KR20200073053A - Method for predicting economic traits in in Hanwoo with GALM gene - Google Patents

Abstract

The present invention relates to a method for predicting economic traits in Hanwoo (Korean native cattle) using a galactose mutarotase (GALM) gene and, more particularly, to a primer set for predicting economic traits in Hanwoo capable of detecting a deletion of 33^th to 46^th base sequences of polynucleotide derived from the GALM gene represented by SEQ ID NO: 1, a composition for predicting economic traits in Hanwoo including the primer set, and a kit for predicting economic traits in Hanwoo including the primer set. By using the primer set of the present invention, it is possible to predict the economic traits of Hanwoo in an effective and practical way, and specifically to predict a thickness of the backfat, marbling scores (MARB) and meat quality grade index (MQGI) of Hanwoo. The present invention may be used to carry out faster prediction than conventional techniques based on phenotypic measurements, so that breeders capable of producing high-quality Hanwoo meat may be selected.

Description

Method for predicting economic traits in in Hanwoo with GALM gene}

The present invention relates to a method for predicting economic traits of Korean beef using GALM (Galactose mutarotase) gene, and more specifically, to detect whether the nucleotide sequence 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 is defective. The present invention relates to a primer set for predicting economic traits of Hanwoo, a composition for predicting economic traits of Hanwoo comprising the primer set, and a kit for predicting economic traits of Hanwoo comprising the primer set.

Conventional traditional Korean cattle marbling and meat quality measurement techniques rely on phenotypic measurements, through which the growth and carcass traits of selected candidate seedlings are assayed to select candidate seedlings again. However, it is time consuming to measure the meat quality of Korean beef and the accuracy of the evaluation is low because it is based on the breeding price of the parents.

In addition, since many candidate breeding cattle are bred through two generations, labor costs, rearing expenses, and facility management expenses can be spent, which can put an economic burden on the breeder.

In order to solve this problem, recently, research on genetic markers capable of estimating the genetic ability of meat has been actively conducted. For example, the main livestock animals using various DNA analysis methods such as Random Amplified Polymorphic DNA (RAPD) using PCR technology, Single Strand Conformational Polymorphism (SSCP), Amplified Fragment Length Polymorphism (AFLP), and Restriction Fragment Length Polymorphism (RFLP) Markers related to economic traits were selected. The most widely used marker is a single nucleotide polymorphism (SNP) marker. If SNP affects the phenotype and the main economic trait of livestock changes, it can be used as a marker to predict the economic trait of livestock.

A recent linkage study between phenotypes and genotypes for livestock animals looked at genetic variations associated with qualitative characteristics such as color changes in the skin as well as quantitative economic characteristics such as animal weight and backfat thickness. Gene markers were identified using quantitative translocation (QTL) analysis of genomic DNA and candidate gene approaches.

Galactose mutarotase (GALM) is a biochemical enzyme that converts β-D-galactose to α-D-galactose. α-D-galactose is used for energy metabolism, biosynthesis of sugar proteins and glycolipids. The biological function of GALM has been studied with retinoic acid (RA).

Retinoic acid plays an important role in adipocyte differentiation. In particular, retinoic acid in cattle induces the differentiation of adipocytes in muscle through regulation of gene expression. Retinoic acid supplementation rapidly induces the expression of GALM and plays an important role in adipocyte differentiation through GALM gene activity.

Recent studies have demonstrated the genetic effects of Korean cattle on MSTN and ADDI polymorphisms, but the link between the genetic background and economic characteristics of Korean cattle has not been clarified. This study investigated the genetic polymorphism of the GALM gene and the relationship between the genotype and conductor properties of this polynucleotide in the Hanwoo population.

An object of the present invention is to provide a primer set for predicting economic feasibility of Korean cattle that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are deficient in the nucleotide sequences 33 to 46.

Another object of the present invention is to provide a composition for predicting economic traits of Hanwoo comprising the primer set.

Another object of the present invention is to provide a kit for predicting economic traits of Hanwoo comprising the primer set.

Another object of the present invention comprises a polynucleotide consisting of 5 to 1000 consecutive bases, including a variation of the base sequence in which the 33rd to 36th base is AGGT or ACTC in the polynucleotide derived from GALM represented by SEQ ID NO: 1, or It is to provide a biomarker for predicting Hanwoo economic traits, including its complementary polynucleotide.

Another object of the present invention includes the step of determining that the economic trait of Korean beef is superior to the case where deletion of the 33 to 46th base of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 does not occur. It is intended to provide a method for predicting traits.

The present invention was made to solve the above problems,

The present invention provides a primer set for predicting economic traits in Korean cattle that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are deficient in the nucleotide sequences 33 to 46.

According to one preferred embodiment of the present invention, the primer set may consist of the nucleotide sequences of SEQ ID NOs: 2 and 3.

According to another preferred embodiment of the present invention, the economic characteristics of Korean beef are from the group consisting of back fat thickness, marbling scores (MARB) and meat quality grade index (MQGI) of Korean beef. It may be one or more properties selected.

According to another preferred embodiment of the present invention, the Hanwoo may be Jeju-do Hanwoo.

In addition, the present invention provides a method for predicting economic traits in Hanwoo, including a primer set for predicting economic traits in Hanwoo that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are missing. It provides a composition for.

In addition, the present invention provides a method for predicting economic traits in Hanwoo, including a primer set for predicting economic traits in Hanwoo that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are missing. Kit.

In addition, the present invention comprises a polynucleotide consisting of 5 to 1000 consecutive bases, comprising a variation of the base sequence in which the 33rd to 36th bases are AGGT or ACTC in the polynucleotide derived from GALM represented by SEQ ID NO: 1, or complements thereof It provides a biomarker for predicting the economic characteristics of Hanwoo, comprising a polynucleotide.

According to a preferred embodiment of the present invention, the biomarker is a primer set for predicting economic traits in Korean cattle that can detect whether the polynucleotides 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 are defective. Can be amplified.

According to a preferred embodiment of the present invention, the economic characteristics of Korean beef may be one or more characteristics selected from the group consisting of Korean beef's back fat thickness, marbling grade, and meat grade index.

According to another preferred embodiment of the present invention, the Hanwoo may be Hanwoo, Jeju Island.

In addition, the present invention (a) a step of extracting genomic DNA of Korean beef, (b) a genomic DNA extracted from step (a) as a template, a polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 or a complementary polynucleotide thereof It provides a method for predicting economic traits of Hanwoo comprising amplifying a polymorphic site of and (c) determining a base sequence of the amplified polymorphic site.

According to a preferred embodiment of the present invention, the step (c) is better than the case where the deletion of the polynucleotides 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 does not occur, compared to the case where it is not. It may be judged as.

According to another preferred embodiment of the present invention, in the step (c), the allele in which the deletion of the polynucleotides 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 occurs in S, S of the polynucleotide When alleles in which the 33rd to 46th bases are not deleted are marked with L, it can be determined that the S/S type has superior economic characteristics of Korean cattle compared to the L/L type or L/S type.

According to another preferred embodiment of the present invention, the Hanwoo economic trait may be one or more characteristics selected from the group consisting of the Korean native cattle thickness, marbling grade and meat grade index.

According to another preferred embodiment of the present invention, the Hanwoo may be Jeju-do Hanwoo.

Using the primer set of the present invention, the economic trait of Korean beef can be predicted by an effective and practical method, specifically, the thickness of the back fat of Korean beef, marbling scores (MARB) and meat quality grade index (MQGI) Can predict.

The present invention can be predicted more quickly than the existing technique based on phenotypic measurements, and based on this, it is possible to select the cattle that produce high-quality Korean beef meat.

1 is a PCR experiment showing the difference according to the insertion or deletion of the 14 bp fragment in the Korean beef GALM gene.
2 is a result of comparing the nucleotide sequence between the alleles of L and S of the GALM gene.

Hereinafter, the present invention will be described in more detail.

The present invention provides a primer set for predicting economic traits in Korean cattle that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are deficient in the nucleotide sequences 33 to 46.

In the present invention, the polynucleotide derived from the GALM gene consisting of the nucleotide sequence of SEQ ID NO: 1 is a polymorphic sequence comprising a polymorphic region of a gene involved in the thickness of the back fat, marbling grade, or meat grade of Korean beef. It means a sequence comprising a polymorphic site in a polynucleotide sequence. The polynucleotide sequence may be DNA or RNA.

The term "polymorphism" of the present invention means a case where two or more alleles are present in one locus, and only one base is different among polymorphic sites. This is called single nucleotide polymorphism (SNP). Polymorphic markers can have two or more alleles that exhibit a frequency of occurrence of 1% or more, specifically 5% or 10% or more, in a selected population.

The term "allele" of the present invention refers to several types of a single gene located at the same locus of the homologous chromosome. Alleles are also used to indicate polymorphism, for example, SNPs have two types of alleles. In the present invention, the GALM gene to be subjected to economic traits of Korean cattle is determined by deletion of the 1265-1278th nucleotide sequence of the GALM gene sequence and the 33-46th nucleotide sequence of the polynucleotide derived from the GALM gene represented by SEQ ID NO:1. L'or'S'. Specifically, when the 14 bp base sequence represented by SEQ ID NO: 4 is an inserted sequence, it is represented by'L', and when the base sequence represented by SEQ ID NO: 4 is deleted, represented by'S', a combination of allelic pairs It can be represented by L/L, L/S or S/S depending on the type.

In the present invention, the term "primer set" refers to a short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying. The primer set can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures and four different nucleoside triphosphates. PCR conditions, sense and antisense primer lengths can be modified based on those known in the art. The primer sequence need not be completely complementary to the polynucleotide containing the polymorphic marker or a complementary polynucleotide thereof, and can be used if it is sufficiently complementary to hybridize. In addition, primers can be modified, e.g. methylation, capping, substitution of nucleotides or modification between nucleotides, e.g. uncharged linkages (e.g. methyl phosphonate, phosphotriester, phosphoroamidate, Carbamate, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.).

The primer set provided in the present invention is a 1265 to 1278 nucleotide sequence of the GALM gene sequence, a 33 to 46 nucleotide sequence of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1, or a gene whose homology with the sequence region is recognized. It is a forward and reverse primer designed to amplify. In a specific embodiment of the present invention, a primer set having oligonucleotides of SEQ ID NOs: 2 and 3 was used.

The present invention provides a composition or kit for economical prediction of Hanwoo comprising the primer set.

Compositions or kits of the present invention include DNA polymerase, reaction buffer (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water ( DEPC-water), sterilized water, and the like.

In addition, the kit of the present invention may further include components necessary for performing electrophoresis capable of confirming whether or not the PCR product is amplified, and may be applied to a DNA chip, a microarray, or the like.

It is possible to detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by SEQ ID NO: 1 are defective in the 33 to 46 nucleotide sequence.

According to Table 1, a polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 was amplified through PCR.

The polynucleotide represented by SEQ ID NO: 2 or 3 is a primer set used in PCR experiments to amplify the GALM gene.

The polynucleotide represented by SEQ ID NO: 4 is a 14 bp fragment in which insertion or deletion occurs in 3′ of the GALM gene, which can predict the economic trait of Korean cattle.

Polynucleotide sequence of SEQ ID NO: 1-4 GALM gene fragment SEQ ID NO: 1 TGATTTCCTTCCCAAAGACTGGCTCCAGGCCAGGTCTAATGACCAGCTCTCCTCTCTGTGAAGTGAAGGGGACTCAACCACCAATGTCACCCATCATCTCAGCCTTGATCCTAGCCCAGAAGTGGCACCTGGGCTCCATGTGTTGGCTCCATCTGTCCATTCTGCCCCTTTC bGALM Forward primer SEQ ID NO: 2 GATTTCCTTCCCAAAGACTGGCT bGALM Riverse primer SEQ ID NO: 3 AGAAAGGGGCAGAATGGACAGAT GALM gene insertion/deletion fragment SEQ ID NO: 4 GGTCTAATGACCAG

<Preparation for experiment>

1. DNA extraction

From July 2013 to June 2015, 857 meat samples of Korean cattle steer were collected at the Jeju Livestock Cooperative Slaughterhouse in Jeju Island. Genomic DNA (gDNA) was isolated from blood and muscle samples using DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany) and used as a template for polymerase chain reaction (PCR).

2. PCR and genotyping

The genotype of GALM was performed by PCR analysis. Primers were prepared to amplify 158 or 172 bp fragments of Korean beef GALM gene. The fragment of 158 or 172 bp is obtained by insertion or deletion of 14 bp (SEQ ID NO: 4) into 3'region (UTR).

The fragment was found in a Korean native cattle expression gene fragment (EST) dataset through a preliminary study comparing cDNA sequence and genomic DNA sequence. The cDNA sequence (accession no.NM_001034795) was obtained from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) database, and the genomic DNA sequence (BTA 11: 21,040,425-21,095,033) was obtained. Obtained from the Ensembl (http://asia.ensembl.org) database.

Primers for the GALM gene containing the SNP were designed. The forward primer is bGALM_F (SEQ ID NO: 2, 5'-GAT TTC CTT CCC AAA GAC TGG CT-3') and the reverse primer is bGALM R (SEQ ID NO: 3, 5'-AGA AAG GGG CAG AAT GGA CAG AT-3') to be.

PCR was performed using 20 µl of the reaction mixture containing 50 ng of DNA, 0.5 nmole of the primer and 2 units of Taq DNA polymerase (GenetBio, Daejeon, Korea). PCR is followed by initial heating at 95° C. for 3 minutes, then heating at 94° C. for 30 seconds for denaturation, 60° C. for 30 seconds for annealing, and 72° C. for polymerization for 30 seconds. As a cycle, a total of 35 cycles were performed. Finally heated at 72° for 5 minutes. The PCR product was isolated and genotyped on a 2.5% agarose gel and visualized by UV irradiation.

The two alleles L and S were determined by comparing the PCR products 172 bp (allele L) and 158 bp (allele S). PCR products of each genotype (L/L, L/S and S/S) confirmed insertion or deletion of polynucleotide 14 bp (SEQ ID NO: 4) through DNA sequencing.

The frequency of insertion or deletion polymorphism allele of GALM 14 bp was calculated using the CERVUS3.0.3 program (Kalinowski et al., 2007). X ² values were calculated using Yates' correction, and Hardy-Weinberg equilibrium was tested using Bonferroni correction.

3. Data Analysis

Conductor properties include body fat weight (CW), dorsal fat thickness (BF), eye muscle area (EMA), marbling score (MARB), meat grade index (MGQI), meat color index (MC) and fat color index (FC). have. Conductor data was collected within 24 hours postmortem. The meat quality index (MGQI) is a value obtained by converting the meat quality as follows for statistical analysis.

MQGI 1 is MQG level 1++ and has a marbling score of 8 and 9, the highest level of marbling. MQGI 2 is MQG level 1+, marbling scores 6 and 7, MQGI 3 is MQG level 1 and marbling scores 4 and 5. MQGI 4 is MQG level 2 and marbling scores are 2 and 3. MQGI 5 is MQG level 3 and has a marbling score of 1, which is the lower rank.

Traits and genotypes were statistically analyzed with the least squares method for scattered data, and for this, the General Linear Model procedure (PROC GLM) of SAS version 8.01 program package/PC (SAS, 1999) was used. The following model for the GALM polymorphic effect was used in the analysis.

Y _ij = μ + SNP _i + ε _ij

Y _ij is the characteristic observed in the i th calf, μ represents the population, SNP represents the GALM genotype (L/L, L/S and S/S) of the i th calf, and ε _ij is any error . The means were separated using the Duncan multiple range test from PROC GLM. Statistical significance is within P <0.05.

Example 1. Genetic polymorphism of GALM gene in Korean cattle population

Three genotypes (L/L, L/S, and S/S) of the 3'UTR genetic polymorphism of the GALM gene were found in the Hanwoo population in Jeju Island (see Fig. 1). The GALM genotype frequency in the Korean cattle population represents the allele distribution (see Table 2). According to Table 2 below, Korean beef has a higher expression frequency of the S allele (0.768) than the L allele (0.232).

Through multiple alignments of DNA sequence analysis results, 14 bp fragments (SEQ ID NOs: 4, 5'' are assigned to the 1265-1278th base of the GALM gene or the 33-46th base of the polynucleotide derived from the GALM gene represented by SEQ ID NO:1) It can be seen that the insertion or deletion (see Figure 2).

Genotype frequency and genetic diversity parameters of Korean cattle GALM gene Breed Genotype Number of animals Allele X ²
(HWE) Diversity
parameter Hanwoo L/L L/S S/S 857 L S N.D. Ho He PIC 0.163 0.142 0.706 0.232 0.768 0.141 0.356 0.293

(HWE stands for Hardy-Weinberg equilibrium, and ND (not determined) means that the result is not derived. Ho is the observed heterozygosity, and He is the predicted heterozygosity. , PIC stands for polymorphic information content.)

Example 2. Association between GALM genotype and conductor trait

As a result of testing the association between the GALM genotype and the carcass trait, the S/S genotype had significantly lower back fat thickness (BF) compared to the L/L and L/S genotypes, and a marbling score (MARB) and a meat quality index (MGQI). Higher (p <0.05, see Table 3). No significant association was found in body fat weight (CW), eye muscle area (EMA), meat color index (MC) or fat color index (FC) (p> 0.05).

Specifically, animals of the GALM S/S genotype have a dorsal thickness (BF) of 12.55 ±3.919 mm, which is about 1.00 mm thinner than the L/L genotype animals (13.49 ±4.938 mm) and L/S genotype animals (13.89 ±5.258 mm). Had. This means that the insertion or deletion of a 14 bp fragment in the 3'UTR of the GALM gene affects fat accumulation in subcutaneous adipose tissue.

On the other hand, the level of marbling score (MARB) of S/S genotype animals (5.83 ±2.066) was higher than that of L/L genotype animals (5.39 ±2.066) and L/S genotype animals (5.31 ±2.109). This indicates that the genotype of the GALM gene accumulates fat in the internal muscles of the dorsal longissimus dorsi.

The meat quality trait, the meat quality index (MGQI), also showed a significant difference in the GALM genotype (p <0.05). The level of MQGI (3.66 ±1.1013) of GALM S/S genotype calf was higher than that of L/L genotype calf (3.46 ±1.049) and L/S genotype calf (3.43 ±1.052).

(a,b,c statistical significance is recognized, P <0.05)

The above detailed description is to illustrate the present invention. In addition, the above-described content is to describe and describe preferred embodiments of the present invention, and the present invention can be used in various other combinations, modifications and environments. That is, it is possible to change or modify the scope of the concept of the invention disclosed herein, the scope equivalent to the disclosed contents, and/or the scope of the art or knowledge in the art. The above-described embodiments describe the best state for realizing the technical spirit of the present invention, and various changes required in specific application fields and uses of the present invention are possible. Therefore, the detailed description of the above invention is not intended to limit the present invention to the disclosed embodiments. In addition, the appended claims should be construed to include other embodiments.

<110> THE FOUNDATION OF AG. TECH. COMMERCIALIZATION AND TRANSFER <120> Method for?predicting economic traits in Hanwoo with GALM gene <130> 1062421 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 172 <212> DNA <213> Artificial Sequence <220> <223> GALM gene fragment <400> 1 tgatttcctt cccaaagact ggctccaggc caggtctaat gaccagctct cctctctgtg 60 aagtgaaggg gactcaacca ccaatgtcac ccatcatctc agccttgatc ctagcccaga 120 agtggcacct gggctccatg tgttggctcc atctgtccat tctgcccctt tc 172 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> bGALM Forward primer <400> 2 gatttccttc ccaaagactg gct 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> bGALM Riverse primer <400> 3 agaaaggggc agaatggaca gat 23 <210> 4 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> GALM gene insertion / deletion fragment <400> 4 ggtctaatga ccag 14

Claims (15)

Primer set for predicting economic feasibility of Korean cattle that can detect whether the polynucleotides derived from the GALM (Galactose mutarotase) gene represented by column number 1 are defective in the 33 to 46 nucleotide sequence. According to claim 1,
The primer set is a primer set for predicting economic traits in Hanwoo, characterized in that it consists of the nucleotide sequence of SEQ ID NO: 2 and 3. According to claim 1,
The Hanwoo economic trait is Hanwoo economic, characterized in that at least one characteristic selected from the group consisting of the back fat thickness, marbling scores (MARB, marbling scores) and meat quality grade index (MQGI) Primer set for trait prediction. According to claim 1,
The Hanwoo is a primer set for predicting economic traits of Hanwoo, characterized in that it is Jeju-do. A composition for predicting economic traits in Korean cattle, comprising the primer set of any one of claims 1 to 4. A kit for predicting economic traits of Hanwoo comprising the primer set of any one of claims 1 to 4. The polynucleotide consisting of 5 to 1000 contiguous bases, and a complementary polynucleotide thereof, comprising a variation of the base sequence in which the 33rd to 36th bases are AGGT or ACTC in the polynucleotide derived from GALM represented by SEQ ID NO: 1 A biomarker for predicting economic traits of Hanwoo. The method of claim 7,
The biomarker is characterized in that it is amplified by the primer set of any one of claims 1 to 4. The method of claim 7,
The Hanwoo economic trait is a biomarker for predicting Hanwoo economic trait, characterized in that at least one characteristic selected from the group consisting of the back fat thickness, marbling grade and meat grade index of Korean beef. The method of claim 7,
The Hanwoo is a biomarker for predicting economic traits of Hanwoo, characterized in that it is Jeju-do. (A) extracting genomic DNA of Korean beef;
(b) amplifying the polymorphic site of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 or a complementary polynucleotide thereof, using the genomic DNA extracted from the step (a) as a template; And
(c) Hanwoo economic trait prediction method comprising the step of determining the base sequence of the amplified polymorphic site. The method of claim 11,
The step (c) is a method for predicting economic traits of Hanwoo, which is determined to have superior economic traits of Korean cattle than those where deletion of the 33 to 46th base of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 did not occur. The method of claim 11,
In the step (c), the allele in which the deletion of the polynucleotides 33 to 46 of the polynucleotide derived from the GALM gene represented by SEQ ID NO: 1 occurs is S, and the allele in which the polynucleotides 33 to 46 of the polynucleotide is not deleted When denoted by L, the S/S type is a method for predicting the economic trait of Hanwoo, which determines that the economic trait of Korean beef is superior to that of L/L or L/S. The method of claim 11,
The method for predicting the economic characteristics of Korean cattle is characterized in that the Hanwoo economic trait is one or more characteristics selected from the group consisting of Korean beef's back fat thickness, marbling grade, and meat grade index. The method of claim 11,
The Hanwoo is a method for predicting economic traits of Hanwoo, characterized in that it is Jeju-do.

Images