KR100816993B1 - Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo - Google Patents

Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo Download PDF

Info

Publication number
KR100816993B1
KR100816993B1 KR1020060110037A KR20060110037A KR100816993B1 KR 100816993 B1 KR100816993 B1 KR 100816993B1 KR 1020060110037 A KR1020060110037 A KR 1020060110037A KR 20060110037 A KR20060110037 A KR 20060110037A KR 100816993 B1 KR100816993 B1 KR 100816993B1
Authority
KR
South Korea
Prior art keywords
hanwoo
weight
carcass
korean native
live weight
Prior art date
Application number
KR1020060110037A
Other languages
Korean (ko)
Inventor
정의룡
신성철
박종근
신기현
Original Assignee
상지대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 상지대학교산학협력단 filed Critical 상지대학교산학협력단
Priority to KR1020060110037A priority Critical patent/KR100816993B1/en
Application granted granted Critical
Publication of KR100816993B1 publication Critical patent/KR100816993B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A method for determining Korean native cattle with high live weight and carcass weight is provided to be used for improving a breeding more efficiently and economically by developing an SNP marker of an acetyl-coenzyme A carboxylase(ACC) gen, thereby selecting the Korean native cattle having high live weight and carcass at an early stage and being utilized for the Korean native cattle improving business. A method for determining Korean native cattle with high live weight and carcass weight comprises the steps of: (a) detecting an SNP marker per individual in accordance with a substitution of a 118th base T with C in a Korean native cattle gene sequence described in SEQ ID : NO. 1 by a PCRSSCP analysis using a PCR product of a Korean native cattle gene amplified by primers of SEQ ID : NOs. 2 and 3; and (b) analyzing each of genotypes of TT, TC and CC to predict the Korean native cattle with high live weight and carcass weight, wherein the Korean native cattle showing a CC genotype marker is determined to have higher live weight and carcass weight than the Korean native cattle showing TT and TC genotype markers.

Description

지방산 생합성 조절효소 유전자를 이용한 한우 생체중 및 도체중 연관 분자마커 개발{Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme A carboxylase gene in Hanwoo}Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme A carboxylase gene in Hanwoo}

도면 1은 본 발명에서 한우 ACC 유전자의 PCR 증폭산물 전기영동 사진1 is a PCR amplification product electrophoresis picture of Hanwoo ACC gene in the present invention

도면 2는 본 발명에서 PCR-SSCP 기법으로 검출한 한우 ACC 유전자의 각 유전자형별 단일염기다형마커(SNP marker) 전기영동 사진 Figure 2 is a single nucleotide polymorphic marker (SNP marker) electrophoresis picture of each genotype of Hanwoo ACC gene detected by the PCR-SSCP technique in the present invention

도면 3은 본 발명에서 한우 ACC 유전자의 단일염기다형(SNP) 염기서열 분석 크로마토그램 Figure 3 is a monobasic polymorphism (SNP) sequencing chromatogram of Hanwoo ACC gene in the present invention

본 발명은 한우의 도체형질과 관련된 한우 개체별 유전적 차이를 비교 검출하기 위한 것으로서, 한우 생체중 및 도체중에 관련된 유전자의 구조변이 탐색으로 육량향상을 위한 유전적 표지인자(SNP marker)를 개발하여 우량 한우를 조기에 판정하고 선발하는 방법에 관한 것이다.The present invention is to compare and detect the genetic differences of individual Hanwoo individuals related to the carcass characteristics of Hanwoo, the development of genetic markers (SNP marker) for meat improvement by searching for structural variation of genes related to livestock and carcass weight of Hanwoo It is about a method of judging and selecting Hanwoo early.

일반적으로 가축의 육종개량에 있어 종래의 양적 유전학적 방법은 가축의 표현형적 기록에 근거로 한다. 즉, 후보종모우는 혈통기록과 체형 발달 등의 당대기록으로 우선 선발하고 빈우와의 교배에 의해 생산되는 후대 검정우를 사육, 도축하여 성장 및 도체 형질등을 기록하고 가축이 사육되어진 환경 요인들을 최대한 배제하면서 가축의 진정한 육종가를 추정해 내기 위한 가장 적절한 통계 모델식을 고안하여 종축을 선발하게 되는데, 이러한 표현형적 관측치를 측정하는 데는 많은 시간이 소요되므로 종축의 선발을 지연하게 되어 세대 간격이 길어지고 많은 두수의 후보 종축을 사육하게 되므로 사료비, 시설 투자비 및 유지비, 인건비 등의 경제적 비용과 필요 이상의 노동력이 소요된다.In general, conventional quantitative genetic methods for breeding of livestock are based on livestock phenotypic records. In other words, candidate cows are selected first by the generation records such as lineage records and body development, and breed and slaughter the latter black cattle produced by crossbreeding, record growth and carcass traits, and maximize the environmental factors in which livestock are raised. By excluding the breeders, we devised the most appropriate statistical model to estimate the true breeders of livestock, and it took much time to measure these phenotypic observations, which delayed the selection of breeders, resulting in longer generation intervals. Because of the large number of candidate breeders, economic costs such as feed costs, facility investment and maintenance costs, labor costs, and labor costs are required.

한편, 가축의 표현 형질을 지배하는 것은 환경에 의해서도 지배되어지지만, 동일한 환경에서 사육된 어떤 한 집단에서도 표현 형질마다 개체간 차이가 존재한다. 이는 결국 개체가 지니는 유전자 수준의 차이에 기인되며, 유전공학, 분자생물학 및 주변관련 과학기술의 급속한 발전으로 가축의 표현 형질 중 경제 형질에 관여하는 유전체의 정보를 이해하여 조기 선발에 의한 세대 간격 단축, 선발강도, 선발의 정확도 등의 향상시켜 연간 유전적 개량량을 증대시킬 수 있는 유전적 표지인자 개발 연구가 시도되고 있다.On the other hand, the dominant phenotypic traits of livestock are governed by the environment, but there are differences among individuals in each of the trait traits in any group raised in the same environment. This is attributable to the differences in gene levels of individuals, and the rapid development of genetic engineering, molecular biology, and surrounding related science and technology to shorten the generation gap by early selection by understanding the information of genomes involved in economic traits among livestock expression traits. The development of genetic markers that can increase the annual genetic improvement by improving the selection strength, the accuracy of selection, etc. is being attempted.

본 연구에서 이용한 acetyl-coenzyme A carboxylase(ACC) 유전자는 Acetyl- CoA를 카르복실화 시켜 Malonyl-CoA로 만들어 지방산 생합성의 개시를 시작하고 지방산 생합성 과정 중 조절효소로서 작용한다. 지방산 생합성의 속도조절 단계에서 카르복실화 과정을 촉매하여 흡수된 영양소를 지방으로 저장할 것인가 또는 대사로 소모시킬 것인지를 결정하는 중요한 인자로서 ACC 유전자가 비활성화 되면 지방 축적은 억제되고 축적된 지방은 연소하게 된다. 이러한 ACC 유전자를 이용한 연구는 현재 식물분야에서 활발히 진행되어 이를 이용한 제초제가 개발되어 판매되고 있으으며, 최근 미국 베일러 의과대학의 와킬 박사 연구에 따르면 ACC 효소를 차단하면 보통 때 보다 훨씬 많이 먹고도 체중이 줄어드는 것으로 쥐 실험결과 밝혀졌다. 실험결과 ACC 가 부족하도록 유전적으로 조작된 쥐들은 보통 쥐들보다 40%를 더 먹고도 몸무게는 오히려 10~15% 줄어든 것으로 나타났다. 이는 ACC 가 억제되면서 근육과 심장세포 등이 빠르게 지방을 연소시켜 이같은 결과가 나타난다고 설명했다.The acetyl-coenzyme A carboxylase (ACC) gene used in this study carboxylates Acetyl-CoA into malonyl-CoA to initiate fatty acid biosynthesis and act as a regulatory enzyme during fatty acid biosynthesis. In the rate-controlling step of fatty acid biosynthesis, it is important to determine whether the absorbed nutrients are stored as fat or metabolized by catalyzing the carboxylation process. When ACC gene is inactivated, fat accumulation is suppressed and accumulated fat do. Research using the ACC gene is currently being actively conducted in the plant field, and herbicides using the same have been developed and sold. According to a recent research by Dr. Wakil of Baylor Medical University, blocking the ACC enzyme results in weight loss even more than usual. The shrinkage was found in rat experiments. Experiments showed that mice genetically engineered to lack ACC lost 40% of their weight, even though they ate 40% more than normal mice. This is explained by the fact that muscle and heart cells burn fat rapidly when ACC is suppressed.

따라서, 본 발명은 우리나라 고유의 소 품종이자 유일한 쇠고기 생산자원인 한우를 대상으로 지방산 생합성 과정의 조절인자로 작용하는 ACC 유전자의 염기구조 변이를 이용하여 생체중과 도체중이 높은 한우를 조기에 판정하고 선발할 수 있는 기술을 개발하여 우리나라 한우 사육 농가를 보호하고 나아가 한우산업의 국제 경쟁력을 강화에 기여할 수 있는 첨단 분자육종 기술을 제공한다.Therefore, the present invention is to determine and select early Hanwoo cattle with high live weight and carcass weight by using the base structure variation of ACC gene, which acts as a regulator of fatty acid biosynthesis process, for Korean cattle, which is a native cattle breed and the only beef production resource in Korea. We will develop advanced technologies to protect Korean cattle breeding farmers and provide advanced molecular breeding technologies that can contribute to strengthening the international competitiveness of the Hanwoo industry.

본 발명은 한우의 지방산 생합성 개시점이자 조절인자인 ACC 유전자를 이용하여 우리나라 재래 소 품종인 한우를 대상으로 단일염기다형(SNP) 탐색 및 발굴을 통해 유전자의 구조적 차이를 규명하고, 한우의 육량 등급항목에 매우 중요한 영향을 미치는 생체중과 도체중에 미치는 효과 분석을 통해 관련 SNP marker를 개발하여 생체중과 도체중이 높은 한우를 조기에 식별하고 선발할 수 있는 분자육종 기술 을 개발함으로써 나아가 한우 개량사업에 활용하는데 그 목적이 있다. The present invention uses the ACC gene, which is the starting point and regulator of fatty acid biosynthesis of Hanwoo, to investigate the structural differences of genes through the search and discovery of single nucleotide polymorphism (SNP) in Korean native cattle breeds, and the meat grade of Hanwoo By analyzing the effects on live weight and carcass weight, which have a very important effect on the item, we develop related SNP markers and develop molecular breeding technology that can identify and select Hanwoo, which is high in live weight and carcass weight, and then use them for Hanwoo improvement business. Its purpose is to.

다음의 실시 예에 따라 본 발명을 상세히 설명한다.The present invention will be described in detail according to the following examples.

실시 예 1 : 한우 ACC 유전자의 SNP 유전자형 검출Example 1 SNP Genotyping of Hanwoo ACC Genes

1. 공시재료 및 DNA 분리 정제1. Test material and DNA separation and purification

본 발명에 사용한 한우는 국가 후대검정사업에 등록하고 후대검정을 통하여 혈통기록과 도체성적을 보유하고 있는 후보 종모우 집단 총 147두를 공시축으로 선정하였다. 각 공시축 혈액으로부터의 genomic DNA의 분리 및 정제는 Miller등(1988)의 방법을 일부 변경하여 분리 정제하였으며 스펙트로포토메타(spectrophotometer)를 이용하여 DNA 농도를 측정한 후 TE buffer(10mM Tris-HCl, pH 7.4; 1mM EDTA)에 용해하여 -20℃ 냉동고에 보존하고 공시재료로 사용하였다.Hanwoo, used in the present invention, was registered with the National Hospitality Assurance Project and selected 147 headed cattle breeding populations with lineage records and carcass scores through the Subsequent Test. Separation and purification of genomic DNA from each coaxial blood was partially purified by some modifications of Miller et al. (1988). After measuring DNA concentration using spectrophotometer, TE buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA), stored in -20 ℃ freezer and used as a test material.

2. 한우 ACC 유전자의 PCR 증폭 및 단일염기다형(SNP) 검출2. PCR Amplification and SNP Detection of Hanwoo ACC Gene

한우 ACC 유전자 intron 1번 영역의 202bp 크기의 DNA 단편을 증폭하기 위한 프라이머(primer)는 GenBank 등록번호 AJ430417호에 등록된 염기서열 정보 2227번째부터 2428번째까지의 염기서열을 참고로 하여 서열번호 1에 제시한 바와 같이 설계 및 제작하였으며, 본 발명에 사용한 프라이머 염기서열은 다음과 같다<표 1>.A primer for amplifying a 202 bp DNA fragment of the Hanwoo ACC gene intron 1 region is shown in SEQ ID NO: 1 with reference to the base sequences 2227 through 2428 listed in GenBank Accession No. AJ430417. Designed and manufactured as shown, the primer base sequence used in the present invention is as follows.

한우 ACC 유전자의 PCR 증폭을 위한 프라이머 염기서열Primer Sequence for PCR Amplification of Hanwoo ACC Gene 유전자gene 프라이머 염기서열(5'- 3')Primer base sequence (5'-3 ') 증폭단편의 크기(bp)Amplification fragment size (bp) 증폭영역Amplification area ACCACC F - CCTCGACTCCTTCTTTTCTT R - GCAAAAGTGCCTATCAAATAF-CCTCGACTCCTTCTTTTCTT R-GCAAAAGTGCCTATCAAATA 202202 인트론 1 Intron 1

ACC 유전자의 PCR 증폭을 위한 반응 조건은 진엠프 시스템 9700(GenAmp PE Applied Biosystem, USA)을 이용하여 다음과 같은 조건하에 실시하였다. 즉, 반응액 조성은 0.2mL 튜브에 주형(template) DNA 30ng, 프라이머 각 0.1μM, dNTP 각 250μM, 10X PCR buffer, 그리고 Taq DNA 중합효소 1 unit 을 첨가하여 PCR 반응액을 총 20㎕로 조정하였다. PCR 반응조건은 최초 94℃에서 5분간 예비가열 후 94℃에서 30초, 53℃에서 30초 그리고 72℃에서 30초간의 사이클을 총 40회 반복한 다음 마지막으로 72℃에서 5분간 가열하여 DNA 증폭과정을 종료하였다. 증폭산물은 2.5% 아가로즈젤(agarose gel)에 전기영동 하여 DNA 증폭 성공여부를 검증하였다. Reaction conditions for PCR amplification of the ACC gene were performed using the GeneAmp System 9700 (GenAmp PE Applied Biosystem, USA) under the following conditions. In other words, the reaction solution composition was adjusted to a total of 20 μl by adding 30ng of template DNA, 0.1μM of primer, 250μM of dNTP, 10X PCR buffer, and 1 unit of Taq DNA polymerase to 0.2mL tube. . PCR reaction conditions were pre-heated for 5 minutes at 94 ℃, followed by 40 cycles of 30 seconds at 94 ℃, 30 seconds at 53 ℃ and 30 seconds at 72 ℃, and finally amplified DNA by heating at 72 ℃ for 5 minutes. The process was terminated. The amplified product was electrophoresed on 2.5% agarose gel to verify DNA amplification success.

AB1 310 Genetic Analyzer 염기서열 분석 장치를 이용하여 한우 ACC 유전자의 DNA 증폭산물을 direct sequencing 기법으로 염기서열을 분석한 결과 1개의 단일염기다형(SNP) 부위를 검출하였다. 즉, 서열번호 1의 118번째 염기에서 T↔C 염기치환에 의한 한우 ACC 유전자의 인트론 1번 영역 내 단일염기다형(SNP)을 검출하였다. The DNA amplification product of Hanwoo ACC gene was analyzed by direct sequencing method using AB1 310 Genetic Analyzer sequencing device. That is, a single nucleotide polymorphism (SNP) was detected in the intron 1 region of the Hanwoo ACC gene by T↔C base substitution at the 118th base of SEQ ID NO: 1.

3. PCR-SSCP(single strand conformation polymorphism, 단일쇄형태구조다형성) 기법에 의한 한우 ACC 유전자의 SNP 유전자형 분석3. SNP Genotyping of Hanwoo ACC Gene by PCR-SSCP (Single Strand Conformation Polymorphism) Technique

검출된 한우 ACC 유전자 인트론 1번 영역에서 검출된 SNP에 대한 SNP marker 유전자형을 분석하기 위해 표 1의 primer를 이용하여 공시축 총 147두의 DNA를 모두 PCR로 증폭하고, SSCP 분석을 수행하였다.In order to analyze the SNP marker genotype for the SNPs detected in the Hanwoon ACC gene intron region 1 , all 147 DNAs of the test axis were amplified by PCR using the primers of Table 1 , and SSCP analysis was performed.

PCR-SSCP 분석은 각 PCR증폭 산물 2㎕에 8㎕의 formamide dye (98% formamide, 20mM EDTA, 0.05% bromophenol blue, 0.05% xylen cyanol)를 첨가하고 95℃에서 5분간 변성시킨 후 즉시 ice에 5분간 보관하여 reannealing을 방지한 다음 10% (49:1) non-denaturation polyacylamide gel을 이용하여 250 volt에서 약 7시간 동안 전기영동을 실시 한 후, silver staining(Bassam et al., 1991)법으로 SSCP의 DNA band를 검출하고 각 banding pattern에 따른 SSCP 유전자형을 결정하였다[도면 2]. 그 다음 [도면 3]에 제시한 바와 같이 ACC 유전자의 SSCP 분석을 통하여 검출한 각 유전자형 marker의 염기서열을 크로마토그램으로 분석 비교하여 각각의 SSCP 유전자형에 상응하는 TT, TC 및 CC 3종류의 SNP marker 유전자형을 판정하였다.  PCR-SSCP analysis was performed by adding 8 µl of formamide dye (98% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylen cyanol) to 2 µl of each PCR amplification product, denatured at 95 ° C for 5 minutes, and immediately After storage for 10 minutes to prevent reannealing, electrophoresis was performed at 250 volt for about 7 hours using a 10% (49: 1) non-denaturation polyacylamide gel, followed by SSCP by silver staining (Bassam et al., 1991). DNA band was detected and SSCP genotype was determined according to each banding pattern [Fig. 2]. Then, as shown in [Fig. 3], the nucleotide sequence of each genotype marker detected through SSCP analysis of the ACC gene was analyzed and compared by chromatogram, and three types of SNP markers of TT, TC and CC corresponding to each SSCP genotype were compared. Genotype was determined.

한우 집단을 대상으로 분석한 ACC 유전자 인트론 1번 영역의 각 SNP에 대한 대립유전자 빈도와 유전자형 출현율을 분석한 결과 T 와 C 대립유전자빈도는 각각 0.517 과 0.483 로 T 대립유전자 빈도가 높게 나타났으며, SSCP 분석을 통해 검출한 SNP marker 유전자형의 출현율은 TT형 27.2%(40두), TC형 49.0%(72두) 및 CC형 23.8%(35두)로 TC hetero 형이 가장 높게 나타났다. The allele frequency and genotype prevalence of each SNP in the ACC gene intron region 1 analyzed in the Hanwoo population showed that the T allele frequency was 0.517 and 0.483, respectively. The incidence of SNP marker genotypes detected by SSCP analysis was highest in TC hetero type, with TT type 27.2% (40), TC type 49.0% (72) and CC type 23.8% (35).

실시 예 2 : 한우 ACC 유전자 인트론 1번 영역의 SNP marker와 도체 및 육질관련 형질과의 연관성 분석 Example 2 Analysis of Correlation between SNP Marker of Carcass and Meat-related Traits in Hantron ACC Gene Intron Region 1

한우 ACC 유전자 인트론 1번 영역의 SNP marker 유전자형이 도체 및 육질관련 형질의 육종가 추정치에 미치는 효과를 규명하기 위하여 SASⓐ 8.2 Package/PC를 이용하여 PROC GLM으로 통계 처리하였으며, 유전자형의 효과 중 유의성이 인정된 형질들에 대해 DMRT(Duncan`s Multiple Range Test) 방법으로 각 유전자형의 least square means간의 차이에 대한 유의성 검정을 실시하였다. In order to investigate the effect of SNP marker genotype in the area of Hanwoo ACC gene intron 1 on the estimation of breeding value of carcass and meat-related traits, it was statistically processed by PROC GLM using SASⓐ 8.2 Package / PC. The traits were tested for significance between the least square means of each genotype by the Duncan's Multiple Range Test (DMRT) method.

본 발명을 통해 검출된 ACC 유전자의 인트론 1번 증폭 영역 내 118번째 SNP에 대한 각각의 SNP 유전자형과 한우의 각종 도체 및 육질형질 간의 연관성을 통계 분석한 결과 표 2에서 보는 바와 같이 생체중 및 도체중과의 유의적 연관성이 입증되었으며(P<0.05), 특히 생체중과는 고도의 유의적 연관성이 입증되었다(P<0.01). 즉, CC homo 유전자형을 가진 개체들의 생체중이 TT homo 및 TC hetero 유전자형을 가진 개체들에 비해 각각 30.214kg(5.6%) 및 29.714kg(5.5%)정도 높게 나타났으며, 도체중에서도 CC homo 유전자형을 가진 개체들이 TT homo 및 TC hetero 유전자형을 가진 개체들에 비해 각각 17.875kg(5.8%) 및 18.011kg(5.9%)정도 높은 것으로 나타났다. 또한 도체중 육종가에서도 CC homo 유전자형을 가진 개체들이 TT homo 및 TC hetero 유전자형을 가진 개체들에 비해 각각 5.165(307.6%) 및 5.351(332.4%)정도 높은 것으로 나타났다. As a result of statistical analysis of the correlation between the respective SNP genotypes for the 118th SNP in the intron 1 amplification region of the ACC gene detected through the present invention and various carcass and meat quality of Hanwoo, as shown in Table 2 Significant association was demonstrated (P <0.05), and in particular, highly significant association with live weight was demonstrated (P <0.01). That is, the live weight of individuals with the CC homo genotype was 30.214 kg (5.6%) and 29.714 kg (5.5%) higher than those with the TT homo and TC hetero genotypes, respectively. Individuals were found to be 17.875 kg (5.8%) and 18.011 kg (5.9%) higher than individuals with TT homo and TC hetero genotypes, respectively. In carcass breeders, individuals with CC homo genotype were 5.165 (307.6%) and 5.351 (332.4%) higher than those with TT homo and TC hetero genotypes, respectively.

이상의 본 발명에 대한 결과를 종합해 볼 때 한우 ACC 유전자 인트론 1번 영역에서 검출된 SNP는 한우의 생체중 및 도체중과의 유의적 연관성이 입증되었고, 본 발명의 SSCP 분석기법을 통해 검출된 SNP marker의 특정 유전자형(CC type)을 이용하여 생체중과 도체중이 높은 한우 개체를 조기에 판정하고 선발할 수 있어 우량 한우 선발을 통한 한우의 육종개량 사업에 활용할 수 있을 것이다. Based on the results of the present invention, the SNP detected in the Hanwoo ACC gene intron region 1 has been shown to be significantly correlated with the live weight and carcass weight of Hanwoo, and the SNP marker detected through the SSCP analysis of the present invention. The specific genotype (CC type) of can be used to determine and select early Hanwoo individuals with high live weight and carcass weight, which can be used for breeding and improvement business of Korean cattle through selection of excellent Korean beef.

본 발명에서 한우 ACC 유전자 인트론 1번 영역의 SNP marker가 도체 및 육질형질에 미치는 영향 Effect of SNP Marker on Carcass and Meat Quality of Hanwoo ACC Gene Intron 1 in the Present Invention 도체 및 육질형질Carcass and meat quality SNP marker 유전자형 SNP marker genotype P-valueP-value TTTT TCTC CCCC 생체중Live weight /Of kgkg 538.000±7.879b 538.000 ± 7.879 b 537.500±5.872b 537.500 ± 5.872 b 567.714±8.423a 567.714 ± 8.423 a 0.009** 0.009 ** 도체중Conductor weight /Of kgkg 307.389±5.077b 307.389 ± 5.077 b 307.525±3.784b 307.525 ± 3.784 b 325.400±5.428a 325.400 ± 5.428 a 0.017* 0.017 * 도체율Conductor rate /%/% 57.132±0.24657.132 ± 0.246 57.126±0.18357.126 ± 0.183 52.280±0.26352.280 ± 0.263 0.8810.881 등지방두께Back fat thickness /Of cmcm 0.655±0.0430.655 ± 0.043 0.618±0.0320.618 ± 0.032 0.691±0.0460.691 ± 0.046 0.4170.417 등심단면적/Fillet area / cmcm ²² 75.075±1.29875.075 ± 1.298 74.500±0.96774.500 ± 0.967 76.485±1.38876.485 ± 1.388 0.5030.503 근내지방도Intramuscular fat map /1~7/ 1-7 1.950±0.1961.950 ± 0.196 2.000±0.1462.000 ± 0.146 2.342±0.2092.342 ± 0.209 0.3200.320 도체중Conductor weight -- 육종가Breeder /1~7/ 1-7 2.302±1.581b 2.302 ± 1.581 b 2.488±1.179b 2.488 ± 1.179 b 7.653±1.691a 7.653 ± 1.691 a 0.028* 0.028 *

주) * P<0.05, ** P<0.01Note) * P <0.05, ** P <0.01

a,b : 서로 다른 부호간에는 유의차가 있음.a, b: There is significant difference between different codes.

이상의 실시 예를 통하여 명백한 바와 같이 한우 ACC 유전자 인트론 1번 영 역 내 SNP에 대한 SSCP 유전자형 marker를 이용하여 한우 각각의 품종 개체의 육질 특성을 규명할 수 있으며 이를 바탕으로 생체중과 도체중이 높은 우량 한우의 조기 진단 및 선발과 더불어 유용 유전자원의 산업적 활용이 가능하다. 즉, 본 발명의 기술을 이용하여 국가적으로는 보증 종모우 및 종빈우의 선발, 사육농가에서는 비육 밑소 및 육량이 우수한 우량 송아지 조기 진단 통한 선발 등에 산업적 활용을 통해 나아가 한우 육종개량사업의 효율성과 개량성과를 극대화하고 동시에 우리나라 고유의 한우 유전자원을 보다 우수하게 개량하고 보존하는 효과를 얻을 수 있다. 또한, 본 발명은 한우의 genomic DNA를 가지고 PCR-SSCP 분석 기법을 이용하는 최첨단 분자육종 기술로서 다수의 시료를 대상으로 SNP 유전자형을 보다 간편하고 신속하며, 정확하게 판정할 수 있는 장점이 있는 기술로서 산업적 실용화가 가능하다.As is clear from the above examples, the meat quality characteristics of each breed of Hanwoo cattle can be identified by using the SSCP genotype marker for SNP in the Hanwoo ACC gene intron 1 region. In addition to early diagnosis and selection, the use of useful genetic resources is possible. In other words, by using the technology of the present invention through the industrial use, such as the selection of guaranteed breeding cattle and breeding cows in the country, early selection of excellent calf in the rearing cattle and rearing cattle in the rearing farms, industrial efficiency and improvement results of the Hanwoo breeding improvement business At the same time, it is possible to obtain the effect of improving and conserving Korea's own Hanwoo genetic resources. In addition, the present invention is a state-of-the-art molecular breeding technology using PCR-SSCP analysis technique with genomic DNA of Hanwoo, which has the advantage of making it easier, faster and more accurate to determine the SNP genotype for a large number of samples. Is possible.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (3)

서열번호 2 및 서열번호 3의 프라이머(primer)에 의해 증폭된 한우 ACC 유전자의 PCR 증폭산물을 이용하는 PCR-SSCP 분석법으로 서열번호 1에 제시한 한우 ACC 유전자 염기서열 118번째 T↔C 염기치환(SNP)에 따른 개체별 SNP marker를 검출하고 각각의 유전자형(TT, TC 및 CC)을 분석하여 생체중과 도체중이 높은 한우를 예측하여 판정하는 방법PCR-SSCP analysis using PCR amplification products of Hanwoo ACC gene amplified by primers SEQ ID NO: 2 and SEQ ID NO: 3 118th T↔C base substitution (SNP) Method to detect individual SNP markers and analyze genotypes (TT, TC and CC) to predict and determine Korean cattle with high live weight and carcass weight 청구항 1에 있어서,The method according to claim 1, 5'에서 3' 방향으로 CCTCGACTCCTTCTTTTCTT의 염기서열 구조를 갖는 서열번호 2의 정방향 프라이머(Forward primer)와 5'에서 3' 방향으로 GCAAAAGTGCCTATCAAATA의 염기서열 구조를 갖는 서열번호 3의 역방향 프라이머(Reverse primer)를 이용하여 한우 ACC 유전자 인트론 1번의 일부 영역을 PCR 증폭하여 SSCP 분석을 수행하는 것을 특징으로 하는 생체중과 도체중이 높은 한우를 예측하여 판정하는 방법A forward primer of SEQ ID NO: 2 having a nucleotide sequence structure of CCTCGACTCCTTCTTTTCTT in the 5 'to 3' direction and a reverse primer of SEQ ID NO: 3 having a nucleotide sequence structure of GCAAAAGTGCCTATCAAATA in the 5 'to 3' direction; A method of predicting and determining Hanwoo, which has high live weight and carcass weight, by performing PCR amplification on a portion of Hanwoo ACC gene intron 1 using SSCP analysis 청구항 1에 있어서,The method according to claim 1, PCR-SSCP 분석법으로 검출된 한우 ACC 유전자의 세 가지 SNP marker 유전자형(TT, TC 및 CC) 가운데 CC 유전자형 marker를 나타내는 한우 개체를 TT 및 TC 유전자형 marker를 나타내는 한우 개체에 비해 생체중과 도체중이 높은 한우로 예측하여 판정하는 방법Of the three SNP marker genotypes (TT, TC, and CC) of the Hanwoo ACC genes detected by PCR-SSCP analysis, Hanwoo individuals with CC genotype markers were compared with Hanwoo individuals with TT and TC genotype markers. How to predict by judging
KR1020060110037A 2006-11-08 2006-11-08 Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo KR100816993B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060110037A KR100816993B1 (en) 2006-11-08 2006-11-08 Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060110037A KR100816993B1 (en) 2006-11-08 2006-11-08 Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo

Publications (1)

Publication Number Publication Date
KR100816993B1 true KR100816993B1 (en) 2008-03-26

Family

ID=39411754

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060110037A KR100816993B1 (en) 2006-11-08 2006-11-08 Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo

Country Status (1)

Country Link
KR (1) KR100816993B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101236298B1 (en) 2010-06-22 2013-02-26 대한민국 Single nucleotide polymorphism (SNP) markers associated with backfat thickness trait in pig and their methods for evaluation
KR101280652B1 (en) 2011-11-07 2013-07-01 상지대학교산학협력단 Technology of genome selection related to backfat thickness in Korean cattle

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010016520A (en) * 2000-12-16 2001-03-05 정의룡 Development of PCR-SSCP method for Identification of Hanwoo Meat
KR20060011287A (en) * 2004-07-30 2006-02-03 대한민국(관리부서:농촌진흥청) Genetic marker of bovine growth hormone gene for the meat quality in hanwoo
KR20060058968A (en) * 2004-11-26 2006-06-01 건국대학교 산학협력단 Selection techniques of bovine weight trait by using the genetic marker of hanwoo growth hormone gene
KR20070038836A (en) * 2005-10-07 2007-04-11 정의룡 Development of molecular marker gene related with meat quality using stearoyl- coa desaturase (scd) gene of hanwoo

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20010016520A (en) * 2000-12-16 2001-03-05 정의룡 Development of PCR-SSCP method for Identification of Hanwoo Meat
KR20060011287A (en) * 2004-07-30 2006-02-03 대한민국(관리부서:농촌진흥청) Genetic marker of bovine growth hormone gene for the meat quality in hanwoo
KR20060058968A (en) * 2004-11-26 2006-06-01 건국대학교 산학협력단 Selection techniques of bovine weight trait by using the genetic marker of hanwoo growth hormone gene
KR20070038836A (en) * 2005-10-07 2007-04-11 정의룡 Development of molecular marker gene related with meat quality using stearoyl- coa desaturase (scd) gene of hanwoo

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101236298B1 (en) 2010-06-22 2013-02-26 대한민국 Single nucleotide polymorphism (SNP) markers associated with backfat thickness trait in pig and their methods for evaluation
KR101280652B1 (en) 2011-11-07 2013-07-01 상지대학교산학협력단 Technology of genome selection related to backfat thickness in Korean cattle

Similar Documents

Publication Publication Date Title
Ahlawat et al. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes
CN112251518B (en) Molecular marker associated with lambing number and growth traits in goat RSAD2 gene and application thereof
US20090269741A1 (en) Method for assessing traits selected from longissimus dorsi peak force, intramuscular fat, retail beef yield and net feed intake in bovine animals
CN110468212B (en) SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application
KR100935293B1 (en) Development of single nucleotide polymorphic marker associated with meat quantity trait using tumor necrosis factor alpha gene of Korean cattle
CN112941199A (en) Method for evaluating pig backfat thickness and eye muscle area and application thereof
KR100827544B1 (en) Development of molecular marker associated with backfat thickness and marbling in Hanwoo
KR100786534B1 (en) Development of DNA molecular marker associated with daily weight gain in Korean cattleHanwoo
CN114107516B (en) SNP (single nucleotide polymorphism) marker for evaluating backfat thickness of pig and detection method thereof
KR100818052B1 (en) Development of molecular dna marker associated with meat quantity traits of hanwoo
CN116377082B (en) Application of sheep LCORL gene single nucleotide polymorphism marker in growth trait selection
KR100816993B1 (en) Development of molecular marker associated live weight and carcass weight using acetyl-coenzyme a carboxylase gene in hanwoo
KR100774849B1 (en) Development of molecular marker of fatty acid-binding proteinFABP gene associated with longissimus muscle area and backfat thickness in Korean cattle
KR101289576B1 (en) Development of molecular marker related to meat quantity in Hanwoo
CN115109856A (en) Molecular marker related to sheep stage body weight, detection method and application thereof
CN110438237B (en) SNP (single nucleotide polymorphism) site related to posttendinosus and fashion head weight on chromosome 6 of meat Simmental cattle and application
JP4982746B2 (en) Pig parent-child determination method using DNA marker
KR100818166B1 (en) Devolopment of molecualar marker for diagnosis of korean cattle producing high meat amount
KR101307008B1 (en) Diagnosis method of high meat producing Hanwoo using the DNA marker associated with marbling score
CN102443633A (en) Method for real time quantitative PCR detection of hematopoietic chimeras and designing of genetic marker primers of hematopoietic chimeras
CN112695104A (en) SNP molecular marker for deep character of eye muscle of white pig and application
KR101289484B1 (en) Method of genetic test for diagnosis of marbling trait in Korean cattle
KR20110038490A (en) Development of dna marker associated with higher meat quantity and diagnosis method of high meat quantity producing hanwoo using the dna marker
KR100854923B1 (en) Development of molecular DNA marker for early selection of Hanwoo with high dressing percentage
CN115851962B (en) Molecular marker related to abdominal fat weight character of chicken and application thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20120412

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20130314

Year of fee payment: 6

LAPS Lapse due to unpaid annual fee