KR101280652B1 - Technology of genome selection related to backfat thickness in Korean cattle - Google Patents

Abstract

The present invention relates to a method for diagnosing Hanwoo beef using a DNA marker, which is closely related to the backfat thickness of Korean cattle by using a genome selection technique. The purpose of this study is to provide a molecular diagnostic method that can be used to improve the accuracy of early selection and individual evaluation of excellent Hanwoo cattle by developing molecular markers related to backfat thickness to predict and determine the qualities.
More specifically, the present invention relates to SNP genotypes of individual cattle by PCR-RFLP (Restriction Fragment Length Polymorphism) using a specific SNP present in the exon 7 region of the Hanwoo SPP1 (secreted phosphoprotein 1) gene. The present invention provides a method of diagnosing and identifying DNA markers according to the genotypes of TC and CC genotypes among Korean cattle, which have a genetically thin backfat thickness compared to those with TT genotypes.

Description

Development of genome selection technology related to Korean beef cattle {Technology of genome selection related to backfat thickness in Korean cattle}

The present invention relates to a specific SNP (single base) of SPP1 (secreted phosphoprotein 1) gene that is closely related to Hanwoo's backfat through PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) analysis. By developing molecular markers related to Hanwoo beef masses using polymorphisms, we provide a technology that enables early diagnosis and discrimination of genetically thin backfat thick cattle.

In recent years, development of molecular genetics and genetic analysis techniques have led to the development of molecular marking technology for the diagnosis of genetic traits based on specific DNA sequence variations of candidate genes closely related to specific traits of livestock at the DNA molecule level . Recently, early identification and screening techniques using molecular markers related to the major economic traits of livestock using various DNA analysis techniques such as RAPD (random amplified polymorphic DNA), SSCP (single strand conformation polymorphisms) and microsatellite This technology is used in various industries. In particular, PCR-RFLP (restriction fragment length polymorphism) analysis, which uses restriction enzymes to PCR products of specific genes and shows DNA fragments differently according to differences in the corresponding nucleotide variation sites, is more reproducible and accurate than other analytical methods. It is excellent and is evaluated as a very useful technique for genetic analysis.

In line with the trend of the times, several high-capacity Korean beef early diagnosis technologies using molecular markers related to economic quality of Korean cattle using molecular genetic techniques have been developed and patented / registered with the Korean Intellectual Property Office. As a typical example, my beef with the intramuscular local roads and associated primers him hanwoogeun prefectural grades inspection method (Patent Application No. 10-2000-0065925), the beef economic traits associated with the Micro Satellite DNA and its analysis primer set (Application No .: 10-2004-0091892) and new primer set and Korean beef cattle selection method (Application No .: 10-2003-0093288) The invention technologies are patented.

However, the existing inventions described above, unlike the analysis method of the present invention using a gene that is closely associated with a specific expression, the genetic polymorphism of the individual according to the number of DNA base repeats of about 2-7 bp size Molecular markers using a distinctive microsatellite analysis technique have a disadvantage in that the accuracy of the molecular label is significantly lower than that of the PCR-RFLP analysis method used in the present invention. In contrast, in the present invention, the molecular marker was developed by PCR-RFLP technique using a specific SNP region of the SPP1 candidate gene closely related to the Hanwoo economic trait, thereby providing a gene molecular marker more related to the Hanwoo economic trait. In addition, the RFLP marker has a higher reproducibility than other analytical methods, and thus has an advantage of providing more accurate molecular molecular markers.

In order to protect and develop domestic beef cattle farmers in response to the opening of the US-Korea FTA negotiations, Korea needs a strategy to enhance quality competitiveness by differentiated from imported beef through the high quality of beef cattle, and to improve the economic efficiency of Hanwoo by raising meat. Do. In order to achieve this, it is important to create an optimal breeding environment, but by developing a state-of-the-art breeding and breeding model that diagnoses and selects Korean cattle with excellent genetic qualities early, producing high-quality, economical, high-quality beef cattle that are safe for consumers. Good quality beef cattle will be available at a lower price. Korean livestock grading is based on carcass weight, carcass weight, dressing percentage, backfat thickness, and M. longissimus dorsi area. Meat grades are judged by A, B, C and iso-grade grades. Among these items, the back fat thickness is one of the most significant factors in determining meat grade. The thinner the back fat thickness, the wider the cross-sectional area is expected to increase the amount of meat. Therefore, it is important to diagnose and select excellent individuals with genetically thin back fat thickness early in order to raise the economic efficiency of the cattle. Do.

Conventional quantitative genetic methods for improving breeding of livestock have relied on phenotypic records of livestock. In other words, the candidates were selected for the first time, such as pedigree record and body development, and the next black sheep produced by mating with the birds was reared and slaughtered to record the carcass and meat quality traits, In order to estimate the true breeding price of livestock, the most suitable statistical model formula is devised to select the breed axis. It takes a long time to measure these phenotypic observations, The cost of labor, such as feed costs, facility investment and maintenance costs, labor costs, and excessive labor are required. Due to such a very inefficient method, there is an urgent need for a method for judging Hanwoo beef grading to select and raise early-quality beef cattle more scientifically and quickly.

Therefore, the present invention has been carried out to develop a technique capable of early diagnosis and selection of genetically engineered Hanwoo cattle using the molecular markers associated with Hanwoo beef traits using the latest molecular breeding technology.

Therefore, the present inventors have researched and developed in order to improve the above problems. As a result, the SPP1 gene present in the chromosome 6 of cows was selected as a candidate gene for traits related to Hanwoo beef, and the molecular markers related to fat thickness such as Hanwoo were developed and superior. The method for early diagnosis of Korean cattle was invented. Hanwoo SPP1 (secreted phosphoprotein 1) gene used in the present invention is a gene that affects the expression of phosphorylated protein secreted from secretory cells and is located in the chromosome QTL (quantitative trait locus) region 6 associated with milk trait, beef cattle It has been reported to be closely associated with the biomass, growth traits and marbling of. Therefore, in the present invention, the SPP1 gene was finally selected as a candidate gene related to Hanwoo economic trait, and it was closely related to meat quality through PCR-RFLP analysis using specific SNP of SPP1 gene and statistical analysis of correlation with meat quality and meat-related traits. DNA markers were developed to develop DNA markers that could be used for early diagnosis and selection of Hanwoo cattle with a genetically thin back fat thickness.

More specifically, genomic DNA is isolated from the blood of Hanwoo, amplified by PCR using a primer (primer) containing the exon region 7 of the SPP1 gene, and then Nla to the amplified PCR product. DNA fragments digested with III restriction enzymes were electrophoresed on agarose gel to determine DNA markers for each genotype, and the back fat thickness was analyzed through statistical analysis of the association between carcass quality and meat quality of Hanwoo. By detecting DNA markers associated with, we can provide excellent diagnostic method for Hanwoo cattle with genetically thin back fat thickness.

Using the DNA genotype markers (CC, CT, and TT) resulting from the 92nd C↔T base substitution in the amplification region of the Hanwoo SPP1 gene exon region 7, characterization of carcass mass on the backfat thickness of Hanwoo individuals Based on this, early diagnosis and selection of excellent Hanwoo cattle and industrial utilization of useful genetic resources are possible. In other words, early diagnosis and selection of the individuals holding the CC and CT genotypes of the SPP1 gene maximizes the efficiency and improvement of the Hanwoo Breeding Improvement Project and at the same time improves and preserves Korea's unique Hanwoo genetic resources. Can be obtained.

In addition, the present invention is a state-of-the-art molecular breeding technique using PCR-RFLP analysis method for genomic DNA of Hanwoo, the PCR-RFLP analysis technique used in the present invention can maximize the efficiency and practicality of selection since it is fast, simple and accurate. In addition, there is an advantage that the DNA marker genotype can be more easily, quickly and accurately determined in a large number of samples.

Figure 1 shows the SNP genotype (DNA marker) of each individual due to the 92th C↔T monobasic polymorphism (SNP) in the Hanwoo SPP1 gene amplification region of SEQ ID NO: 1 detected by the PCR-RFLP analysis technique in the present invention Yeongdong pictures
Figure 2 shows the base sequence of each SNP genotype (DNA marker) for the 92th C↔T monobasic polymorphism (SNP) in the Hanwoo SPP1 gene amplification region of SEQ ID NO: 1 detected by the PCR-RFLP analysis technique in the present invention Analytical chromatogram

In order to achieve the above objects, the present invention will be described in more detail with reference to the following non-limiting examples.

Example 1: SPP1  Gene SNP  Genotype detection

1. Disclosure material and DNA separation purification

Hanwoo, used in the present invention, was registered with the National Hospitality Assurance Project and selected 147 headed cattle breeding populations with lineage records and carcass scores through the Subsequent Test. Separation and purification of genomic DNA from each coaxial blood was partially purified by some modification of Miller et al. (1988). After measuring DNA concentration using spectrophotometer, TE buffer (10 mM Tris-HCl, pH 7.4; 1 mM EDTA), stored in -20 ℃ freezer and used as a test material.

2. PCR Amplification and SNP Detection of Hanwoo SPP1 Gene

Primer for amplifying the 353 bp DNA fragment shown in SEQ ID No. 1 including the region of intron 7 in exon 7 of the Hanwoo SPP1 gene is referred to the base sequence information registered in GenBank Accession No. NC_007304. Designed and prepared as shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively, primer base sequences used in the present invention are shown in Table 1.

Primer Sequences for PCR Amplification of Hanwoo SPP1 Gene primer Amplification region Primer base sequence SEQ ID NO: SPP1 Exon 7-Intron 7 Forward F-AGTGAGGAGATGCATGACGC
Reverse R-CATATTGTCTCCCACCCTGCT 2
3

Reaction conditions for PCR amplification of the SPP1 gene were performed using the GeneAmp System 9700 (GenAmp PE Applied Biosystem, USA) under the following conditions. The reaction solution was prepared by adding 50 ng of template DNA, 0.1 μM of each primer, 250 μM of dNTP, 2 μl of 10X PCR buffer and 1 unit of Taq DNA polymerase to a 0.2 ml tube. ≪ / RTI > PCR reaction conditions were pre-heated for 5 minutes at 94 ℃, 30 cycles at 94 ℃, 30 seconds at 55 ℃ and 30 seconds at 72 ℃, and then repeated 30 times and finally heated at 72 ℃ for 5 minutes to amplify DNA. The process was terminated. PCR amplification products were electrophoresed on 2% agarose gel to verify DNA amplification success. As a result of sequencing by direct sequencing technique using PCR amplification products of the Hanwoo SPP1 gene, a total of 353 bp bases were detected as shown in SEQ ID NO. A base polymorphism (SNP) site was detected. That is, the SNP was detected by the C↔T base substitution at the 6,349 th base of the NCBI GenBank registration number NC_007304 (92 th of the SEQ ID NO: 1). For SNP genotyping by individual Hanwoo cattle Nla RFLP analysis was performed using III restriction enzymes.

3. Analysis of SNP Genotype Markers of Hanwoo SPP1 Gene by PCR-RFLP Technique

Nla at the 92th C↔T SNP site in the amplified region of the detected Hanwoo SPP1 gene III restriction enzyme recognition site (5'-CATG ^↓ -3 ') was present and the RFLP technique detected DNA markers corresponding to three SNP genotypes (CC, CT and TT) of the Hanwoo SPP1 gene [Fig. 1 and drawing 2].

Beef RFLP analysis of SPP1 gene unit 2 of Nla the PCR amplification product of 5 ㎕ III restriction enzyme was added and then digested at 37 ° C. for at least 3 hours. DNA fragments obtained by cleaving each PCR amplification product with restriction enzymes were electrophoresed at 2% agarose gel at about 100 volts for about 1 hour using TBE buffer (90 mM Tris-borate, 2 mM EDTA, pH 8.0). After staining with EtBr (ethidium bromide), the DNA fragments were observed to determine the SNP genotype of each assay individual. In other words, two restriction enzyme recognition sites existed in individuals with the CC homo genotype, so that a total of three DNA fragments with sizes of 16, 109 and 288 bp were detected, and three restriction enzyme recognition in individuals with the TT homo genotype. A total of four DNA fragments with 16, 77, 109 and 151 bp size in the presence of the site were detected. Individuals with CT hetero genotype detected all five DNA fragments and detected DNA bands with sizes 16, 77, 109, 151 and 288 bp (Fig. 1). However, a 16 bp DNA fragment with a very small molecular weight was not detected on 2% agarose gel.

As a result of analyzing the frequency and genotype of the 92nd SNP allele in the amplification region of the SPP1 gene, which analyzed 147 heads of Hanwoo progeny black cattle population, the allele frequency was 74.1% for the C allele. , T allele was about 25.9%, C allele frequency was higher than T allele, SNP marker genotype frequency was 55.8% (82 eyes), CT type 36.7% (54 eyes), and The TT genotype was the lowest and the CC genotype was the highest at 7.5% (11 heads).

Example 2. Hanwoo SPP1  Gene DNA marker  Genotype and meat quality Flesh  Statistical analysis of association with traits

In order to estimate the effect of the SNP genotype of the Hanwoo SPP1 gene detected through the present invention on the carcass meat quality and carcass quality related carcass quality and breeding value estimates of the Korean cattle, it was statistically processed by the PROC GLM method using the SASⓐ9.1 Package / PC program. Among the traits of which genotype effects were recognized, significance test was performed by the Duncan's Multiple Range Test (DMRT) method. As a result, genotype of the SNP site (SEQ ID No. 92) by C↔T base substitution in the exon 7 region of the Hanwoo SPP1 gene was proved to be significantly correlated with the back fat thickness of Hanwoo (P <0.05). That is, as shown in Table 2, the individuals with the TT genotype in the backfat thickness were significantly higher than those with the CC and CT genotypes by 0.239 and 0.176, respectively (P <0.05).

DNA marker genotype of Korean cattle SPP1 gene and its association with meat mass and meat quality Meat and meat quality
SNP genotype P-value CC CT TT Birth weight / kg 534.263 ± 6.295 544.825 ± 8.053 571.657 ± 17.855 0.128 Conductor weight / kg 305.389 ± 4.034 310.579 ± 5.161 329.487 ± 11.442 0.143 Conductor Rate /% 57.103 ± 0.200 56.961 ± 0.256 57.631 ± 0.568 0.558 Back fat thickness / cm 0.605 ± 0.029 ^b 0.668 ± 0.037 ^b 0.844 ± 0.083 ^a 0.024 Longest root cross section / cm 74.418 ± 0.948 74.625 ± 1.213 77.767 ± 2.689 0.514 Local muscle degree / 1-7 2.013 ± 0.159 1.933 ± 0.204 2.071 ± 0.453 0.932

In summary, the 92nd C↔T SNP genotype in the amplification region of the Hanwoo SPP1 gene of the present invention has a significant association with the backfat thickness, which is a very important item in determining the quality of Korean beef. Proven that this marker could be used as a DNA marker for early diagnosis and selection of genetically thin back cattle.

In Table 2, ^{a and b} : there is a significant difference between the different codes (P <0.05).
1, M: 100 bp DNA size marker; CC, CT, TT: respective DNA marker genotypes by SPP1 gene SNP of the present invention; 288bp, 151bp, 109bp, 77bp: size of DNA fragment detected by RFLP analysis
In Figure 2, CC, CT, TT: respective DNA marker genotypes for sequencing chromatogram by SPP1 gene SNP of the present invention.

Attach an electronic file to a sequence list

Claims (3)

Nla to a Hanwoo SPP1 (secreted phosphoprotein 1) gene amplified product amplified by PCR (Polymerase chain reaction) by primers of SEQ ID NO: 2 and SEQ ID NO: 3 Restriction Fragment Length Polymorphism (PCR-RFLP) analysis including the process of III restriction enzyme analysis Determination of DNA markers of each star, and analysis of each SNP genotype (CC, CT and TT) to predict and determine the genetically related Hanwoo back fat thickness, characterized in that predicted and determined Hanwoo cattle thin genetically thin back fat thickness Hanwoo beef trait diagnosis method
The method according to claim 1,
Hanwoo SPP1 gene was PCR by using a forward primer of SEQ ID NO: 2 having a nucleotide sequence structure of AGTGAGGAGAGACATCATGACGC in 5 'to 3' direction and a reverse primer of SEQ ID NO: 3 having a nucleotide sequence structure of CATATTGTCTCCCACCCTGCT in 5 'to 3' direction. Hanwoo beef trait diagnostic method using molecular labeling associated with Hanwoo back fat thickness, characterized in that the amplification The method according to claim 1,
Among the three DNA marker genotypes (CC, CT, and TT) of the Hanwoo SPP1 gene detected by PCR-RFLP analysis, Hanwoo individuals that show CC and CT genotypes are genetically backfat compared to Hanwoo individuals that show TT genotype. Method for diagnosing Hanwoo beef traits using molecular labeling associated with backfat thickness of Hanwoo

Images