KR102194877B1 - Method for predicting economic traits in in Hanwoo with GALM gene - Google Patents

Abstract

The present invention relates to a method for predicting economic traits of Korean cattle using a GALM (Galactose mutarotase) gene, and more specifically, to detect whether or not the 33rd to 46th nucleotide sequences of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 are missing. It relates to a primer set for predicting economical trait of Korean cattle, a composition for predicting economical trait of Korean cattle comprising the primer set, and a kit for predicting economical trait of Korean cattle comprising the primer set. By using the primer set of the present invention, the economic traits of Korean cattle can be predicted in an effective and practical way, and specifically, the backfat thickness, marbling scores (MARB) and meat quality grade index (MQGI) of Korean cattle Can be predicted. In the present invention, it is possible to predict more quickly than conventional techniques based on phenotypic measurements, and based on this, it is possible to select breeders that produce high-quality Korean beef meat.

Description

{Method for predicting economic traits in in Hanwoo with GALM gene}

The present invention relates to a method for predicting economic traits of Korean cattle using a GALM (Galactose mutarotase) gene, and more specifically, to detect whether or not the 33rd to 46th nucleotide sequences of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 are missing. It relates to a primer set for predicting economical trait of Korean cattle, a composition for predicting economical trait of Korean cattle comprising the primer set, and a kit for predicting economical trait of Korean cattle comprising the primer set.

Conventional traditional Korean cattle marbling and meat quality measurement techniques rely on phenotypic measurements, and through this, the growth and carcass traits of the selected candidate breeders are tested to select candidate breeders again. However, measuring the meat quality of Korean cattle through this method takes a lot of time, and the accuracy of the evaluation is low because it is based on the breeding price of the parents.

In addition, since many candidate breeders are reared through two generations, labor costs, raising expenses, facility management expenses, etc. are expended, which can put an economic burden on the breeders.

In order to solve such a problem, studies on genetic markers that can estimate the genetic ability of meat have been actively conducted in recent years. For example, various DNA analysis methods such as RAPD (Random Amplified Polymorphic DNA), SSCP (Single Strand Conformational Polymorphism), AFLP (Amplified Fragment Length Polymorphism) and RFLP (Restriction Fragment Length Polymorphism) are used to Markers related to economic traits were selected. Among them, the most widely used marker is a single nucleotide polymorphism (SNP) marker. If SNP affects the phenotype and the major economic traits of livestock are changed, it can be used as a marker to predict the economic traits of livestock.

Recent studies on the association between phenotype and genotype in livestock animals have investigated genetic variations related to qualitative characteristics such as changes in color of the skin, as well as quantitative economic characteristics such as body weight and backfat thickness of animals. Genetic markers were identified using quantitative trait locus (QTL) analysis of genomic DNA and candidate genetic approaches.

Galactose mutarotase (GALM) is a biochemical enzyme that converts β-D-galactose into α-D-galactose. α-D-galactose is used for energy metabolism and biosynthesis of glycoproteins and glycolipids. The biological function of GALM was studied with retinoic acid (RA).

Retinoic acid plays an important role in adipocyte differentiation. Particularly in cattle, retinoic acid induces the differentiation of adipocytes in muscle through regulation of gene expression. The retinoic acid supplement rapidly induces the expression of GALM and plays an important role in adipocyte differentiation through GALM gene activity.

In a recent study, the genetic effects of Korean cattle on MSTN and ADDI polymorphisms were described, but the relationship between the genetic background and economic characteristics of Korean cattle was not clear. This study investigated the genetic polymorphism of the GALM gene and investigated the relationship between the genotype and conductor characteristics of this polynucleotide in the Korean cattle population.

An object of the present invention is to provide a primer set for predicting economic traits of Korean cattle capable of detecting the deletion of nucleotide sequences 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1.

Another object of the present invention is to provide a composition for predicting economic trait of Korean cattle comprising the primer set.

Another object of the present invention is to provide a kit for predicting economic trait of Korean cattle comprising the primer set.

Another object of the present invention is a polynucleotide consisting of 5 to 1000 consecutive bases comprising a mutation in the nucleotide sequence in which the 33rd to 36th base is AGGT or ACTC in the GALM-derived polynucleotide represented by SEQ ID NO: 1, or It is to provide a biomarker for predicting economic traits of Korean cattle, including its complementary polynucleotide.

Another object of the present invention is to determine that the economic characteristics of Korean cattle are superior to those in which the deletion of the 33rd to 46th bases of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 has occurred. It is to provide a method for predicting traits.

The present invention was devised to solve the above problems,

The present invention provides a primer set for predicting economic traits of Korean cattle capable of detecting the deletion of the 33rd to 46th nucleotide sequences of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1.

According to a preferred embodiment of the present invention, the primer set may consist of the nucleotide sequences of SEQ ID NOs: 2 and 3.

According to another preferred embodiment of the present invention, the economic trait of Korean cattle is from the group consisting of back fat thickness, marbling scores (MARB) and meat quality grade index (MQGI) of Korean cattle. It may be one or more selected characteristics.

According to another preferred embodiment of the present invention, the Korean beef may be Jeju Island Korean beef.

In addition, the present invention predicts economic traits of Korean cattle including a primer set for predicting economic traits of Korean cattle capable of detecting the deletion of nucleotide sequences 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 It provides a composition for use.

In addition, the present invention predicts economic traits of Korean cattle including a primer set for predicting economic traits of Korean cattle capable of detecting the deletion of nucleotide sequences 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 Kits are provided.

In addition, the present invention includes a variation of the nucleotide sequence in which the 33rd to 36th base is AGGT or ACTC in the GALM-derived polynucleotide represented by SEQ ID NO: 1, and a polynucleotide consisting of 5 to 1000 consecutive bases, or a complement thereof It provides a biomarker for predicting economical traits of Korean cattle, including a typical polynucleotide.

According to a preferred embodiment of the present invention, the biomarker is a primer set for predicting economic traits of Korean cattle that can detect whether the 33rd to 46th nucleotide sequences of the GALM gene-derived polynucleotide represented by SEQ ID NO: 1 are deleted. Can be amplified.

According to a preferred embodiment of the present invention, the economic trait of Korean cattle may be one or more characteristics selected from the group consisting of backfat thickness, marbling grade, and meat quality index of Korean cattle.

According to another preferred embodiment of the present invention, the Korean beef may be Jeju Island Korean beef.

In addition, the present invention comprises the steps of (a) extracting the genomic DNA of Korean cattle, (b) using the genomic DNA extracted from the step (a) as a template, a polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 or a complementary polynucleotide thereof. It provides a method for predicting economic traits of Korean cattle comprising the step of amplifying the polymorphic site of and (c) determining the base sequence of the amplified polymorphic site.

According to a preferred embodiment of the present invention, in the step (c), when the deletion of bases 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 occurs, the economic characteristics of Korean cattle are superior to that of otherwise. It may be to judge that it is.

According to another preferred embodiment of the present invention, the allele in which the deletion of bases 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 in step (c) is S, and the polynucleotide When the alleles in which the 33rd to 46th bases are not deleted are denoted by L, it can be determined that the S/S type has superior economic traits of Korean cattle compared to the L/L or L/S type.

According to another preferred embodiment of the present invention, the economical trait of Korean cattle may be one or more characteristics selected from the group consisting of backfat thickness, marbling grade, and meat quality index of Korean cattle.

According to another preferred embodiment of the present invention, the Korean beef may be Jeju Island Korean beef.

By using the primer set of the present invention, the economic traits of Korean cattle can be predicted in an effective and practical way, and specifically, the backfat thickness, marbling scores (MARB) and meat quality grade index (MQGI) of Korean cattle Can be predicted.

In the present invention, it is possible to predict more quickly than conventional techniques based on phenotypic measurements, and based on this, it is possible to select breeders that produce high-quality Korean beef meat.

1 is a PCR experiment result showing the difference according to the insertion or deletion of a 14 bp fragment in the Hanwoo GALM gene.
2 is a result of comparing the nucleotide sequences between the alleles of L and S of the GALM gene.

Hereinafter, the present invention will be described in more detail.

The present invention provides a primer set for predicting economic traits of Korean cattle capable of detecting the deletion of the 33rd to 46th nucleotide sequences of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1.

In the present invention, the GALM gene-derived polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is a polymorphic sequence including a polymorphic site of a gene involved in the backfat thickness, marbling grade or meat quality of Korean cattle, and the polymorphic sequence is It means a sequence including a polymorphic site in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

The term "polymorphism" of the present invention refers to a case in which two or more alleles exist in one locus. Among polymorphic sites, only a single base is different. It is called single nucleotide polymorphism (SNP). Polymorphic markers may have two or more alleles exhibiting an incidence of at least 1%, specifically at least 5% or 10% in the selected population.

The term "allele" of the present invention refers to several types of one gene present at the same locus of a homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNP has two types of alleles. In the present invention, the GALM gene, which is the object of determining the economic trait of Korean cattle, is'deletion of nucleotide sequences 1265 to 1278 of the GALM gene sequence and nucleotides 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1. Appears as L'or'S'. Specifically, in the case of a sequence into which the 14 bp nucleotide sequence represented by SEQ ID NO: 4 is inserted, it is represented by'L', when the nucleotide sequence represented by SEQ ID NO: 4 is deleted, it is represented by'S', and a combination of allele pairs It can be expressed as L/L, L/S or S/S according to.

In the present invention, the term "primer set" refers to a short nucleic acid sequence that can form a base pair with a complementary template and serves as a starting point for copying a template strand. The primer set is capable of initiating DNA synthesis in the presence of a reagent for polymerization (DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature. The PCR conditions, the length of the sense and antisense primers can be modified based on those known in the art. The primer sequence need not be completely complementary to the polynucleotide containing the polymorphic marker or a polynucleotide complementary thereto, and can be used as long as it is sufficiently complementary to hybridize. In addition, the primers can be modified, for example methylation, capation, substitution of nucleotides or modifications between nucleotides, such as uncharged linkers (e.g. methyl phosphonate, phosphotriester, phosphoroamidate, Carbamates, etc.) or charged linkers (e.g. phosphorothioate, phosphorodithioate, etc.).

The primer set provided by the present invention includes the 1265 to 1278 nucleotide sequences of the GALM gene sequence, the 33 to 46 nucleotide sequences of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1, or a gene whose homology to the sequence region is recognized. It is a forward and reverse primer designed to be amplified. In a specific implementation of the present invention, a primer set having oligonucleotides of SEQ ID NOs: 2 and 3 was used.

The present invention provides a composition or kit for predicting economic traits of Korean cattle comprising the primer set.

The composition or kit of the present invention comprises DNA polymerase, reaction buffer (various pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water ( DEPC-water), sterilized water, and the like.

In addition, the kit of the present invention may additionally include constituents necessary for performing electrophoresis to determine whether a PCR product is amplified or not, and may be applied as a DNA chip or a microarray.

It is possible to detect whether the nucleotide sequence 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 is deleted.

According to Table 1 below, the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 was amplified through PCR.

The polynucleotide represented by SEQ ID NO: 2 or 3 is a set of primers used in PCR experiments to amplify the GALM gene.

The polynucleotide represented by SEQ ID NO: 4 is a 14 bp fragment in which 3'of the GALM gene is inserted or deleted, and economic traits of Korean cattle can be predicted.

Polynucleotide sequence of SEQ ID NO: 1 to 4 GALM gene fragment SEQ ID NO: 1 TGATTTCCTTCCCAAAGACTGGCTCCAGGCCAGGTCTAATGACCAGCTCTCCTCTCTGTGAAGTGAAGGGGACTCAACCACCAATGTCACCCATCATCTCAGCCTTGATCCTAGCCCAGAAGTGGCACCTGGGCTCCATGTGTTGGCTCCATCTGTCCATTCTGCCCCTTTC bGALM Forward primer SEQ ID NO: 2 GATTTCCTTCCCAAAGACTGGCT bGALM Riverse primer SEQ ID NO: 3 AGAAAGGGGCAGAATGGACAGAT GALM gene insertion/deletion fragment SEQ ID NO: 4 GGTCTAATGACCAG

<Experiment preparation>

1. DNA extraction

From July 2013 to June 2015, 857 Korean steer meat samples were collected at the Jeju Livestock Cooperative Slaughterhouse in Jeju Island. Genomic DNA (gDNA) was isolated from blood and muscle samples using the DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany), and used as a template for polymerase chain reaction (PCR).

2. PCR and genotyping

The genotype of GALM was performed by PCR analysis. A primer was prepared to amplify a 158 or 172 bp fragment of the Hanwoo GALM gene. The fragment of 158 or 172 bp is by insertion or deletion of 14 bp (SEQ ID NO: 4) in the 3'region (UTR).

The fragment was found in the Korean cattle expressed sequence tag (EST) data (dataset) through a preliminary study comparing the cDNA sequence and the genomic DNA sequence. The cDNA sequence (accession no. NM_001034795) was obtained from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) database, and the genomic DNA sequence (BTA 11: 21,040,425-21,095,033) was Obtained from the Ensembl (http://asia.ensembl.org) database.

Primers for the GALM gene including the SNP were designed. The forward primer is bGALM_F (SEQ ID NO: 2, 5'-GAT TTC CTT CCC AAA GAC TGG CT-3') and the reverse primer is bGALM R (SEQ ID NO: 3, 5'-AGA AAG GGG CAG AAT GGA CAG AT-3') to be.

PCR was performed using 20 µl of a reaction mixture containing 50 ng of DNA, 0.5 nmole of the primer and 2 units of Taq DNA polymerase (GenetBio, Daejeon, Korea). PCR was performed by initial heating at 95°C for 3 minutes, followed by heating at 94°C for 30 seconds for denaturation, 60°C for 30 seconds for annealing, and 72°C for 30 seconds for polymerization. As a cycle, a total of 35 cycles were performed. Finally heated at 72° for 5 minutes. The PCR product was isolated, genotyped on a 2.5% agarose gel, and visualized by UV irradiation.

Two alleles L and S were determined by comparing the PCR products of 172 bp (allele L) and 158 bp (allele S). PCR products of each genotype (L/L, L/S, and S/S) were confirmed for insertion or deletion of polynucleotide 14 bp (SEQ ID NO: 4) through DNA sequencing.

The insertion or deletion polymorphism allele frequency of GALM 14 bp was calculated using the CERVUS3.0.3 program (Kalinowski et al., 2007). The X ² value was calculated using Yates' correction, and Hardy-Weinberg equilibrium was examined using Bonferroni correction.

3. Data Analysis

Carcass characteristics include body fat weight (CW), back fat thickness (BF), eye muscle area (EMA), marbling score (MARB), meat quality index (MGQI), meat color index (MC), and fat color index (FC). have. Carcass data was collected within 24 hours post-mortem. The meat quality grade index (MGQI) is a value obtained by converting the meat quality grade as follows for statistical analysis.

MQGI 1 is an MQG level 1++ and has a marbling score of 8 and 9, making it the highest level of marbling. MQGI 2 is MQG level 1+ and has a marbling score of 6 and 7, and MQGI 3 has an MQG level of 1 and a marbling score of 4 and 5. MQGI 4 is an MQG level 2 and has a marbling score of 2 and 3. MQGI 5 is an MQG level 3 and has a marbling score of 1, which is a lower grade.

Traits and genotypes were statistically analyzed using the least squares method for the scattered data, and the General Linear Model procedure (PROC GLM) of SAS version 8.01 program package/PC (SAS, 1999) was used. The following model for the GALM polymorphic effect was used in the analysis.

Y _ij = μ + SNP _i + ε _ij

Y _ij is the characteristic observed in the ith bull, μ indicates the population, SNP indicates the GALM genotype (L/L, L/S and S/S) of the ith bull, and ε _ij is an arbitrary error. . Means were differentiated using PROC GLM's Duncan multiple range test. Statistical significance is within P <0.05.

Example 1. Genetic polymorphism of GALM gene of Korean cattle population

Three genotypes (L/L, L/S and S/S), the 3'UTR genetic polymorphism of the GALM gene, were found in the Korean cattle population in Jeju Island (see FIG. 1). The GALM genotype frequency in the Korean cattle population represents the allele distribution (see Table 2). According to Table 2 below, Korean cattle have a higher expression frequency of the S allele (0.768) than the L allele (0.232).

Through multiple alignment of the DNA sequence analysis results, 14 bp fragments (SEQ ID NOs: 4 and 5 ``are at bases 1265 to 1278 of the GALM gene or bases 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 It can be seen that it is inserted or deleted (see Fig. 2).

Genotype Frequency and Genetic Diversity Parameters of Hanwoo's GALM Gene Breed Genotype Number of animals Allele X ²
(HWE) Diversity
parameter Korean beef L/L L/S S/S 857 L S N.D. Ho He PIC 0.163 0.142 0.706 0.232 0.768 0.141 0.356 0.293

(HWE means Hardy-Weinberg equilibrium, ND (not determined) means that the result has not been derived. Ho is the observed heterozygosity, and He is the expected heterozygosity. , PIC means polymorphic information content.)

Example 2. Association between GALM genotype and carcass trait

As a result of testing the association between the GALM genotype and carcass trait, the S/S genotype had significantly lower backfat thickness (BF) compared to the L/L and L/S genotypes, and the marbling score (MARB) and meat quality index (MGQI). It was higher (p <0.05, see Table 3). No significant association was found in body fat weight (CW), eye muscle area (EMA), meat color index (MC) or fat color index (FC) (p> 0.05).

Specifically, GALM S/S genotype animals have a backfat thickness (BF) of 12.55 ±3.919 mm, which is about 1.00 mm thinner than L/L genotype animals (13.49 ±4.938 mm) and L/S genotype animals (13.89 ±5.258 mm). Had. This means that insertion or deletion of a 14 bp fragment in the 3'UTR of the GALM gene affects fat accumulation in subcutaneous adipose tissue.

On the other hand, the S/S genotype animal's marbling score (MARB) level (5.83±2.066) was higher than that of the L/L genotype animal (5.39±2.066) and the L/S genotype animal (5.31±2.109). This indicates that the genotype of the GALM gene accumulates fat in the internal muscles of the dorsal longest muscle (longissimus dorsi).

The meat quality grade index (MGQI), a meat quality-related trait, also showed a significant difference in the GALM genotype (p <0.05). The level of MQGI in GALM S/S genotype steers (3.66±1.1013) was higher than that of L/L genotype steers (3.46±1.049) and L/S genotype steers (3.43±1.052).

(a,b,c statistical significance is recognized, P <0.05)

The detailed description above is illustrative of the present invention. In addition, the above description shows and describes preferred embodiments of the present invention, and the present invention can be used in various other combinations, modifications and environments. That is, changes or modifications may be made within the scope of the concept of the invention disclosed in the present specification, the scope equivalent to the disclosed contents, and/or the skill or knowledge of the art. The above-described embodiment describes the best state for implementing the technical idea of the present invention, and various changes required in the specific application fields and uses of the present invention are possible. Therefore, the detailed description of the invention is not intended to limit the invention to the disclosed embodiment. In addition, the appended claims should be construed as including other embodiments.

<110> THE FOUNDATION OF AG. TECH. COMMERCIALIZATION AND TRANSFER <120> Method for predicting economic traits in Hanwoo with GALM gene <130> 1062421 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 172 <212> DNA <213> Artificial Sequence <220> <223> GALM gene fragment <400> 1 tgatttcctt cccaaagact ggctccaggc caggtctaat gaccagctct cctctctgtg 60 aagtgaaggg gactcaacca ccaatgtcac ccatcatctc agccttgatc ctagcccaga 120 agtggcacct gggctccatg tgttggctcc atctgtccat tctgcccctt tc 172 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> bGALM Forward primer <400> 2 gatttccttc ccaaagactg gct 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> bGALM Riverse primer <400> 3 agaaaggggc agaatggaca gat 23 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> GALM gene insertion / deletion fragment <400> 4 ggtctaatga ccag 14

Claims (19)

delete delete delete delete delete delete delete delete delete delete (a) extracting genomic DNA of Korean cattle;
(b) Using the genomic DNA extracted from step (a) as a template, a primer set capable of detecting the deletion of nucleotide sequences 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 was prepared. Amplifying the polymorphic site of the polynucleotide or its complementary polynucleotide by using; And
(c) When the allele in which base 33 to 46 of the amplified polynucleotide has been deleted is represented by S, and the allele in which base 33 to 46 of the polynucleotide is not deleted is represented by L, S/ Hanwoo economic trait prediction method comprising the step of determining that the S-type has superior backfat thickness, marbling grade, and meat quality index compared to L/L-type or L/S-type.
delete delete delete The method of claim 11,
The method for predicting economic traits of Korean beef, characterized in that the Korean beef is Jeju Island Korean beef.
delete The method of claim 11,
The primer set economical trait prediction method of Korean cattle, characterized in that consisting of the base sequence of SEQ ID NO: 2 and 3.
The method of claim 11,
Step (b) Characterized in that amplification using a composition for predicting economic traits of Korean cattle comprising a primer set capable of detecting the deletion of the 33rd to 46th nucleotide sequence of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 Hanwoo economic trait prediction method.
The method of claim 11,
Step (b) Characterized in that it is amplified using a kit for predicting economic traits of Korean cattle comprising a primer set capable of detecting the deletion of nucleotide sequences 33 to 46 of the polynucleotide derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1. Hanwoo economic trait prediction method.

Images