KR20230039395A - SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof - Google Patents
SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof Download PDFInfo
- Publication number
- KR20230039395A KR20230039395A KR1020210122666A KR20210122666A KR20230039395A KR 20230039395 A KR20230039395 A KR 20230039395A KR 1020210122666 A KR1020210122666 A KR 1020210122666A KR 20210122666 A KR20210122666 A KR 20210122666A KR 20230039395 A KR20230039395 A KR 20230039395A
- Authority
- KR
- South Korea
- Prior art keywords
- content
- pigs
- determining
- palmitic acid
- base
- Prior art date
Links
- IPCSVZSSVZVIGE-UHFFFAOYSA-N hexadecanoic acid Chemical compound CCCCCCCCCCCCCCCC(O)=O IPCSVZSSVZVIGE-UHFFFAOYSA-N 0.000 title claims abstract description 183
- 235000021314 Palmitic acid Nutrition 0.000 title claims abstract description 57
- WQEPLUUGTLDZJY-UHFFFAOYSA-N n-Pentadecanoic acid Natural products CCCCCCCCCCCCCCC(O)=O WQEPLUUGTLDZJY-UHFFFAOYSA-N 0.000 title claims abstract description 57
- 241000282887 Suidae Species 0.000 title claims abstract description 49
- 239000003550 marker Substances 0.000 title claims abstract description 37
- 235000014113 dietary fatty acids Nutrition 0.000 title claims description 48
- 239000000194 fatty acid Substances 0.000 title claims description 48
- 229930195729 fatty acid Natural products 0.000 title claims description 48
- 150000004665 fatty acids Chemical class 0.000 title claims description 47
- 239000002773 nucleotide Substances 0.000 claims abstract description 38
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 38
- 108091033319 polynucleotide Proteins 0.000 claims abstract description 27
- 102000040430 polynucleotide Human genes 0.000 claims abstract description 27
- 239000002157 polynucleotide Substances 0.000 claims abstract description 27
- 239000000203 mixture Substances 0.000 claims abstract description 22
- 230000000295 complement effect Effects 0.000 claims abstract description 15
- 238000000034 method Methods 0.000 claims description 22
- 241000282898 Sus scrofa Species 0.000 claims description 20
- 239000000523 sample Substances 0.000 claims description 13
- 239000003795 chemical substances by application Substances 0.000 claims description 6
- 238000002360 preparation method Methods 0.000 claims description 2
- 238000004458 analytical method Methods 0.000 description 21
- 235000015277 pork Nutrition 0.000 description 15
- 210000000349 chromosome Anatomy 0.000 description 12
- 108020004414 DNA Proteins 0.000 description 10
- 241001465754 Metazoa Species 0.000 description 7
- 101000923044 Homo sapiens Growth arrest-specific protein 7 Proteins 0.000 description 6
- 108700028369 Alleles Proteins 0.000 description 5
- 230000002068 genetic effect Effects 0.000 description 5
- 238000009396 hybridization Methods 0.000 description 5
- 238000005516 engineering process Methods 0.000 description 4
- 102000054766 genetic haplotypes Human genes 0.000 description 4
- 150000002632 lipids Chemical class 0.000 description 4
- 230000035772 mutation Effects 0.000 description 4
- -1 nucleoside triphosphates Chemical class 0.000 description 4
- 108090000623 proteins and genes Proteins 0.000 description 4
- 108091028043 Nucleic acid sequence Proteins 0.000 description 3
- 230000000694 effects Effects 0.000 description 3
- 238000012986 modification Methods 0.000 description 3
- 230000004048 modification Effects 0.000 description 3
- 238000012163 sequencing technique Methods 0.000 description 3
- 238000000018 DNA microarray Methods 0.000 description 2
- 241000512897 Elaeis Species 0.000 description 2
- 235000001950 Elaeis guineensis Nutrition 0.000 description 2
- 102100031493 Growth arrest-specific protein 7 Human genes 0.000 description 2
- 102100034343 Integrase Human genes 0.000 description 2
- 108091034117 Oligonucleotide Proteins 0.000 description 2
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 2
- 238000009395 breeding Methods 0.000 description 2
- 230000001488 breeding effect Effects 0.000 description 2
- 150000002148 esters Chemical class 0.000 description 2
- 101150044508 key gene Proteins 0.000 description 2
- 244000144972 livestock Species 0.000 description 2
- 210000003205 muscle Anatomy 0.000 description 2
- 239000002777 nucleoside Substances 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000001226 triphosphate Substances 0.000 description 2
- 235000011178 triphosphate Nutrition 0.000 description 2
- QCMYYKRYFNMIEC-UHFFFAOYSA-N COP(O)=O Chemical class COP(O)=O QCMYYKRYFNMIEC-UHFFFAOYSA-N 0.000 description 1
- 102000053602 DNA Human genes 0.000 description 1
- 230000006820 DNA synthesis Effects 0.000 description 1
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 1
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 1
- 102000004163 DNA-directed RNA polymerases Human genes 0.000 description 1
- 108090000626 DNA-directed RNA polymerases Proteins 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- 235000019482 Palm oil Nutrition 0.000 description 1
- 108020004682 Single-Stranded DNA Proteins 0.000 description 1
- 108091027568 Single-stranded nucleotide Proteins 0.000 description 1
- RYYWUUFWQRZTIU-UHFFFAOYSA-N Thiophosphoric acid Chemical class OP(O)(S)=O RYYWUUFWQRZTIU-UHFFFAOYSA-N 0.000 description 1
- 238000007844 allele-specific PCR Methods 0.000 description 1
- 230000000692 anti-sense effect Effects 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 238000012098 association analyses Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 235000014121 butter Nutrition 0.000 description 1
- 150000004657 carbamic acid derivatives Chemical class 0.000 description 1
- 235000013351 cheese Nutrition 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- WORJEOGGNQDSOE-UHFFFAOYSA-N chloroform;methanol Chemical compound OC.ClC(Cl)Cl WORJEOGGNQDSOE-UHFFFAOYSA-N 0.000 description 1
- 238000010835 comparative analysis Methods 0.000 description 1
- 235000013365 dairy product Nutrition 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- NAGJZTKCGNOGPW-UHFFFAOYSA-N dithiophosphoric acid Chemical class OP(O)(S)=S NAGJZTKCGNOGPW-UHFFFAOYSA-N 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 235000019387 fatty acid methyl ester Nutrition 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 239000000796 flavoring agent Substances 0.000 description 1
- 235000019634 flavors Nutrition 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- IPCSVZSSVZVIGE-UHFFFAOYSA-M hexadecanoate Chemical compound CCCCCCCCCCCCCCCC([O-])=O IPCSVZSSVZVIGE-UHFFFAOYSA-M 0.000 description 1
- 125000002887 hydroxy group Chemical group [H]O* 0.000 description 1
- 238000007918 intramuscular administration Methods 0.000 description 1
- 238000002955 isolation Methods 0.000 description 1
- 125000003473 lipid group Chemical group 0.000 description 1
- 238000004949 mass spectrometry Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- JBXYCUKPDAAYAS-UHFFFAOYSA-N methanol;trifluoroborane Chemical compound OC.FB(F)F JBXYCUKPDAAYAS-UHFFFAOYSA-N 0.000 description 1
- 150000004702 methyl esters Chemical class 0.000 description 1
- 230000011987 methylation Effects 0.000 description 1
- 238000007069 methylation reaction Methods 0.000 description 1
- 238000002493 microarray Methods 0.000 description 1
- 244000005700 microbiome Species 0.000 description 1
- 150000007523 nucleic acids Chemical group 0.000 description 1
- 235000016709 nutrition Nutrition 0.000 description 1
- 239000003921 oil Substances 0.000 description 1
- 235000019198 oils Nutrition 0.000 description 1
- 239000002540 palm oil Substances 0.000 description 1
- 150000002942 palmitic acid derivatives Chemical class 0.000 description 1
- PTMHPRAIXMAOOB-UHFFFAOYSA-N phosphoramidic acid Chemical class NP(O)(O)=O PTMHPRAIXMAOOB-UHFFFAOYSA-N 0.000 description 1
- 150000008300 phosphoramidites Chemical class 0.000 description 1
- 238000006116 polymerization reaction Methods 0.000 description 1
- 230000000379 polymerizing effect Effects 0.000 description 1
- 102000054765 polymorphisms of proteins Human genes 0.000 description 1
- 235000021075 protein intake Nutrition 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000013441 quality evaluation Methods 0.000 description 1
- 238000011002 quantification Methods 0.000 description 1
- 230000002285 radioactive effect Effects 0.000 description 1
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 1
- 150000003839 salts Chemical class 0.000 description 1
- 150000004671 saturated fatty acids Chemical class 0.000 description 1
- 230000001953 sensory effect Effects 0.000 description 1
- 238000000926 separation method Methods 0.000 description 1
- 239000007787 solid Substances 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP 마커 조성물 및 이를 이용한 돼지의 지방산(Palmitic acid, C16:0) 함량 판별 방법에 관한 것이다.The present invention relates to a SNP marker composition for determining the content of palmitic acid (C16:0) in pigs and a method for determining the content of palmitic acid (C16:0) in pigs using the same.
약 9000년 전에 인도의 동부 지방에서 사육된 이래로, 돼지는 세계적으로 사람이 필요로 하는 단백질 섭취를 위한 가장 기본적인 가축으로 각각의 시대와 상황 및 사람들의 기호에 따라 사육되어 왔다. 일반적으로 유럽 품종과 아시아 품종들은 각 대륙의 야생 멧돼지(Sus scrofa)에서 유래되었으며, 현재까지 존재하고 있는 품종은 200여종 이며, 최근 FAO (Finance and Accounts Office)에서 발표한 결과에 따르면 아시아 품종이 30%, 유럽품종이 33% 정도임이 보고되었다. 이 품종들 사이에 표현형의 차이는 모색, 크기, 체형 등이 있다.Since being bred in the eastern part of India about 9,000 years ago, pigs have been bred according to each era, situation, and people's taste as the most basic livestock for protein intake required by people worldwide. In general, European and Asian breeds are derived from wild boars ( Sus scrofa ) of each continent, and there are about 200 breeds that exist so far, and according to the results recently announced by the FAO (Finance and Accounts Office), Asian breeds are 30 %, and European varieties were reported to be about 33%. Phenotypic differences between these breeds include coat color, size, and body type.
최근에는, 돈육의 품질을 제고하기 위하여, 돼지를 일정한 규격에서 사육하고 과학적으로 관리하고, 이로부터 얻어진 돈육을 브랜드화하고 있으며, 이미 다양한 브랜드의 돈육이 상업적으로 판매되고 있다. 그러나, 이처럼 브랜드화된 돈육과 브랜드화되지 않은 돈육은 일반인이 육안으로 식별하기 어렵기 때문에, 이러한 점을 악용하여 브랜드화되지 않은 돈육을 브랜드화된 돈육으로 속여서 판매하는 방식으로 돈육의 유통질서를 교란시키는 사건이 빈번하게 발생하고 있다. 실제로, 브랜드화된 돈육과 브랜드화되지 않은 돈육을 구별하는 것은 전문가의 수준에서도 매우 어려운 일이기 때문에, 정품 브랜드의 돈육을 판별하는 객관적인 기준을 마련하려는 연구가 활발히 진행되고 있다.Recently, in order to improve the quality of pork, pigs are bred and scientifically managed, and the resulting pork is branded, and pork of various brands is already commercially sold. However, since it is difficult for the general public to distinguish branded pork from non-branded pork with the naked eye, there have been incidents in which the distribution order of pork is disrupted by exploiting this point to deceive and sell non-branded pork as branded pork. It is happening frequently. In fact, since it is very difficult to distinguish branded pork from non-branded pork even at the level of experts, studies are being actively conducted to establish objective criteria for distinguishing genuine brand pork.
한편, 지방산 (fatty acid, FA) 성분은 감각적, 영양적 및 기능적 요인에 기여할 수 있기 때문에 돼지 고기 품질 평가에 중요한 역할을 하며, 예를 들어, FA 성분은 돼지 고기의 산화 안정성을 조절하여 고기의 색과 풍미에 영향을 미친다. On the other hand, fatty acid (FA) components play an important role in pork quality evaluation because they can contribute to sensory, nutritional and functional factors. Affects color and flavor.
따라서, 이러한 돼지의 지방산의 함량을 판별하여 돼지의 품질을 판별할 수 있는 기술이 필요한 실정이다.Therefore, there is a need for a technology capable of determining the quality of pigs by determining the content of fatty acids in such pigs.
본 발명이 해결하고자 하는 과제는 돈육의 품질을 판별하기 위하여, 돼지의 지방산의 함량을 판별할 수 있는 SNP 마커 조성물, 돼지의 지방산 함량 판별용 조성물, 판별용 키트 및 판별 방법을 제공하는 것이다.The problem to be solved by the present invention is to provide a SNP marker composition capable of determining the fatty acid content of pigs, a composition for determining the fatty acid content of pigs, a kit for determining the quality of pork, and a method for determining the fatty acid content of pigs.
본 발명의 일 실시 예는 서열번호1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP(Single Nucleotide Polymorphism) 마커 조성물이다.In one embodiment of the present invention, the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base, or a polynucleotide complementary thereto It is a SNP (Single Nucleotide Polymorphism) marker composition for determining the content of palmitic acid (C16:0) in pigs containing nucleotides.
본 발명의 다른 실시 예는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP 마커를 검출 또는 증폭할 수 있는 제제를 포함하는, 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 조성물로서, 상기 SNP 마커는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함한다.Another embodiment of the present invention is a composition for determining the content of palmitic acid (C16: 0) in pigs, including an agent capable of detecting or amplifying a SNP marker for determining the content of palmitic acid (C16: 0) in pigs In the SNP marker, the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base or a nucleotide complementary thereto includes
상기 제제는 상기 SNP 마커를 검출 또는 증폭할 수 있는 프라이머 또는 프로브일 수 있다.The agent may be a primer or probe capable of detecting or amplifying the SNP marker.
본 발명의 다른 실시 예는 상기 조성물을 포함하는, 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 키트이다.Another embodiment of the present invention is a kit for determining a pig's fatty acid (Palmitic acid, C16:0) content, including the composition.
본 발명의 다른 실시 예는 (a) 개체로부터 분리된 시료의 DNA로부터 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP 마커의 다형성 부위를 증폭하거나 검출하는 단계; 및 (b) 상기 (a) 단계에서 증폭 또는 검출된 다형성 부위의 염기를 결정하는 단계를 포함하며, 상기 (a) 단계의 SNP 마커는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별 방법이다.Another embodiment of the present invention is (a) amplifying or detecting a polymorphic site of a SNP marker for determining a pig's fatty acid (Palmitic acid, C16:0) content from the DNA of a sample isolated from the subject; and (b) determining the base of the polymorphic site amplified or detected in step (a), wherein the SNP marker in step (a) is the 1001st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1. is T or C, and a porcine fatty acid (Palmitic acid, C16:0) content determination method comprising a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base or a nucleotide complementary thereto.
상기 개체는 제주재래돼지, 랜드레이스 또는 제주재래돼지와 랜드레이스의 교잡종일 수 있다.The individual may be Jeju native pig, Landrace, or a hybrid of Jeju native pig and Landrace.
본 발명에 따른 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별할 수 있는 SNP 마커는 돈육 내 지방산을 객관적으로 평가할 수 있고, 이에 따라 돈육의 품질을 쉽게 판별할 수 있다.The SNP marker capable of determining the content of fatty acids (Palmitic acid, C16:0) in pigs according to the present invention can objectively evaluate fatty acids in pork, and accordingly, the quality of pork can be easily determined.
도 1은 GAS7 유전자의 염기서열을 나타내는 것이며, 1001번째 염기에서 T/C 염기 변이가 나타난다.
도 2는 GWAS(genome wide association study)분석을 통해 돼지의 지방산(Palmitic acid, C16:0)의 함량을 조절하는 핵심유전자의 염색체상에서 유전자좌위를 확인한 것이다.
도 3은 연관분석을 통해 돼지의 지방산(Palmitic acid, C16:0)에 대한 12번 염색체의 주요 QTL 영역을 분석한 것이다.
도 4는 12번 염색체의 서열번호1의 GAS7 유전자의 염기서열의 1001번째 염기 변이에 따른 유전자형을 확인한 결과를 나타내는 그래프이다.Figure 1 shows the nucleotide sequence of the GAS7 gene, showing T / C base mutation at the 1001st base.
Figure 2 confirms the genetic locus on the chromosome of a key gene controlling the content of fatty acids (palmitic acid, C16: 0) in pigs through genome wide association study (GWAS) analysis.
3 shows analysis of the main QTL region of
Figure 4 is a graph showing the results of confirming the genotype according to the 1001st base mutation of the base sequence of the GAS7 gene of SEQ ID NO: 1 of
이하, 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있도록 본 발명의 구체적인 실시 예를 통하여 보다 상세하게 설명한다. 그러나 본 발명은 여러 가지 상이한 형태로 구현될 수 있으며 여기에서 설명하는 실시 예에 한정되지 않는다.Hereinafter, specific embodiments of the present invention will be described in more detail so that those skilled in the art can easily implement the present invention. However, the present invention may be implemented in many different forms and is not limited to the embodiments described herein.
본 발명은 서열번호 1의 염기서열로 구성되는 GAS7 유전자의 변이염기를 SNP 마커로 활용하여 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별하는 것이다.The present invention is to determine the content of fatty acids (Palmitic acid, C16: 0) in pigs by using the mutated base of the GAS7 gene composed of the nucleotide sequence of SEQ ID NO: 1 as an SNP marker.
CCTACATTGCCGTGAGTTGTGGTGTAGGTCGCAGACGCAGCTCGGATCCCGCGTTGCTCTGGCTCTGGCATAGGCTGGCAGCTGTAGCTCCAATTCGACCCCTAGCCTGGGAACCTCCATATGCCGTAGGTGCGGCCCTAGAAAAGAAAAAAAGAAGAGAAGCAGGACAGGGAGAGGACCAGTTCACATGACACCTGCTCTCTGGGGTGTCCTGTCCTGTAGCCCAAAGAGCCTGGCTCTCCAGGACCCAGGGGCCTCACTTTGAGGTTCAGCACTGACCTGTCCACCTGGGCCTTCCACAACCCCAACCCATACTCCGTGACAAGGCCATTCACGCCTTCTCGAAGAAAAACTGCTTAAGCCAGGGGCCCACATCCCAGCAAGGTGGGCCTGATTCCCCAGGGCAAGCTCTCATCTCTTTATCCTCTTCAGTTCAGCCAGCCGTCCAACCAGCCATCCAAGAGTTACCCAGCCAGGCCTCATGGAAGCCGAGGGCCGGGCAGGGCCATCCCAGAGATTTCCTGCCCTGGAGGGGCTCAGGGTGCAGGGGGAGAGGGTCACACGAGTCACCACCGGCCAGGGCTATCGCGGGGGGCAGCCCTGTGCAAGCCAGGGGAGAAGGAGCAACCGGCCTGGGGAGCGACCGAAGGGCACAGGTGGGCTGGGTCTGGGGGAGGCAAGAGGGGGAGGGACCCCAGAGAGAGGGGCGGGTGTGCAGAGGCACGGGGTGCGGAGGTGTGTGTACCCGGAGAGGGCAACTGAGGAGGCTGGGGCGGGTGGGGAAGGTGGTCTGTGAAGGCCCCTGTCCCCCAGCAAGGAGCAGCCCGACTCTCGGGACAGTGGGGAGCCAGTGGAGATGGCTCCATAGGACTCAGGTTGTAGGAGGACACCGTGGAGGGCCACGCGAGGCTAGGAAGTGTGGGACTCCAGCCCCAAGCCTGGGGTCCCTGGCTCAGCTGGAACACAGGGATATTGACTAGGAAGCCAGTTAACAGGAAACTTGCCACTCCCTGGGAGACGTCAGCCACTTTCCAACCACCTCCCTCCAGCCTTCCCCCTTGGGGTCCAGCCCTCCAGAAACAACAGACCGTCCTCCTCCCCCCTCCCCCACAAGCCAGGAGAAGGCCAAGGGCACGGGACTCTGCGAGGATGGATCACGCCAGCGGCAGGTCTGCGCCGGATCCCTCTCCACCCTGCCCGCCTCTCACGCCGGCCCTCATTTGCAGGAGACGTGCCGCTGTAGCTGAGTGTATATATCGTCTGGATGATTTGCCGTGGAGCATCATTTACACCTTCTGCTGCTCCTCCGAGAAAATCATTTCTCCAAGACTAATAATAAAACAGACCAGCCACCTAGAGTAACAAAGCACTGCAACCAGCCCCTGGCACGCAATTCAGAAACACACCAGAACAGCTGCACGTGGCATGCCCCAGAGCAGAGAGGAGCGGCAGCGTGTAGCGGACTGGGATTCTGGACTTTGCAAACAGTGTCACCTAGAGCACCACGGCTTCCTGGAGGAGTCCCCAGAGCGGGTATGCAGCCAGAAGAGCAGTGCCTGGGTCAGACCCCAAGGAGCACCCGTGAAGCCAGGTCTGGGAGCCCTGGAGACTTGAGGCTGGATCTGGTTCCCCTGTCTGCATTTGCACATCAGCACAGCTGCCTTCATGGACTGGGGACACAGGGGCAAAGGGCAAAGGGCTCAGGCCTGCCTGGCTCCACAAACCCCCTGGAGTGCCCAGTCAAGCTCTGGCCAAGCCATTCCCCACATCTCCCTCACTGGCAGGGCCTCCAACCCGCTCAGAATGACTCCACAGTGGACTCTGCACAGCTGAGGAAGAGGCCTGGCTACCTTCTCCCAGGTGAGACAGAGGACACCCGTCTGAAATTCTCAACATCAACAGCATCACTGCAGCCACACACCCCCACGGGGCTCCTTAAGGGCACCTAGAGATCAGGTCTTATACCCACAGACGGCTCACTGTCGCTCTGACCCCAAATTC <GAS7 nucleotide sequence, SEQ ID NO: 1>
CCTACATTGCCGTGAGTTGTGGTGTAGGTCGCAGACGCAGCTCGGATCCCGCGTTGCTCTGGCTCTGGCATAGGCTGGCAGCTGTAGCTCCAATTCGACCCCTAGCCTGGGAACCTCCATATGCCGTAGGTGCGGCCCTAGAAAAGAAAAAAAGAAGAGAAGCAGGACAGGGAGAGGACCAGTTCACATGACACCTGCTCTCTGGGGTGTCCTGTCCTGTAGCCCAAAGAGCCTGGCTCTCCAGGACCCAGGGGCCTCACTTTGAGGTTCAGCACTGACCTGTCCACCTGGGCCTTCCACAACCCCAACCCATACTCCGTGACAAGGCCATTCACGCCTTCTCGAAGAAAAACTGCTTAAGCCAGGGGCCCACATCCCAGCAAGGTGGGCCTGATTCCCCAGGGCAAGCTCTCATCTCTTTATCCTCTTCAGTTCAGCCAGCCGTCCAACCAGCCATCCAAGAGTTACCCAGCCAGGCCTCATGGAAGCCGAGGGCCGGGCAGGGCCATCCCAGAGATTTCCTGCCCTGGAGGGGCTCAGGGTGCAGGGGGAGAGGGTCACACGAGTCACCACCGGCCAGGGCTATCGCGGGGGGCAGCCCTGTGCAAGCCAGGGGAGAAGGAGCAACCGGCCTGGGGAGCGACCGAAGGGCACAGGTGGGCTGGGTCTGGGGGAGGCAAGAGGGGGAGGGACCCCAGAGAGAGGGGCGGGTGTGCAGAGGCACGGGGTGCGGAGGTGTGTGTACCCGGAGAGGGCAACTGAGGAGGCTGGGGCGGGTGGGGAAGGTGGTCTGTGAAGGCCCCTGTCCCCCAGCAAGGAGCAGCCCGACTCTCGGGACAGTGGGGAGCCAGTGGAGATGGCTCCATAGGACTCAGGTTGTAGGAGGACACCGTGGAGGGCCACGCGAGGCTAGGAAGTGTGGGACTCCAGCCCCAAGCCTGGGGTCCCTGGCTCAGCTGGAACACAGGGATATTGACTAGGAAGCCAGTTAACAGGAAAC TTGCCACTCCCTGGGAGACGTCAGCCACTTTCCAACCACCTCCCTCCAGCCTTCCCCCTTGGGGTCCAGCCCTCCAGAAACAACAGACCGTCCTCCTCCCCCCTCCCCCACAAGCCAGGAGAAGGCCAAGGGCACGGGACTCTGCGAGGATGGATCACGCCAGCGGCAGGTCTGCGCCGGATCCCTCTCCACCCTGCCCGCCTCTCACGCCGGCCCTCATTTGCAGGAGACGTGCCGCTGTAGCTGAGTGTATATATCGTCTGGATGATTTGCCGTGGAGCATCATTTACACCTTCTGCTGCTCCTCCGAGAAAATCATTTCTCCAAGACTAATAATAAAACAGACCAGCCACCTAGAGTAACAAAGCACTGCAACCAGCCCCTGGCACGCAATTCAGAAACACACCAGAACAGCTGCACGTGGCATGCCCCAGAGCAGAGAGGAGCGGCAGCGTGTAGCGGACTGGGATTCTGGACTTTGCAAACAGTGTCACCTAGAGCACCACGGCTTCCTGGAGGAGTCCCCAGAGCGGGTATGCAGCCAGAAGAGCAGTGCCTGGGTCAGACCCCAAGGAGCACCCGTGAAGCCAGGTCTGGGAGCCCTGGAGACTTGAGGCTGGATCTGGTTCCCCTGTCTGCATTTGCACATCAGCACAGCTGCCTTCATGGACTGGGGACACAGGGGCAAAGGGCAAAGGGCTCAGGCCTGCCTGGCTCCACAAACCCCCTGGAGTGCCCAGTCAAGCTCTGGCCAAGCCATTCCCCACATCTCCCTCACTGGCAGGGCCTCCAACCCGCTCAGAATGACTCCACAGTGGACTCTGCACAGCTGAGGAAGAGGCCTGGCTACCTTCTCCCAGGTGAGACAGAGGACACCCGTCTGAAATTCTCAACATCAACAGCATCACTGCAGCCACACACCCCCACGGGGCTCCTTAAGGGCACCTAGAGATCAGGTCTTATACCCACAGACGGCTCACTGTCGCTCTGACCCCAAATT C
따라서, 본 발명의 일 실시 예는 서열번호1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP(Single Nucleotide Polymorphism) 마커 조성물이다.Therefore, in one embodiment of the present invention, the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base, or It is a SNP (Single Nucleotide Polymorphism) marker composition for determining the content of palmitic acid (C16:0) in porcine containing complementary nucleotides.
본 발명의 용어 "SNP 마커"란, 개체 또는 종을 식별하기 위해 이용되는 DNA 서열 상의 단일 염기 다형성 대립유전자 염기쌍을 의미한다. SNP는 비교적 그 빈도가 높고 안정하며 유전체 전체에 분포되어 있고 이에 의하여 개체의 유전적 다양성이 발생하므로, SNP 마커는 개체 간의 유전적 근접성을 알려주는 지표의 역할을 할 수 있다. SNP 마커는 일반적으로 단일 염기 다형성에 수반되는 표현형의 변화를 포함하지만 경우에 따라 그렇지 않을 수도 있다. The term "SNP marker" of the present invention means a base pair of a single base polymorphism allele on a DNA sequence used to identify an individual or species. Since SNPs have a relatively high frequency, are stable, and are distributed throughout the genome, resulting in genetic diversity of individuals, SNP markers can serve as indicators of genetic proximity between individuals. SNP markers usually include phenotypic changes accompanying single nucleotide polymorphisms, but may not in some cases.
본 발명의 용어 "개체"란, 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별하고자 하는 대상인 돼지를 의미하며, 상기 돼지로부터 얻어진 검체를 이용하여, 상기 SNP 마커의 유전자형을 분석함으로써 상기 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별할 수 있고, 상기 돼지는 제주재래돼지, 랜드레이스 또는 제주재래돼지와 랜드레이스의 교잡종일 수 있다.The term "individual" of the present invention refers to a pig that is a target for determining the content of palmitic acid (C16:0) in pigs, and the genotype of the SNP marker is analyzed using a sample obtained from the pig. The fatty acid (Palmitic acid, C16: 0) content of can be determined, and the pig may be Jeju native pig, Landrace, or a cross between Jeju native pig and Landrace.
본 발명의 돼지의 지방산은 팔미트산(Palmitic acid, C16:0)으로, 상기 팔미트산은 동물, 식물, 미생물에서 발견되는 가장 일반적인 포화 지방산으로 16개의 탄소를 포함하고 있고 화학식은 CH3(CH2)14COOH이다. 이름에서 알 수 있듯이 오일팜(기름야자)의 열매로부터 추출한 기름(palm oil)의 주요 성분이다. 팔미트산은 육류, 치즈, 버터 및 유제품에서도 발견할 수 있다. 팔미트산의 염 및 에스터(에스테르)는 팔미테이트로 알려져 있다. 팔미테이트는 생리적 pH (7.4)에서 관찰되는 팔미트산의 형태이다.The pig fatty acid of the present invention is palmitic acid (C16:0), and the palmitic acid is the most common saturated fatty acid found in animals, plants, and microorganisms and contains 16 carbons, and the chemical formula is CH3 (CH2) 14COOH. As the name suggests, it is the main component of oil (palm oil) extracted from the fruit of the oil palm (oil palm). Palmitic acid can also be found in meat, cheese, butter and dairy products. The salts and esters (esters) of palmitic acid are known as palmitates. Palmitate is the form of palmitic acid found at physiological pH (7.4).
본 발명에 있어서, 상기 팔미트산(Palmitic acid, C16:0)은 12번 염색체에 위치한 SNP(M1GA0017062)의 유전형을 이용하여 함량을 예측할 수 있는 대상으로 사용된다. In the present invention, the palmitic acid (C16:0) is used as a target for predicting the content using the genotype of the SNP (M1GA0017062) located on
본 발명에 있어서, 상기 돼지의 지방산(Palmitic acid, C16:0)의 함량은 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T인 경우의 돼지의 지방산(Palmitic acid, C16:0)의 함량이 1001번째 염기가 C인 경우보다 높은 수준을 나타내는 것으로 판별할 수 있다. 본 발명의 일 실시 예에서, 유전자형이 CC인 경우 돼지의 지방산(Palmitic acid, C16:0)의 함량이 상대적으로 가장 높은 수준을 나타내었고, 유전자형이 TT인 경우 돼지의 지방산(Palmitic acid, C16:0)의 함량이 상대적으로 가장 낮은 수준을 나타내었으며, 유전자형이 CT인 경우 중간 값을 나타내었다. 따라서, 유전자형이 TT 및 CT를 모두 포함하는 경우는 유전자형이 CC인 경우보다 돼지의 지방산(Palmitic acid, C16:0)의 함량이 높게 판별되었다(실시 예 3).In the present invention, the porcine fatty acid (Palmitic acid, C16: 0) content is determined when the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T. ) It can be determined that the content of the 1001st base is higher than that of C. In one embodiment of the present invention, when the genotype is CC, the content of fatty acids (Palmitic acid, C16: 0) in pigs is relatively the highest, and when the genotype is TT, the fatty acids (Palmitic acid, C16: 0) showed the relatively lowest level, and the middle value was shown when the genotype was CT. Therefore, when the genotype included both TT and CT, the content of fatty acid (Palmitic acid, C16:0) was determined to be higher in pigs than when the genotype was CC (Example 3).
본 발명의 다른 실시 예는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP 마커를 검출 또는 증폭할 수 있는 제제를 포함하는, 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 조성물로서, 상기 SNP 마커는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함한다.Another embodiment of the present invention is a composition for determining the content of palmitic acid (C16: 0) in pigs, including an agent capable of detecting or amplifying a SNP marker for determining the content of palmitic acid (C16: 0) in pigs In the SNP marker, the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base or a nucleotide complementary thereto includes
본 발명의 용어 "SNP 마커를 검출 또는 증폭할 수 있는 제제"란, 상기와 같은 유전자의 다형성 부위를 검출 또는 증폭을 통해 확인하여 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별할 수 있는 조성물을 의미하며, 바람직하게는 상기 SNP 마커의 폴리뉴클레오티드를 특이적으로 검출 또는 증폭할 수 있는 프라이머 또는 프로브를 의미한다. The term "agent capable of detecting or amplifying a SNP marker" of the present invention refers to a product capable of determining the content of fatty acid (Palmitic acid, C16:0) in pigs by detecting or amplifying the polymorphic region of the gene as described above. It means a composition, and preferably means a primer or probe capable of specifically detecting or amplifying the polynucleotide of the SNP marker.
상기 SNP 마커 증폭에 사용되는 프라이머는, 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도 하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있으나, 통상 15 내지 30 뉴클레오티드이다. 짧은 프라이머 분자는 일반적으로 주형과 안정한 혼성체를 형성하기 위해서는 더 낮은 온도를 필요로 한다. 상기 프라이머 서열은 상기 SNP 마커와 완전하게 상보적일 필요는 없으나, 상기 SNP 마커와 혼성화 할 정도로 충분히 상보적이어야 한다.The primers used to amplify the SNP markers are prepared in the form of template-directed DNA under suitable conditions (eg, four different nucleoside triphosphates and a polymerizing agent such as DNA, RNA polymerase or reverse transcriptase) in an appropriate buffer and at an appropriate temperature. It can be a single-stranded oligonucleotide that can serve as a starting point for synthesis. The appropriate length of the primer may vary depending on the purpose of use, but is usually 15 to 30 nucleotides. Short primer molecules generally require lower temperatures to form stable hybrids with the template. The primer sequence need not be perfectly complementary to the SNP marker, but must be sufficiently complementary to hybridize with the SNP marker.
본 발명의 용어 "프라이머"란, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미하며, 주로 특정 구간을 증폭하는 프라이머 세트의 형태로 사용된다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성을 개시할 수 있다. 이때, PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다. The term "primer" of the present invention refers to a base sequence having a short free 3' terminal hydroxyl group, which can form a base pair with a complementary template and is a starting point for template strand copying. It refers to a short sequence that functions as a point, and is mainly used in the form of a primer set that amplifies a specific section. A primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature. At this time, PCR conditions and lengths of sense and antisense primers may be modified based on those known in the art.
본 발명의 용어, "프로브"는 다양한 길이의 DNA 또는 RNA 염기서열로 방사성 표지 또는 형광 표지 등을 통해 표지되어 있으며, 단일가닥의 염기서열로 구성되어 상보적인 서열을 가진 단일가닥 DNA 또는 RNA에 특이적으로 결합하여 혼성화하는 것이 특징이며, 혼성화한 프로브의 표지 신호를 탐지하는 방식을 통해 타겟을 검출할 수 있다.As used herein, the term "probe" refers to DNA or RNA nucleotide sequences of various lengths labeled with radioactive or fluorescent labels, and is composed of a single-stranded nucleotide sequence and is specific for single-stranded DNA or RNA having a complementary sequence. It is characterized in that it binds and hybridizes with the target, and the target can be detected through a method of detecting the label signal of the hybridized probe.
본 발명의 프라이머 또는 프로브는 포스포아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있다.The primers or probes of the present invention can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences can also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of one or more homologs of a natural nucleotide, and modifications between nucleotides, such as uncharged linkages such as methyl phosphonates, phosphotriesters, phosphoro amidates, carbamates, etc.) or to charged linkages (eg phosphorothioates, phosphorodithioates, etc.).
또한, 본 발명은 또 다른 관점에서, 상기 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 조성물을 포함하는, 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 키트에 관한 것이다.In another aspect, the present invention relates to a kit for determining the content of palmitic acid (C16:0) in pigs, including the composition for determining the content of palmitic acid (C16:0) in pigs.
본 발명의 키트는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.The kit of the present invention may be a DNA chip kit, but is not limited thereto.
상기 DNA 칩 키트는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 마커인 SNP 마커를 포함하는 폴리뉴클레오티드의 서열과 상보적인 염기서열을 포함하는 올리고뉴클레오티드가 부착된 칩을 이용하여 특이적으로 타겟 DNA와 혼성화하여 결합하는 것을 특징으로 하며, SNP의 염기 변이에 따라 혼성화 수준의 변화가 나타나는 것을 이용하여 돼지의 지방산(Palmitic acid, C16:0) 함량을 판별할 수 있다.The DNA chip kit uses a chip to which an oligonucleotide containing a nucleotide sequence complementary to a polynucleotide sequence containing a SNP marker, which is a marker for determining the content of palmitic acid (C16:0) in pigs, is attached. It is characterized by hybridization and binding to the target DNA, and the change in hybridization level according to the base mutation of the SNP can be used to determine the content of palmitic acid (C16:0) in pigs.
또한, 본 발명은 또 다른 관점에서, (a) 개체로부터 분리된 시료의 DNA로부터 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 SNP 마커의 다형성 부위를 증폭하거나 검출하는 단계; 및 (b) 상기 (a) 단계에서 증폭 또는 검출된 다형성 부위의 염기를 결정하는 단계를 포함하며, 상기 (a) 단계의 SNP 마커는 서열번호1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별 방법에 관한 것이다.In another aspect, the present invention provides (a) amplifying or detecting a polymorphic site of a SNP marker for determining a pig's fatty acid (Palmitic acid, C16:0) content from the DNA of a sample isolated from the subject; and (b) determining the base of the polymorphic site amplified or detected in step (a), wherein the SNP marker in step (a) is the 1001st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1. is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base or a nucleotide complementary thereto, a method for determining the content of palmitic acid (C16:0) in pigs.
본 발명은 상기 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 C인 경우의 돼지의 지방산(Palmitic acid, C16:0)의 함량이 1001번째 염기가 T인 경우보다 높은 수준을 나타내는 것으로 판별할 수 있다.In the present invention, when the 1001st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 is C, the content of palmitic acid (C16:0) in pigs is higher than that when the 1001st base is T. can be identified as
상기 (a) 단계의 DNA 시료로부터 폴리뉴클레오티드를 증폭하는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다.Any method known to those skilled in the art may be used for amplifying the polynucleotide from the DNA sample in step (a).
상기 방법 중 (b)단계의 증폭된 SNP 마커 부위의 염기를 결정하는 방법은 시퀀싱 분석, 마이크로어레이(microarray)에 의한 혼성화, 대립유전자 특이적인 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화 기법(dynamic allele-specific hybridization, DASH), PCR 연장 분석, PCR-SSCP, PCR-RFLP 분석, HRM 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예를 들면, Sequenom의 MassARRAY 시스템), 미니-시퀀싱(mini-sequencing) 방법, Bio-Plex 시스템(BioRad), CEQ and SNPstream 시스템(Beckman), Molecular Inversion Probe 어레이 기술(예를 들면, Affymetrix GeneChip), 및 BeadArray Technologies(예를 들면, Illumina GoldenGate 및 Infinium 분석법) 등을 이용하여 수행될 수 있으나, 특별히 이에 제한되지는 않는다. 상기 방법들 또는 본 발명이 속하는 기술분야의 당업자에게 이용 가능한 다른 방법에 의해, 상기 SNP 마커에서의 하나 이상의 대립유전자를 확인할 수 있다.Among the above methods, the method for determining the base of the amplified SNP marker region in step (b) includes sequencing analysis, microarray hybridization, allele specific PCR, and dynamic allele hybridization technique. allele-specific hybridization (DASH), PCR extension analysis, PCR-SSCP, PCR-RFLP analysis, HRM analysis or TaqMan techniques, SNPlex platform (Applied Biosystems), mass spectrometry (eg Sequenom's MassARRAY system), mini-sequencing (mini-sequencing) methods, Bio-Plex systems (BioRad), CEQ and SNPstream systems (Beckman), Molecular Inversion Probe array technology (eg, Affymetrix GeneChip), and BeadArray Technologies (eg, Illumina GoldenGate and Infinium assays). ), etc., but is not particularly limited thereto. One or more alleles in the SNP marker can be identified by the above methods or other methods available to those skilled in the art.
이하, 본 발명에 따른 구체적인 실시 예를 들어 설명한다.Hereinafter, specific examples according to the present invention will be described.
<재료 및 실험방법><Materials and test methods>
1. 공시 동물1. Disclosure animals
순종 제주 재래 돼지(KNP)와 순종 랜드레이스 돼지(Landrace)를 교배(LK cross)하여 F2 자손(수컷 568 마리, 암컷 537 마리)의 총 1,105 마리의 동물을 생산하였다.A total of 1,105 animals of F2 progeny (568 males and 537 females) were produced by crossing purebred Jeju native pigs (KNP) and purebred Landrace pigs (LK cross).
구체적으로, 19 마리의 KNP돼지와 17 마리의 Landrace 돼지를 교배하여 91마리의 F1 번식용 돼지를 확보하였고, F1 자손간 교배하여 F2 자손을 생성하였다. 사육, 사료, 표현형에 대한 모든 실험 절차는 제주도에 위치한 국립축산과학원 난지축산연구소의 동일한 연구 농장에서 이루어졌다. Specifically, by crossing 19 KNP pigs and 17 Landrace pigs, 91 pigs for F1 breeding were obtained, and F2 offspring were generated by crossing F1 offspring. All experimental procedures for breeding, feed, and phenotype were conducted at the same research farm at the Nanji Livestock Research Institute, National Institute of Animal Science, located in Jeju Island.
2. 지방산 조성 표현형 분석2. Fatty acid composition phenotype analysis
지방산(FA) 조성 데이터를 확보하기위해 F2 자손의 좌도체 등심(Longissimus dorsi muscle)을 전량 샘플링하여 분석에 활용하였다.In order to obtain fatty acid (FA) composition data, the entire amount of Longissimus dorsi muscle of the F2 offspring was sampled and used for analysis.
Folch 등(A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497-509.)의 방법에 따라 클로로포름-메탄올(2:1,v/v)을 사용하여 각 장근 배근 샘플의 근육 내 지질을 분리하고, 지질 추출물을 Morrison과 Smith의 방법(Preparation of Fatty Acid Methyl Esters and Dimethylacetals from Lipids with Boron Fluoride-methanol. J. Lipid Res. 1964, 5, 600-608.)을 사용하여 지방산(FA) 메틸 에스테르로 변환하였다.Chloroform-methanol (2:1, v/v) was prepared according to the method of Folch et al. (A Simple Method for the Isolation and Purification of Total Lipides from Animal Tissues. J. Biol. Chem. 1957, 226, 497-509.) was used to isolate the intramuscular lipids of each lattice muscle sample, and lipid extracts were prepared according to the method of Morrison and Smith (Preparation of Fatty Acid Methyl Esters and Dimethylacetals from Lipids with Boron Fluoride-methanol. J. Lipid Res. 1964, 5, 600- 608.) was used to convert to fatty acid (FA) methyl esters.
FA 메틸 에스테르의 분리 및 정량화는 가스크로마토그래프(6890N, Agilent Technologies, Germany)를 사용하여 수행하였다.Separation and quantification of FA methyl esters were performed using a gas chromatograph (6890N, Agilent Technologies, Germany).
3. 돼지 전장 유전자형 분석3. Porcine full-length genotyping
F2 개체에 대하여 돼지 SNP 60K BeadChip (Illumina)을 사용하여 62,163 개의 단일 뉴클레오티드 다형성 (SNP) 마커에 대해 유전자형을 분석하였고, 게놈 DNA는 표준 sucrose-proteinase K 방법을 사용하여 혈액에서 추출하였다. 유전자형 SNP 마커의 품질 관리 및 여과는 PLINK 프로그램 (ver. 1.90)을 사용하여 수행하였으며, 유전형은 경미한 대립 유전자 빈도 (<5 %), 유전형 호출 비율 (<90 %) 및 Hardy-Weinberg 평형 오류에 대한 c2-테스트의 P- 값(≤0.000001)에 따라 필터링되었다. 18 개의 상 염색체에 대한 총 39,485 개의 SNP 마커가 최종 GWAS 분석에 활용되었다.F2 individuals were genotyped for 62,163 single nucleotide polymorphism (SNP) markers using the porcine SNP 60K BeadChip (Illumina), and genomic DNA was extracted from blood using the standard sucrose-proteinase K method. Quality control and filtering of genotyped SNP markers was performed using the PLINK program (ver. 1.90), and genotypes were evaluated for minor allele frequency (<5%), genotype call rate (<90%), and Hardy-Weinberg equilibrium error. Filtered according to the P-value (≤0.000001) of the c2-test. A total of 39,485 SNP markers on 18 autosomes were utilized for the final GWAS analysis.
4. 지방산 조성 유전자좌위 분석(GWAS Analysis)4. Fatty Acid Composition Genetic Locus Analysis (GWAS Analysis)
단일 마커 연관 분석은 게놈 차원의 효율적인 혼합 모델 연관(genome-wide efficient mixed model association, GEMMA) 프로그램(ver. 0.94.1)을 사용하여 FA 프로파일 형질에 대한 양적형질좌위(QTL)를 확인하기 위해 SNPchip 기반 GWAS(genome-wide association study)가 수행되었다.Single marker association analysis was performed using SNPchip to identify quantitative trait loci (QTL) for FA profile traits using the genome-wide efficient mixed model association (GEMMA) program (ver. 0.94.1). A genome-wide association study (GWAS) was performed.
GWAS의 다중 비교 문제를 해결하기 위해 LK 코호트에 대해 Bonferroni 조정 유의 임계 값 (i.e., 0.01/39,485 SNP markers, p = 2.53 x 10-7)을 계산하였고, 유의성 역치를 기준으로 GWAS는 염색체별로 염색체를 수행하였다. 이러한 QTL 영역의 신뢰 구간은 상위 SNP 부근에서 유의성 임계 값 (p = 2.53 x 10-7)보다 낮은 명목 p-value를 갖는 두 개의 SNP (상한 경계 및 하한 경계)를 사용하여 결정되었다.To solve the multiple comparison problem of GWAS, a Bonferroni-adjusted significance threshold (ie, 0.01/39,485 SNP markers, p = 2.53 x 10 -7 ) was calculated for the LK cohort, and based on the significance threshold, GWAS classified chromosome by chromosome performed. Confidence intervals for these QTL regions were determined using two SNPs (upper and lower bounds) with nominal p-values lower than the significance threshold (p = 2.53 × 10 −7 ) in the vicinity of the upper SNPs.
5. 지방산조성 종류 별 초미세지도 작성을 위한 LALD(Joint Linkage and Linkage Disequilibrium) 분석5. LALD (Joint Linkage and Linkage Disequilibrium) Analysis for Ultrafine Map Creation by Fatty Acid Composition Type
GWAS에 의해 검출 된 유의성 높은 QTL영역내에서 초미세지도 작성을 위하여 LALD(Joint Linkage and Linkage Disequilibrium) 분석을 수행하였다.LALD (Joint Linkage and Linkage Disequilibrium) analysis was performed to create a hyperfine map within the highly significant QTL region detected by GWAS.
먼저, CRIMAP 프로그램 (ver. 2.503)을 사용하여 GWAS에 의해 추출된 유의성 높은 QTL영역을 확보하였다.First, a highly significant QTL region extracted by GWAS was secured using the CRIMAP program (ver. 2.503).
다음으로, 부모 돼지(즉, Landrace 및 KNP)에서 발견된 설립자 일배체형은 가족 수준에서 얻은 LA정보와 인구 수준에서 얻은 LD 정보를 Hidden MarkovModel 프레임 워크에 통합하는 DualPHASE 프로그램(ver. 1.1)을 사용하여 재구성되었고, 총 20 개의 설립자 일배체형 클러스터 (K = 20)가 사용되었다.Next, the founder haplotypes found in the parental pigs (i.e., Landrace and KNP) were analyzed using the DualPHASE program (ver. 1.1), which integrates LA information obtained at the family level and LD information obtained at the population level into the Hidden MarkovModel framework. Reconstructed, and a total of 20 founder haplotype clusters (K = 20) were used.
마지막으로, 추정된 일배체형을 고정(예 : 성별, 배치 및 도체 무게) 및 랜덤 효과(즉, 창립자 일 배체 유형 및 동물 효과의 20 가지 효과)와 랜덤 잔여 오차 항을 포함하는 혼합 모델에 통합하여 QxPAK 프로그램(ver. 5.05)이 지방산 형질에 대한 초미세지도 작성에 활용되었으며, 초미세지도상의 QTL 신뢰구간은 1-LOD 드롭 방법으로 설정되었다.Finally, by incorporating the estimated haplotype into a mixed model containing fixed (e.g., sex, batch, and carcass weight) and random effects (i.e., founder haplotype and 20 effects of animal effects) and random residual error terms, The QxPAK program (ver. 5.05) was used to create hyperfine maps for fatty acid traits, and the QTL confidence intervals on the hyperfine maps were set by the 1-LOD drop method.
6. 지방산조성 후보유전자 분석6. Analysis of candidate genes for fatty acid composition
각 QTL의 유전자 목록은 Sus scrofa 11.1 어셈블리 (NCBI 액세스 ID : NC_010454.4)를 기반으로 NCBI 데이터베이스 릴리스 85에서 추출되었고, 각 QTL 영역의 유전자 목록은 NCBI 데이터베이스에서 얻었다. QTL 위치의 비교 분석은 Animal QTLdb를 사용하여 수행되었다.The gene list of each QTL was extracted from the NCBI database release 85 based on the Sus scrofa 11.1 assembly (NCBI access ID: NC_010454.4), and the gene list of each QTL region was obtained from the NCBI database. Comparative analysis of QTL locations was performed using Animal QTLdb.
실시 예 1 : 돼지의 지방산(Palmitic acid, C16:0) 관련 GWAS 분석 결과Example 1: Pig fatty acid (Palmitic acid, C16: 0) related GWAS analysis results
도 2는 GWAS(genome wide association study)분석을 통해 돼지의 지방산(Palmitic acid, C16:0)의 함량을 조절하는 핵심유전자의 염색체상에서 유전자좌위를 확인한 것이다.Figure 2 confirms the genetic locus on the chromosome of a key gene controlling the content of fatty acids (palmitic acid, C16: 0) in pigs through genome wide association study (GWAS) analysis.
도 2를 통해, 돼지의 지방산(Palmitic acid, C16:0)의 함량과 연관된 양적형질위치(Quantitative trait locus, QTL)는 돼지의 12번 염색체(SSC 12)에 있음을 확인하였다.2, it was confirmed that the quantitative trait locus (QTL) associated with the content of palmitic acid (C16:0) in pigs was located on chromosome 12 (SSC 12) of pigs.
실시 예 2 : 돼지의 지방산(Palmitic acid, C16:0) 연관 QTL 지역 분석Example 2: Porcine fatty acid (Palmitic acid, C16: 0) related QTL region analysis
돼지의 12번 염색체 중 구체적인 QTL 영역을 확인하기 위하여, 연관 분석 (linkage analysis)을 수행하였다. In order to identify a specific QTL region in
도 3은 연관 분석을 통해 돼지의 지방산(Palmitic acid, C16:0)에 대한 12번 염색체의 주요 QTL 영역을 분석한 것이다.3 shows analysis of the main QTL region of
도 3에서 확인할 수 있듯이, QTL은 M1GA0017062를 포함하는 지역에 존재하고 있음을 확인하였다.As can be seen in Figure 3, it was confirmed that the QTL is present in the region including M1GA0017062.
실시 예 3: 돼지의 지방산(Palmitic acid, C16:0) 함량 연관 SNP를 포함하는 염기서열 추출 및 분석 Example 3: Extraction and analysis of nucleotide sequences including SNPs related to fatty acid (Palmitic acid, C16:0) content in pigs
상기 실시 예 2를 통해 12번 염색체에 위치한 M1GA0017062 SNP가 돼지의 지방산(Palmitic acid, C16:0) 함량과 관련하여 유의성이 가장 높음을 확인하였다. 이에 상기 M1GA0017062를 포함하는 GAS7 유전자의 서열(서열번호 1)을 확보한 다음, 이들의 염기서열을 분석하였고, 1001번 염기서열에 따른 유전자형 (TT, TC, CC)을 확인하였다(도 3).Through Example 2, it was confirmed that the M1GA0017062 SNP located on
도 4는 12번 염색체의 서열번호 1의 염기서열로 구성된 M1GA0017062 폴리뉴클레오티드에 포함된 1001번째 염기 변이에 따른 유전자형을 확인한 결과를 나타내는 그래프이다. 도 4에서 보듯이, 유전자형은 CC, CT 또는 TT로 구분됨을 확인하였다.4 is a graph showing the results of confirming the genotype according to the 1001st base mutation included in the M1GA0017062 polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 of
또한, 유전자형이 CC인 경우 돼지의 지방산(Palmitic acid, C16:0)의 함량이 상대적으로 가장 높은 수준을 나타내었고, 유전자형이 TT인 경우 돼지의 지방산(Palmitic acid, C16:0)의 함량이 상대적으로 가장 낮은 수준을 나타내었으며, 유전자형이 CT인 경우 중간 값을 나타내었다.In addition, when the genotype was CC, the content of fatty acid (Palmitic acid, C16:0) in pigs was relatively the highest, and when the genotype was TT, the content of fatty acid (Palmitic acid, C16:0) was relatively high. showed the lowest level, and the middle value was shown when the genotype was CT.
이상으로 본 발명의 바람직한 실시 예를 상세하게 설명하였다. 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다.In the above, preferred embodiments of the present invention have been described in detail. The description of the present invention is for illustrative purposes, and those skilled in the art will understand that other specific forms can be easily modified without changing the technical spirit or essential features of the present invention.
따라서, 본 발명의 범위는 상세한 설명보다는 후술하는 특허청구범위에 의하여 나타내어지며, 특허청구범위의 의미, 범위 및 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.Therefore, the scope of the present invention is indicated by the following claims rather than the detailed description, and all changes or modifications derived from the meaning, scope and equivalent concepts of the claims are interpreted as being included in the scope of the present invention. It should be.
<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof <130> DP20210109 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 2001 <212> DNA <213> Artificial Sequence <220> <223> GAS7 <400> 1 cctacattgc cgtgagttgt ggtgtaggtc gcagacgcag ctcggatccc gcgttgctct 60 ggctctggca taggctggca gctgtagctc caattcgacc cctagcctgg gaacctccat 120 atgccgtagg tgcggcccta gaaaagaaaa aaagaagaga agcaggacag ggagaggacc 180 agttcacatg acacctgctc tctggggtgt cctgtcctgt agcccaaaga gcctggctct 240 ccaggaccca ggggcctcac tttgaggttc agcactgacc tgtccacctg ggccttccac 300 aaccccaacc catactccgt gacaaggcca ttcacgcctt ctcgaagaaa aactgcttaa 360 gccaggggcc cacatcccag caaggtgggc ctgattcccc agggcaagct ctcatctctt 420 tatcctcttc agttcagcca gccgtccaac cagccatcca agagttaccc agccaggcct 480 catggaagcc gagggccggg cagggccatc ccagagattt cctgccctgg aggggctcag 540 ggtgcagggg gagagggtca cacgagtcac caccggccag ggctatcgcg gggggcagcc 600 ctgtgcaagc caggggagaa ggagcaaccg gcctggggag cgaccgaagg gcacaggtgg 660 gctgggtctg ggggaggcaa gagggggagg gaccccagag agaggggcgg gtgtgcagag 720 gcacggggtg cggaggtgtg tgtacccgga gagggcaact gaggaggctg gggcgggtgg 780 ggaaggtggt ctgtgaaggc ccctgtcccc cagcaaggag cagcccgact ctcgggacag 840 tggggagcca gtggagatgg ctccatagga ctcaggttgt aggaggacac cgtggagggc 900 cacgcgaggc taggaagtgt gggactccag ccccaagcct ggggtccctg gctcagctgg 960 aacacaggga tattgactag gaagccagtt aacaggaaac ttgccactcc ctgggagacg 1020 tcagccactt tccaaccacc tccctccagc cttccccctt ggggtccagc cctccagaaa 1080 caacagaccg tcctcctccc ccctccccca caagccagga gaaggccaag ggcacgggac 1140 tctgcgagga tggatcacgc cagcggcagg tctgcgccgg atccctctcc accctgcccg 1200 cctctcacgc cggccctcat ttgcaggaga cgtgccgctg tagctgagtg tatatatcgt 1260 ctggatgatt tgccgtggag catcatttac accttctgct gctcctccga gaaaatcatt 1320 tctccaagac taataataaa acagaccagc cacctagagt aacaaagcac tgcaaccagc 1380 ccctggcacg caattcagaa acacaccaga acagctgcac gtggcatgcc ccagagcaga 1440 gaggagcggc agcgtgtagc ggactgggat tctggacttt gcaaacagtg tcacctagag 1500 caccacggct tcctggagga gtccccagag cgggtatgca gccagaagag cagtgcctgg 1560 gtcagacccc aaggagcacc cgtgaagcca ggtctgggag ccctggagac ttgaggctgg 1620 atctggttcc cctgtctgca tttgcacatc agcacagctg ccttcatgga ctggggacac 1680 aggggcaaag ggcaaagggc tcaggcctgc ctggctccac aaaccccctg gagtgcccag 1740 tcaagctctg gccaagccat tccccacatc tccctcactg gcagggcctc caacccgctc 1800 agaatgactc cacagtggac tctgcacagc tgaggaagag gcctggctac cttctcccag 1860 gtgagacaga ggacacccgt ctgaaattct caacatcaac agcatcactg cagccacaca 1920 cccccacggg gctccttaag ggcacctaga gatcaggtct tatacccaca gacggctcac 1980 tgtcgctctg accccaaatt c 2001 <110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> SNP marker for determining the content of fatty acid (Palmitic acid, C16:0) in pigs and its uses <130> DP20210109 <160> 1 <170> KoPatentIn 3.0 <210> 1 <211> 2001 <212> DNA <213> artificial sequence <220> <223> GAS7 <400> 1 cctacattgc cgtgagttgt ggtgtaggtc gcagacgcag ctcggatccc gcgttgctct 60 ggctctggca taggctggca gctgtagctc caattcgacc cctagcctgg gaacctccat 120 atgccgtagg tgcggcccta gaaaagaaaa aaagaagaga agcaggacag ggagaggacc 180 agttcacatg acacctgctc tctggggtgt cctgtcctgt agcccaaaga gcctggctct 240 ccaggaccca ggggcctcac tttgaggttc agcactgacc tgtccacctg ggccttccac 300 aaccccaacc catactccgt gacaaggcca ttcacgcctt ctcgaagaaa aactgcttaa 360 gccaggggcc cacatcccag caaggtggggc ctgattcccc agggcaagct ctcatctctt 420 tatcctcttc agttcagcca gccgtccaac cagccatcca agagttaccc agccaggcct 480 catggaagcc gagggccggg cagggccatc ccagagattt cctgccctgg aggggctcag 540 ggtgcagggg gagagggtca cacgagtcac caccggccag ggctatcgcg gggggcagcc 600 ctgtgcaagc caggggagaa ggagcaaccg gcctggggag cgaccgaagg gcacaggtgg 660 gctgggtctg ggggaggcaa gagggggagg gaccccagag agaggggcgg gtgtgcagag 720 gcacggggtg cggaggtgtg tgtacccgga gagggcaact gaggaggctg gggcgggtgg 780 ggaaggtggt ctgtgaaggc ccctgtcccc cagcaaggag cagcccgact ctcggggacag 840 tggggagcca gtggagatgg ctccatagga ctcaggttgt aggagggacac cgtggagggc 900 cacgcgaggc taggaagtgt gggactccag ccccaagcct ggggtccctg gctcagctgg 960 aacacaggga tattgactag gaagccagtt aacaggaaac ttgccactcc ctgggagacg 1020 tcagccactt tccaaccacc tccctccagc cttccccctt ggggtccagc cctccagaaa 1080 caacagaccg tcctcctccc ccctccccca caagccagga gaaggccaag ggcacgggac 1140 tctgcgagga tggatcacgc cagcggcagg tctgcgccgg atccctctcc accctgcccg 1200 cctctcacgc cggccctcat ttgcaggaga cgtgccgctg tagctgagtg tatatatcgt 1260 ctggatgatt tgccgtggag catcatttac accttctgct gctcctccga gaaaatcatt 1320 tctccaagac taataataaa acagaccagc cacctagagt aacaaagcac tgcaaccagc 1380 ccctggcacg caattcagaa acacaccaga acagctgcac gtggcatgcc ccagagcaga 1440 gaggagcggc agcgtgtagc ggactgggat tctggacttt gcaaacagtg tcacctagag 1500 caccacggct tcctggagga gtccccagag cgggtatgca gccagaagag cagtgcctgg 1560 gtcagacccc aaggagcacc cgtgaagcca ggtctggggag ccctggagac ttgaggctgg 1620 atctggttcc cctgtctgca tttgcacatc agcacagctg ccttcatgga ctggggacac 1680 aggggcaaag ggcaaagggc tcaggcctgc ctggctccac aaaccccctg gagtgcccag 1740 tcaagctctg gccaagccat tccccacatc tccctcactg gcagggcctc caacccgctc 1800 agaatgactc cacagtggac tctgcacagc tgaggaagag gcctggctac cttctcccag 1860 gtgagacaga ggacacccgt ctgaaattct cacacatcaac agcatcactg cagccacaca 1920 cccccacggg gctccttaag ggcacctaga gatcaggtct tatacccaca gacggctcac 1980 tgtcgctctg accccaatt c 2001
Claims (6)
The 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, and a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base or a porcine fatty acid comprising a nucleotide complementary thereto (Palmitic acid, C16:0) SNP (Single Nucleotide Polymorphism) marker composition for determination of content.
상기 SNP 마커는 서열번호 1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 조성물.
A composition for determining the content of palmitic acid (C16: 0) in pigs, including an agent capable of detecting or amplifying a SNP marker for determining the content of palmitic acid (C16: 0) in pigs,
The SNP marker includes a polynucleotide consisting of 5 to 1000 consecutive bases in which the 1001st base of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T or C, or a nucleotide complementary thereto, including the 1001st base. A composition for determining the content of fatty acids (Palmitic acid, C16: 0) in pigs.
상기 제제는 상기 SNP 마커를 검출 또는 증폭할 수 있는 프라이머 또는 프로브인 것을 특징으로 하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별용 조성물.
According to claim 2,
The preparation is a composition for determining the content of fatty acid (Palmitic acid, C16: 0) in pigs, characterized in that the primer or probe capable of detecting or amplifying the SNP marker.
A kit for determining a pig's fatty acid (Palmitic acid, C16:0) content, comprising the composition of claim 2.
(b) 상기 (a) 단계에서 증폭 또는 검출된 다형성 부위의 염기를 결정하는 단계를 포함하며,
상기 (a) 단계의 SNP 마커는 서열번호1의 염기서열로 구성되는 폴리뉴클레오티드의 1001번째 염기가 T 또는 C이고, 상기 1001번째 염기를 포함하는 5 내지 1000개의 연속적인 염기로 구성된 폴리뉴클레오티드 또는 이에 상보적인 뉴클레오티드를 포함하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별 방법.
(a) amplifying or detecting a polymorphic site of a SNP marker for determining a pig's fatty acid (Palmitic acid, C16:0) content from DNA of a sample isolated from the subject; and
(b) determining the base of the polymorphic site amplified or detected in step (a);
The SNP marker in step (a) is a polynucleotide consisting of 5 to 1000 consecutive bases including the 1001st base in which the 1001st base of the polynucleotide composed of the nucleotide sequence of SEQ ID NO: 1 is T or C, or A method for determining the content of palmitic acid (C16:0) in pigs containing complementary nucleotides.
상기 개체는 제주재래돼지, 랜드레이스 또는 제주재래돼지와 랜드레이스의 교잡종인 것을 특징으로 하는 돼지의 지방산(Palmitic acid, C16:0) 함량 판별 방법.According to claim 5,
The method of determining the fatty acid (Palmitic acid, C16: 0) content of pigs, characterized in that the subject is Jeju native pig, Landrace or a hybrid of Jeju native pig and Landrace.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210122666A KR20230039395A (en) | 2021-09-14 | 2021-09-14 | SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020210122666A KR20230039395A (en) | 2021-09-14 | 2021-09-14 | SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
KR20230039395A true KR20230039395A (en) | 2023-03-21 |
Family
ID=85800962
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020210122666A KR20230039395A (en) | 2021-09-14 | 2021-09-14 | SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR20230039395A (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101823368B1 (en) | 2015-11-13 | 2018-03-14 | 대한민국 | SNP marker regulating polyunsaturated fatty acid level in the pork and uses thereof |
-
2021
- 2021-09-14 KR KR1020210122666A patent/KR20230039395A/en unknown
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101823368B1 (en) | 2015-11-13 | 2018-03-14 | 대한민국 | SNP marker regulating polyunsaturated fatty acid level in the pork and uses thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101432164B1 (en) | Novel haplotype marker for discriminating level of meat quality of Pig and use thereof | |
KR101677517B1 (en) | Novel SNP marker for discriminating level of meat quality and Black Coat Color of pig and use thereof | |
KR101418402B1 (en) | Novel SNP marker for discriminating level of loinmuscle area of Pig and use thereof | |
KR101450792B1 (en) | Novel SNP marker for discriminating Black Coat Colour of Pig and use thereof | |
KR101312480B1 (en) | Novel snp marker for discriminating number of rib of pig and use thereof | |
KR101784163B1 (en) | Novel SNP marker for discriminating reduction of backfat thickness and use thereof | |
KR102645735B1 (en) | SNP marker for determining the content of fatty acid(Arachidonic acid, C20:4) in pigs and its uses thereof | |
KR102682930B1 (en) | SNP marker for determining the content of polyunsaturated fatty acid in pigs and its uses thereof | |
KR102645733B1 (en) | SNP marker for determining the content of fatty acid(Oleic acid, C18:1) in pigs and its uses thereof | |
KR102645734B1 (en) | SNP marker for determining the content of fatty acid(Linoleic acid, C18:2) in pigs and its uses thereof | |
KR20230039395A (en) | SNP marker for determining the content of fatty acid(Palmitic acid, C16:0) in pigs and its uses thereof | |
KR102645736B1 (en) | SNP markers for determining the proportion of polyunsaturated fatty acids and saturated fatty acids in pigs and its uses thereof | |
KR20230039412A (en) | SNP marker for determining the content of fatty acid(Margaric acid, C17:0) in pigs and its uses thereof | |
KR20230039433A (en) | SNP marker for determining the content of fatty acid(Eicosenoic acid, C20:1) in pigs and its uses thereof | |
KR20230039447A (en) | SNP marker for determining the content of fatty acid(Margaroleic acid, C17:1) in pigs and its uses thereof | |
KR20230040834A (en) | SNP marker for determining the content of fatty acid(lauric acid, C12:0) in pigs and its uses thereof | |
KR20230039432A (en) | SNP marker for determining the content of fatty acid(arachidic acid, C20:0) in pigs and its uses thereof | |
KR20230040831A (en) | SNP marker for determining the content of saturated fatty acid in pigs and its uses thereof | |
KR20230040830A (en) | SNP marker for determining the content of monounsaturated fatty acid in pigs and its uses thereof | |
KR20230040832A (en) | SNP marker for determining the content of unsaturated fatty acid in pigs and its uses thereof | |
KR101928887B1 (en) | Single nucleotide polymorphism markers for determining Jeju black cattle and the uses thereof | |
KR20230040833A (en) | SNP markers for determining the proportion of monounsaturated fatty acids and saturated fatty acids in pigs and its uses thereof | |
KR20230039430A (en) | SNP marker for determining the content of fatty acid(α-linolenic acid, C18:3) in pigs and its uses thereof | |
KR20230027375A (en) | SNP marker for determining the content of polyunsaturated fatty acid in pigs and its uses thereof | |
KR101985659B1 (en) | Method for identification of Baekwoo breed using single nucleotide polymorphism markers |