KR101289576B1 - Development of molecular marker related to meat quantity in Hanwoo - Google Patents

Abstract

The present invention relates to a method for diagnosing Hanwoo beef traits using genetic molecular markers that are closely related to the backfat thickness of Korean cattle. The present invention relates to a method for diagnosing and determining the genetic characteristics of Korean cattle with thin backfat thickness. The purpose of this study is to provide a genetic diagnostic method that can be used to develop related molecular labels and improve the accuracy of early selection and individual evaluation of excellent Hanwoo cattle.
More specifically, the present invention relates to SNP genotypes of individual cattle by PCR-RFLP (Restriction Fragment Length Polymorphism) using a specific SNP present in the intron 6 region of the Hanwoo PON1 (paraoxonase 1) gene. By detecting the DNA marker according to the present invention, a method of diagnosing and identifying individuals with TC genotype among those with genetically thin back fat thickness compared to those with TT and CC genotypes is provided.

Description

Development of molecular marker related to meat quantity in Hanwoo}

The present invention relates to Hanwoo beef traits using specific SNP (monobasic polymorphism) of Hanwoo PON1 (paraoxonase 1) gene through PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) analysis. By developing molecular markers, this technology provides a technique for diagnosing and determining Hanwoo cattle, which are genetically thin back fat thickness.

Polymerase chain reaction (PCR) was first introduced by Kary Mullis in 1986. The development of the PCR method is a revolutionary technology that allows the state of the target gene to be known using a small amount of DNA. In 1953, the world of DNA molecular biology, which began with the discovery of the DNA helix structure by Watson and Crick, was a new development 20 years later with the discovery of restriction enzymes and the subsequent development of DNA cloning and sequencing methods. Recent developments in molecular genetic techniques have led to the development of gene markers at the DNA level.

In the field of genetics and breeding of livestock, the gene is used as a marker gene for breeding improvement by using DNA polymorphism. DNA polymorphisms enable the development of markers by major genes and quantitative trait loci (QTLs) that determine important economic traits and include linkage analysis, genetic maps, parenetage testing has been used as a powerful tool to analyze distingtion of breeds, pedigree analysis, genetic diversity and relationships. In particular, selective breeding techniques using DNA markers have been used as a way to enhance the hereditary capacity of livestock beyond the limits of traditional selection breeding methods. Such genetic engineering techniques include Random Amplified Polymorphic DNA (RAPD), Amplified Fragment Length Polymorphism (AFLP), Single Strand Conformational Polymorphism (SSCP), and Restriction Fragment Length Polymorphism (RFLP). Among them, the RFLP technique, which is a technique for analyzing the polymorphism of DNA fragments by restriction enzyme treatment, is excellent in reproducibility and high in efficiency, and thus is usefully used as a gene diagnosis method.

Accordingly, the present invention provides a technique that can be used for early diagnosis of high-quality Korean cattle by detecting the molecular markers that are closely related to the Hanwoo beef trait using the PCR-RFLP technique.

Beef consumption has accelerated since the 1990s, and beef imports have continued to increase. Therefore, in order to improve and enhance the international competitiveness of domestic beef, it is urgently needed to improve consumer quality by improving the quality of Korean beef and to improve economic efficiency by increasing meat production. Therefore, in order to enhance the competitiveness of Hanwoo, the improvement of the ability of Hanwoo's major economic characteristics is the most sure means of securing competitiveness. At present, livestock grading in Korea is based on carcass weight, dressing percentage, backfat thickness and M. longissimus Carcass grades, such as dorsi area), are used to determine meat grades by A, B, C, and iso-grade grades. Among these items, back fat thickness is one of the most significant factors in determining meat grade. The thinner the back fat thickness, the wider the cross-sectional area is expected to increase the amount of meat. Therefore, it is important to diagnose and select excellent individuals with genetically thin back fat thickness early in order to raise the economic efficiency of the cattle. Do. Conventional quantitative genetic methods for livestock breeding have relied on the phenotypic record of livestock. In other words, candidate cows are selected first by the current records such as pedigree records and body development, breeding and slaughtering subsequent black cattle produced by crossbreeding, recording carcass and meat traits, and excluding the environmental factors in which livestock is raised as much as possible. In order to estimate the true breeding value of livestock, we devised the most appropriate statistical model to select breeders, which takes much time to measure phenotypic observations, delaying the selection of breeders, resulting in longer generation intervals and many head counts. Since the breeder is raising a breeder's breeder, it costs economic and excessive labor such as feed, facility investment, maintenance and labor costs. Due to such a very inefficient method, there is an urgent need for a method for judging Hanwoo beef grading to select and raise early-quality beef cattle more scientifically and quickly.

Therefore, the present invention has been carried out to develop a technique capable of early diagnosis and selection of genetically engineered Hanwoo cattle using the molecular markers associated with Hanwoo beef traits using the latest molecular breeding technology.

Therefore, the present inventors have researched and developed to improve the above problems, and selected the PON 1 (paraoxonase 1) gene present in the chromosome 4 of bovine as a candidate gene related to meat quality and quantitative quality of Korean beef, and closely related to the fat thickness of Korean beef. We have discovered molecular markers that are closely related and invented a method for diagnosing superior Korean cattle.

PON 1 gene is attached to high-density lipoprotein and protects against high-density lipoprotein (HDL) and low-density lipoprotein (LDL) oxidation. It is known to play an important role in mammalian growth metabolism and physiology. have. Previous studies have reported that the PON1 gene polymorphism affects growth traits and carcass characteristics in beef cattle, and that PON1 protein has a role in coordinating insulin, growth hormone, lipoproteinase, and Leptin, a representative obesity gene. have. Therefore, in the present invention, the PON1 gene affecting the growth and carcass characteristics of mammals is finally selected as a candidate gene for traits related to Hanwoo cattle and genetically analyzed through the analysis of the association between the specific SNP genotype of the PON1 gene and the traits of Hanwoo cattle. We have developed a technique for early diagnosis and discrimination of high quality Korean cattle.

More specifically, genomic DNA is isolated from the blood of Hanwoo, amplified by PCR using primers containing the introns 6 to 7 regions of the PON1 gene, and then BstE to the amplified PCR product. DNA fragments digested with II restriction enzymes were electrophoresed on agarose gel to determine DNA markers for each genotype, and the backfat thickness through statistical analysis of the association between carcass quality and meat quality of Hanwoo By detecting DNA markers associated with, we can provide excellent diagnostic method for Hanwoo cattle with genetically thin back fat thickness.

According to the present invention, the DNA of the Hanwoo individual using DNA genotype markers (TT, TC and CC type) due to specific SNP (SEQ ID No. 1, S231, T↔C base substitution) in the Hanwoo PON1 gene intron 6 amplified by PCR The carcass rearing characteristics of the backfat thickness can be identified, and based on this, early diagnosis and selection of excellent Hanwoo cattle and industrial utilization of useful genetic resources are possible. In other words, early diagnosis and selection of individuals with TC genotype of PON1 gene maximizes the efficiency and improvement of the Hanwoo Breeding Improvement Project, and at the same time, improves and preserves Korea's unique Hanwoo genetic resources. Can be.

In addition, the present invention is a state-of-the-art molecular breeding technique using PCR-RFLP analysis method for genomic DNA of Hanwoo, the PCR-RFLP analysis technique used in the present invention can maximize the efficiency and practicality of selection since it is fast, simple and accurate. In addition, there is an advantage that the DNA marker genotype can be more easily, quickly and accurately determined in a large number of samples.

Figure 1 shows the SNP genotype (DNA marker) of each individual due to the 231 th T↔C monobasic polymorphism (SNP) in the Hanwoo PON1 gene amplification region of SEQ ID NO: 1 detected by the PCR-RFLP analysis technique in the present invention Yeongdong pictures
Figure 2 shows the base sequence of each SNP genotype (DNA marker) for the 231rd T↔C monobasic polymorphism (SNP) in the Hanwoo PON1 gene amplification region of SEQ ID NO: 1 detected by the PCR-RFLP analysis technique in the present invention Analytical chromatogram

In order to achieve the above objects, the present invention will be described in more detail with reference to the following non-limiting examples.

Example 1: PON1  Gene SNP  Genotype detection

1. Disclosure material and DNA separation purification

Hanwoo, used in the present invention, was registered with the National Hospitality Assurance Project and selected 147 headed cattle breeding populations with lineage records and carcass scores through the Subsequent Test. Separation and purification of genomic DNA from each coaxial blood was partially purified by some modification of Miller et al. (1988). After measuring DNA concentration using spectrophotometer, TE buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA), stored in -20 ℃ freezer and used as a test material.

2. PCR Amplification and SNP Detection of Hanwoo PON1 Gene

For primers for amplifying the 582 bp sized DNA fragment shown in SEQ ID NO: 1 comprising the regions of intron 6 to intron 7 of the Hanwoo P0N1 gene, refer to the nucleotide sequence information registered in GenBank Accession No. NC_007302.4. By designing and manufacturing as shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively, the primer base sequence used in the present invention is shown in Table 1.

Primer Sequences for PCR Amplification of Hanwoo PON1 Gene Gene name Amplification area The primer sequence (5'-3 ') SEQ ID NO: PON1 Intron 6-Intron 7 Forward F-GCTTTTGCTCGAAGATGCTAAG
Reverse R-TTGCATAGACGATGTGTGTGGT 2
3

Reaction conditions for PCR amplification of the PON1 gene were performed using the Geneamp System 9700 (GenAmp PE Applied Biosystem, USA) under the following conditions. The reaction solution was prepared by adding 50 ng of template DNA, 0.1 μM of each primer, 250 μM of dNTP, 2 μl of 10X PCR buffer and 1 unit of Taq DNA polymerase to a 0.2 ml tube. ≪ / RTI > PCR reaction conditions were pre-heated for 5 minutes at 94 ° C, followed by a total of 35 cycles of 30 seconds at 94 ° C, 30 seconds at 55 ° C, and 1 minute at 72 ° C, and finally amplified DNA by heating at 72 ° C for 5 minutes. The process was terminated. PCR amplification products were electrophoresed on 2% agarose gel to verify DNA amplification success. As a result of sequencing by direct sequencing technique using PCR amplification products of the Hanwoo PON1 gene, a total of 582 bp bases were detected as shown in SEQ ID NO. A base polymorphism (SNP) site was detected. That is, the SNP was detected by T↔C base substitution at the 26,129th base of the NCBI GenBank registration number NC_007302.4 (the 231th position of SEQ ID NO: 1). RFLP analysis was performed using BstE II restriction enzyme for SNP genotyping of individual Korean cattle subjects for SNPs according to the detected 231 th T↔C base substitution of SEQ ID No. 1.

3. Analysis of SNP Genotype Marker of Hanwoo PON1 Gene by PCR-RFLP Technique

The BstE Ⅱ restriction enzyme recognition site (5'-G'GTNAC_C-3 ') is present at the 231 th T↔C SNP site in the amplified region of the detected Hanwoo PON1 gene. DNA markers were detected (Fig. 1 and Fig. 2).

RFLP analysis of the Hanwoo PON1 gene was performed in 5 μl PCR amplification products. BstE II restriction enzyme was added and then digested at 37 ° C. for at least 3 hours. DNA fragments obtained by cleaving each PCR amplification product with restriction enzymes were electrophoresed for 2 hours at 100 volt voltage on 2% agarose gel using TBE buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.0). After staining with EtBr (ethidium bromide), the DNA fragments were observed to determine the SNP genotype of each assay individual. That is, in the individuals with TT homo genotype, there was no restriction enzyme recognition site, so a total of 1 DNA fragment with a size of 582 bp was detected. In the individuals with CC homo genotype, one restriction enzyme recognition site was present, resulting in 231,351. A total of two DNA fragments with bp size were detected. Individuals with the TC hetero genotype detected all three DNA fragments and detected DNA bands with sizes 231, 351 and 582 bp (Fig. 1).

As a result of analyzing the frequency and genotype occurrence of the 231th SNP allele in the amplification region of the PON1 gene, which analyzed 147 heads of the Hanwoo progeny black cattle population, the allele frequency was 50.0%. , C allele was about 50.0%, and the frequency of SNP marker genotype was TT type 25.2% (37), TC type 49.7% (73), and CC type 25.2% (37) The genotype was low and the TC genotype was highest.

Example 2. Hanwoo PON1  Gene DNA marker  Genotype and meat quality Flesh  Statistical analysis of association with traits

In order to estimate the effect of the SNP genotype of the Hanwoo PON1 gene detected through the present invention on the carcass quality and carcass quality related carcass quality and breeding value estimates of Hanwoo, it was statistically processed by the PROC GLM method using SASⓐ9.1 Package / PC program. Among the traits of which genotype effects were recognized, significance test was performed by the Duncan's Multiple Range Test (DMRT) method.

As a result, the SNP (SEQ ID No. 231) genotype by T↔C base substitution in the intron 6 region of the Hanwoo PON1 gene was proved to be significantly correlated with the estimated back fat thickness breeding value of Hanwoo (P <0.05). That is, as shown in Table 2, the individuals with the TC genotype showed significantly lower backfat thickness breeding estimates than those with the TT and CC genotypes (P <.05).

DNA marker genotype of Hanwoo PON1 gene and its association with meat mass and meat quality Meat and meat quality SNP genotype P-value
TT TC CC Carcass breeder estimate 3.573 ± 1.465 2.084 ± 1.086 2.537 ± 1.444 0.695 Sirloin cross-section breeding estimate 0.799 ± 0.400 0.323 ± 0.297 0.185 ± 0.395 0.507 Intramuscular fat breeding estimate -0.022 ± 0.014 -0.029 ± 0.011 -0.033 ± 0.014 0.877 Back fat thickness breeding estimate 0.192 ± 0.097 ^a -0.066 ± 0.072 ^b 0.111 ± 0.096 ^a 0.038

In summary, the 231 th T↔C SNP genotype in the amplification region of the Hanwoo PON1 gene of the present invention has a significant association with the backfat thickness, which is a very important item in determining the quality of Korean beef. Proven that this molecular label could be used as a DNA molecule marker for early diagnosis and selection of genetically thin back fat cattle.

In Table 2, ^{a and b} : there is a significant difference between the different codes (P <0.05).
1, M: 100 bp DNA size marker; TT, TC, CC: respective DNA marker genotypes by the PON1 gene SNP of the present invention; 582 bp, 351 bp, 231 bp: Size of DNA fragment detected by RFLP analysis.

Attach an electronic file to a sequence list

Claims (3)

BstE to Hanwoo PON1 (paraoxonase 1) gene amplification products amplified by PCR (Polymerase chain reaction) by primers of SEQ ID NO: 2 and SEQ ID NO: 3 Korean cattle subject to be tested by the 231st T↔C nucleotide substitution of the Hanwoo PON1 gene sequence shown in SEQ ID NO: 1 by PCR-RFLP (Restriction Fragment Length Polymorphism) analysis including the processing of restriction enzyme II . Determination of DNA markers of each star and analysis of each SNP genotype (TT, CT, and CC) to predict and determine the Hanwoo backfat thickness-related molecular markers characterized in predicting genetically thin backfatty cattle. Hanwoo beef trait diagnosis method
The method according to claim 1,
The Hanwoo PON1 gene was PCR by using a forward primer of SEQ ID NO: 2 having a nucleotide sequence structure of GCTTTTGCTCGAAGATGCTAAG in a 5 'to 3' direction and a reverse primer of SEQ ID NO: 3 having a TTGCATAGACGATGTGTGTGGT base sequence in a 5 'to 3' direction. Hanwoo beef trait diagnosis method using molecular markers associated with Hanwoo back fat thickness characterized by amplification
The method according to claim 1,
Of the three DNA marker genotypes (TT, TC, and CC) of the Hanwoo PON1 gene detected by PCR-RFLP analysis, Hanwoo individuals exhibiting the TC genotype were genetically backfat compared to Hanwoo individuals representing the TT and CC genotypes. Method for diagnosing Hanwoo beef trait using molecular markers related to backfat thickness of Hanwoo

Images