the C / G genotype was 0.029, and G compared with those with the C / C genotype even in the myocardium. It was found to be about 0.071 higher than the individuals with the / G genotype [ Table 2 ]. Also, in the 117th SNP by G↔A base substitution, the backfat thickness of individuals with G / A hetero genotype was about 0.134 (12.2%) higher than those with G / G homo genotype, respectively. It was found to be about 0.118 (11.9%) higher than those with the A homo genotype.In the intramuscular fat breeding group, the individuals with the G / A genotype were about 0.048, and the A / with the G / G genotype. It was found to be about 0.031 higher than the individuals with the A genotype [ Table 3 ].

다음으로, 이들 2개의 SNP 유전자형의 효과를 하나로 통합하여 동시에 한우의 도체 및 육질형질에 미치는 SSCP marker 유전자형의 효과를 분석하였다. 그 결과 표 4에서 보는 바와 같이 등지방 두께 및 근내지방도 육종가에서 유의적인 연관성이 입증되었다. 즉, 등지방 두께에서 AC type을 가진 개체들이 0.775로 가장 높게 나타났으며, 그 다음 CC type 0.664, BC type 0.655, AA type 0.616, BB type 0.541 순으로 높게 나타났다. 또한 근내지방도 육종가에서는 AC type을 가진 개체들이 0.022로 가장 높게 나타났으며, 그 다음 BC type -0.024, AA type -0.031, CC type -0.035, BB type -0.074 순으로 높게 나타났다. 참고적으로, 본 발명에서 한우 leptin 유전자 SSCP marker type에 대한 각 SNP 별 유전자형 분석 결과는 표 5에 제시하였다.Next, by integrating the effects of these two SNP genotypes into one, the effects of SSCP marker genotype on carcass and meat quality of Hanwoo were analyzed. As a result, as shown in Table 4 , the back fat thickness and muscle fat were also significantly correlated in the breeders. In other words, the individuals with AC type showed the highest in the backfat thickness of 0.775, followed by CC type 0.664, BC type 0.655, AA type 0.616, and BB type 0.541. In the breeding region, muscles with AC type showed the highest value of 0.022, followed by BC type -0.024, AA type -0.031, CC type -0.035, and BB type -0.074. For reference, in the present invention, genotype analysis results of each SNP for the Korean cattle leptin gene SSCP marker type are shown in Table 5 .

이상의 본 발명에 대한 결과를 종합해 볼 때 한우 leptin 유전자 promoter영역의 C112G 및 G117A SNP의 유전자형은 한우의 등지방 두께 및 근내지방도 육종가에 대한 유의적 연관성이 입증되었으며, 본 발명을 통해 개발된 SSCP marker의 특정 유전자형(AC type)을 이용하여 한우 육질개량을 위한 DNA 표지인자로서의 활용 가능성이 확인되었다. 따라서, 본 연구를 통해 개발된 육질관련 분자표지의 활용으로 등지방 두께와 근내지방도가 높은 우수한 고품질 고급육 생산 한우의 조기 선발을 위한 새로운 DNA 표지인자로 실용화가 가능할 것으로 기대된다. Based on the results of the present invention, genotypes of C112G and G117A SNPs in the Hanwoo leptin gene promoter region have been shown to be significantly correlated to the backfat thickness and intramuscular fat breeding value of Hanwoo, and the SSCP marker developed through the present invention. The specific genotype (AC type) of was identified as a possible DNA marker for beef cattle quality improvement. Therefore, it is expected that the utilization of molecular markers related to meat quality developed through this study will enable the practical use as a new DNA marker for early selection of high-quality, high-quality beef with high backfat thickness and intramuscular fat.

본 발명에서 한우 leptin 유전자 promoter 영역의 112번째 SNP 표지인자가 도체 및 육질형질에 미치는 영향 Effect of the 112th SNP Marker of Hanwoo Leptin Gene Promoter on Carcass and Meat Quality in the Present Invention 도체 및 육질형질Carcass and meat quality SNP 유전자형 SNP genotype P-P- valuevalue CCCC CGCG GGGG 생체중Live weight /Of kgkg 543.958±7.391543.958 ± 7.391 549.846±6.351549.846 ± 6.351 536.470±8.782536.470 ± 8.782 0.4640.464 도체중Conductor weight /Of kgkg 311.375±4.755311.375 ± 4.755 313.923±4.086313.923 ± 4.086 307.970±5.650307.970 ± 5.650 0.6920.692 도체율Conductor rate /%/% 57.183±0.22457.183 ± 0.224 57.040±0.19257.040 ± 0.192 57.376±0.26657.376 ± 0.266 0.5910.591 등지방두께Back fat thickness /Of cmcm 0.633±0.0380.633 ± 0.038 abab 0.709±0.0330.709 ± 0.033 aa 0.541±0.0450.541 ± 0.045 bb 0.0120.012 ** 등심단면적/Fillet area / cmcm ²² 76.145±1.18376.145 ± 1.183 74.123±1.01774.123 ± 1.017 75.617±1.40675.617 ± 1.406 0.4010.401 근내지방도Intramuscular fat map /1~7/ 1-7 1.895±0.1791.895 ± 0.179 2.123±0.1542.123 ± 0.154 2.205±0.2132.205 ± 0.213 0.4820.482 근내지방도Intramuscular fat map -- 육종가Breeder /1~7/ 1-7 -0.032±0.018-0.032 ± 0.018 abab -0.003±0.015-0.003 ± 0.015 aa -0.074±0.021-0.074 ± 0.021 bb 0.0350.035 **

주) * P<0.05Note) * P <0.05

a,b : 서로 다른 부호간에는 유의차가 있음.a, b: There is significant difference between different codes.

본 발명에서 한우 leptin 유전자 promoter 영역의 117번째 SNP 표지인자가 도체 및 육질형질에 미치는 영향 Effect of 117th SNP Marker of Hanwoo Leptin Gene Promoter on Carcass and Meat Quality in the Present Invention 도체 및 육질형질Carcass and meat quality SNP 유전자형SNP genotype P-P- valuevalue GGGG GAGA AAAA 생체중Live weight /Of kgkg 541.428±6.132541.428 ± 6.132 550.869±7.565550.869 ± 7.565 543.548±9.215543.548 ± 9.215 0.6180.618 도체중Conductor weight /Of kgkg 309.514±3.934309.514 ± 3.934 315.652±4.853315.652 ± 4.853 310.838±5.912310.838 ± 5.912 0.6090.609 도체율Conductor rate /%/% 57.122±0.18657.122 ± 0.186 57.247±0.22957.247 ± 0.229 57.135±0.28057.135 ± 0.280 0.9080.908 등지방두께Back fat thickness /Of cmcm 0.600±0.0320.600 ± 0.032 bb 0.734±0.0390.734 ± 0.039 aa 0.616±0.0480.616 ± 0.048 bb 0.0260.026 ** 등심단면적/Fillet area / cmcm ²² 74.471±0.98174.471 ± 0.981 76.282±1.21076.282 ± 1.210 74.903±1.47574.903 ± 1.475 0.5030.503 근내지방도Intramuscular fat map /1~7/ 1-7 2.214±0.1482.214 ± 0.148 1.956±0.1831.956 ± 0.183 1.903±0.2231.903 ± 0.223 0.3920.392 근내지방도Intramuscular fat map -육종가/1~7Breeding price / 1 ~ 7 -0.048±0.015-0.048 ± 0.015 aa 0.000±0.0190.000 ± 0.019 aa -0.031±0.023-0.031 ± 0.023 aa 0.0490.049 **

주) * P<0.05Note) * P <0.05

a,b : 서로 다른 부호간에는 유의차가 있음.a, b: There is significant difference between different codes.

본 발명에서 한우 leptin 유전자의 SSCP marker가 한우의 도체 및 육질형질에 미치는 영향Effect of SSCP Marker of Hanwoo Leptin Gene on Carcass and Meat Quality of Hanwoo in the Present Invention 도체 및 Conductor and 육질형질Meat quality SSCPSSCP markermarker typetype P-P- valuevalue AAAA BBBB CCCC ACAC BCBC 생체중Live weight /Of kgkg 543.548±9.247543.548 ± 9.247 536.470±8.830536.470 ± 8.830 544.705±12.488544.705 ± 12.488 544.482±9.561544.482 ± 9.561 546.111±8.581546.111 ± 8.581 0.7430.743 도체중Conductor weight /Of kgkg 310.838±5.944310.838 ± 5.944 307.970±5.676307.970 ± 5.676 312.352±8.027312.352 ± 8.027 317.586±6.146317.586 ± 6.146 310.972±5.516310.972 ± 5.516 0.8440.844 도체율Conductor rate /%/% 57.135 ±0.28057.135 ± 0.280 57.376±0.26757.376 ± 0.267 57.270±0.37857.270 ± 0.378 57.234±0.28957.234 ± 0.289 56.883±0.26056.883 ± 0.260 0.7460.746 등지방두께Back fat thickness /Of cmcm 0.6160.616 ±0.047± 0.047 bb 0.541±0.0450.541 ± 0.045 bb 0.664±0.0640.664 ± 0.064 abab 0.775±0.0490.775 ± 0.049 aa 0.655±0.0440.655 ± 0.044 abab 0.0150.015 ** 등심단면적/Fillet area / cmcm ²² 74.903 ±1.46974.903 ± 1.469 75.617±1.40375.617 ± 1.403 78.411±1.98478.411 ± 1.984 75.034±1.51975.034 ± 1.519 73.388±1.36373.388 ± 1.363 0.3450.345 근내지방도Intramuscular fat map /1~7/ 1-7 1.903 ±0.2241.903 ± 0.224 2.205±0.2142.205 ± 0.214 1.882 ±0.3031.882 ± 0.303 2.000 ±0.2322.000 ± 0.232 2.222 ±0.2082.222 ± 0.208 0.7430.743 근내지방도Intramuscular fat map -육종가/1~7Breeding price / 1 ~ 7 -0.031±0.022-0.031 ± 0.022 abab -0.074±0.021-0.074 ± 0.021 bb -0.035±0.030-0.035 ± 0.030 abab 0.022±0.0230.022 ± 0.023 aa -0.024±0.021-0.024 ± 0.021 abab 0.0410.041 **

주) * P<0.05Note) * P <0.05

a,b : 서로 다른 부호간에는 유의차가 있음.a, b: There is significant difference between different codes.

본 발명에서 한우 leptin 유전자 SSCP marker type에 대한 각 SNP별 유전자형 분석 Genotype analysis of each SNP for the Korean cattle leptin gene SSCP marker type in the present invention SSCP marker type SSCP marker type leptin promoter SNP genotypeleptin promoter SNP genotype C112GC112G G117AG117A AAAA C/C homoC / C homo A/A homoA / A homo BBBB G/G homoG / G homo G/G homoG / G homo CCCC C/C homoC / C homo G/A heteroG / A hetero ACAC C/G heteroC / G hetero G/A heteroG / A hetero BCBC C/G heteroC / G hetero G/G homoG / G homo

이상의 실시 예를 통하여 명백한 바와 같이 한우 leptin 유전자 프로모터 영역 내 특정 SNP의 유전자형을 이용하여 한우 각각의 품종 개체의 육질 특성을 규명할 수 있으며 이를 바탕으로 등지방 두께와 근내지방도가 높은 고 품질 고급육 생산 한우의 조기 선발과 더불어 유용 유전자원의 산업적 활용이 가능하다. 즉, 본 발명의 기술을 이용하여 국가적으로는 보증 종모우 및 종빈우의 선발, 사육농가에서는 비육 밑소 및 육질이 우수한 우량 송아지 조기 진단 통한 선발 등에 산업적 활용을 통해 나아가 한우 육종개량사업의 효율성과 개량성과를 극대화하고 동시에 우리나라 고유의 한우 유전자원을 보다 우수하게 개량하고 보존하는 효과를 얻을 수 있다.  As is clear from the above examples, it is possible to examine the meat characteristics of individual breeds of Hanwoo cattle by using a specific SNP genotype within the Hanwoo leptin gene promoter region. In addition to early selection, the use of useful genetic resources is possible. In other words, by using the technology of the present invention through the industrial use, such as the selection of guaranteed cattle and breeding cattle in the country, the selection of beef cattle in the breeding farms and early diagnosis of excellent calf with excellent meat quality, further improve the efficiency and improvement of the Hanwoo breeding business At the same time, it is possible to obtain the effect of improving and conserving Korea's own Hanwoo genetic resources.

또한, 본 발명은 한우의 genomic DNA를 가지고 PCR-SSCP 분석 기법을 이용하는 최첨단 분자육종 기술로서 다수의 시료를 대상으로 SNP 유전자형을 보다 간편하고 신속하며, 정확하게 판정할 수 있는 장점이 있는 기술로서 산업적 실용화가 가능하다.  In addition, the present invention is a state-of-the-art molecular breeding technology using PCR-SSCP analysis technique with genomic DNA of Hanwoo, which has the advantage of making it easier, faster and more accurate to determine the SNP genotype for a large number of samples. Is possible.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (3)

서열번호 2의 정방향 프라이머 및 서열번호 3의 역방향 프라이머를 이용하여 PCR로 증폭하고, 상기 증폭된 한우 leptin 유전자 전사조절 영역(promoter)의 증폭산물을 PCR-SSCP 분석 기법으로 각 한우 개체의 SSCP marker type (AA, BB, CC, AC and BC)을 검출 및 분석한 다음, 검출된 SSCP marker를 한우의 등지방두께 및 근내지방도 관련 DNA 표지인자로 이용하여 한우의 육질을 미리 예측하고 판정하는 것을 특징으로 하는 DNA 표지인자 이용 한우 육질 진단 방법PCR amplification using the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 3, the amplified product of the amplified Hanwoo leptin gene transcription control region (promoter) SSCP marker type of each Hanwoo individual by PCR-SSCP analysis technique (AA, BB, CC, AC and BC) are detected and analyzed, and the meat quality of Korean cattle is predicted and determined in advance by using the detected SSCP markers as DNA markers related to isofat thickness and intramuscular fat of Hanwoo. Korean beef quality diagnosis method using DNA marker to make 청구항 1에 있어서,The method according to claim 1, 5'에서 3'방향으로 CGTTAAACCTAAATTTGCGA의 염기서열 구조를 갖는 서열번호 2의 정방향 프라이머와 5'에서 3'방향으로 ATCACACCTGCCTTGATGAT의 염기서열 구조를 갖는 서열번호 3의 역방향 프라이머를 이용하여 한우의 leptin 유전자 전사조절영역을 PCR 증폭하는 것을 특징으로 하는 DNA 표지인자 이용 한우 육질 진단 방법Regulating transcription of leptin genes in Korean cattle by using the forward primer of SEQ ID NO: 2 having the nucleotide sequence structure of CGTTAAACCTAAATTTGCGA in the 5 'to 3' direction and the reverse primer of SEQ ID NO: 3 having the nucleotide sequence structure of the ATCACACCCCCCTTGATGAT in the 5 'to 3' direction Korean beef quality diagnosis method using DNA marker, characterized in that PCR amplification of the region 삭제delete
KR1020060097816A 2006-10-09 2006-10-09 Development of molecular marker associated with backfat thickness and marbling in Hanwoo KR100827544B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060097816A KR100827544B1 (en) 2006-10-09 2006-10-09 Development of molecular marker associated with backfat thickness and marbling in Hanwoo

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060097816A KR100827544B1 (en) 2006-10-09 2006-10-09 Development of molecular marker associated with backfat thickness and marbling in Hanwoo

Publications (2)

Publication Number Publication Date
KR20080032674A KR20080032674A (en) 2008-04-16
KR100827544B1 true KR100827544B1 (en) 2008-05-07

Family

ID=39573064

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060097816A KR100827544B1 (en) 2006-10-09 2006-10-09 Development of molecular marker associated with backfat thickness and marbling in Hanwoo

Country Status (1)

Country Link
KR (1) KR100827544B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101213217B1 (en) 2010-07-30 2012-12-18 충북대학교 산학협력단 SNP Markers Associated with Meat Quantity and Beef Quality in Hanwoo

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100935293B1 (en) * 2008-02-12 2010-01-06 상지대학교산학협력단 Development of single nucleotide polymorphic marker associated with meat quantity trait using tumor necrosis factor alpha gene of Korean cattle
CN101935655B (en) * 2010-10-14 2011-12-07 扬州大学 Molecule detection kit for beef tenderness selection
KR101723185B1 (en) * 2014-10-23 2017-04-05 대한민국 A polynucleotide for predicting marbling score in Hanwoo and diagnosing method using the same
KR101686436B1 (en) * 2014-11-18 2016-12-14 대한민국 A composition for detecting intramuscular fat tissue in cow and detecting method using the same

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Anim. Genet., 36(2). 111-118(2005)
J. Anim. Sci. Technol., 46(3), 295-300(2004)
NCBI Accession Number AJ571671(2005.03.21.)
NCBI Accession Number DQ202319(2005.10.03.)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101213217B1 (en) 2010-07-30 2012-12-18 충북대학교 산학협력단 SNP Markers Associated with Meat Quantity and Beef Quality in Hanwoo

Also Published As

Publication number Publication date
KR20080032674A (en) 2008-04-16

Similar Documents

Publication Publication Date Title
US7947444B2 (en) Leptin promoter polymorphisms and uses thereof
JP6424027B2 (en) DNA markers related to the 6 traits of pigs developed by analyzing the relations with traits and their discrimination systems
KR100827544B1 (en) Development of molecular marker associated with backfat thickness and marbling in Hanwoo
KR100935293B1 (en) Development of single nucleotide polymorphic marker associated with meat quantity trait using tumor necrosis factor alpha gene of Korean cattle
KR101083213B1 (en) Diagnosis method of meat quality using DNA marker associated with marbling score in Hanwoo
KR100786534B1 (en) Development of DNA molecular marker associated with daily weight gain in Korean cattleHanwoo
KR100818052B1 (en) Development of molecular dna marker associated with meat quantity traits of hanwoo
US20060275793A1 (en) Association between markers in the leptin gene and carcass traits in commercial feedlot steer and heifers
KR100818166B1 (en) Devolopment of molecualar marker for diagnosis of korean cattle producing high meat amount
KR101472000B1 (en) SNP for determination of meat quantity in Hanwoo and diagnosis method of meat quantity using the same
KR101289576B1 (en) Development of molecular marker related to meat quantity in Hanwoo
KR100816993B1 (en) Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo
KR101307008B1 (en) Diagnosis method of high meat producing Hanwoo using the DNA marker associated with marbling score
KR102001528B1 (en) Gene marker for discrimination of Korean Native pig and use thereof
KR101289484B1 (en) Method of genetic test for diagnosis of marbling trait in Korean cattle
Bandi et al. Comparative study of gene structure in the upstream regulatory region of CDC10 and MYBPC1 genes in Iranian fat-tailed and nonfat-tailed sheep breeds
KR100854923B1 (en) Development of molecular DNA marker for early selection of Hanwoo with high dressing percentage
KR101700529B1 (en) Diagnosis method for meat quantity using the DNA marker associated with longissimus muscle area in Hanwoo
EP1660675B1 (en) Polymorphism of the igf2 gene and improving production characteristics of cattle
KR20110038490A (en) Development of dna marker associated with higher meat quantity and diagnosis method of high meat quantity producing hanwoo using the dna marker
KR101417389B1 (en) Development of genetic marker related to maturity score in Hanwoo
KR102194877B1 (en) Method for predicting economic traits in in Hanwoo with GALM gene
KR101797876B1 (en) Diagnostic method for longissimus muscle area by using SNP markers in Korean cattle
KR101307087B1 (en) Diagnosis method of high quality meat using the SNP marker in Hanwoo
KR101853201B1 (en) Diagnostic method for carcass weight by using SNP markers of glutathione peroxidase 3 gene in Korean cattle

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
AMND Amendment
E601 Decision to refuse application
AMND Amendment
J121 Written withdrawal of request for trial
J201 Request for trial against refusal decision
B701 Decision to grant
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20120430

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20130314

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee