CN109609618B - Kit for detecting pathological myopia and use method and application thereof - Google Patents

Kit for detecting pathological myopia and use method and application thereof Download PDF

Info

Publication number
CN109609618B
CN109609618B CN201910016654.6A CN201910016654A CN109609618B CN 109609618 B CN109609618 B CN 109609618B CN 201910016654 A CN201910016654 A CN 201910016654A CN 109609618 B CN109609618 B CN 109609618B
Authority
CN
China
Prior art keywords
ser
pro
gly
glu
arg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201910016654.6A
Other languages
Chinese (zh)
Other versions
CN109609618A (en
Inventor
于常红
周宇
梁涛
张心华
纪静
常文光
朱元镇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao University
Original Assignee
Qingdao University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao University filed Critical Qingdao University
Priority to CN201910016654.6A priority Critical patent/CN109609618B/en
Publication of CN109609618A publication Critical patent/CN109609618A/en
Application granted granted Critical
Publication of CN109609618B publication Critical patent/CN109609618B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Abstract

The invention provides a kit for detecting pathological myopia and a use method and application thereof. The invention comprises reagents for amplifying a gene fragment at the c.3385 locus of the 3 rd exon of the KIAA1462 gene; the reagent comprises a primer pair, wherein the sequence of a sense primer of the primer pair is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA are provided. The kit provided by the invention has the advantages of high sensitivity and strong specificity, can be used for determining whether the mutation site is mutated or not by only a small amount of DNA samples, can be used for obtaining whether the result of the pathological myopia of the type is obtained by only detecting one gene site, is convenient to use and simple to operate, achieves the purpose of early screening, is beneficial to development of new drugs, and has good market application prospect.

Description

Kit for detecting pathological myopia and use method and application thereof
Technical Field
The invention relates to the technical field of medical kits, in particular to a kit for detecting pathological myopia and a use method and application thereof.
Background
Pathological Myopia (PM) refers to ametropia with diopter less than or equal to-6.0D, with lengthening of the axis of the eye, retinal choroidal degeneration. Besides vision loss, complications such as cataract, amblyopia, macular degeneration, retinal detachment and the like are also frequently accompanied, and are important causes of blindness. Data show that the incidence of myopia is dramatically increased in recent years, and 80-90% of students suffer from myopia at present, wherein 10-20% of the students are high myopia. The incidence of pathological myopia in the general population is l%, which has become an important cause of blindness. It is expected that by the year 2020, the number of myopes will reach 25 billion, and this disease has become an increasingly serious global public health problem.
The pathogenesis of myopia is complex and cannot be elucidated so far. The genetic effect is confirmed through a large number of research results, and environmental factors play a role in regulating modification. Under the background, the research is selected from the genetic genetics to search the causes of the diseases, and the research is of great significance to the prevention and treatment of the diseases. The genetic patterns of pathological myopia exhibit a high degree of heterogeneity, with different genetic patterns involved in the development of the disease. A large number of myopia pathogenic/susceptible gene regions are discovered by methods such as genome scanning linkage, relevance analysis and sequencing, the discovery of the large number of disease linkage regions provides clues for future gene cloning, and myopia loci of Chinese population are increased from 2 to 10.
The treatment of high myopia is not optimistic. Optical corrective lenses help increase vision but do not effectively control myopia progression; the lengthening of the ocular axis and the laser treatment of the vitreous body operation can be controlled by the operation, the pathological change process can be only delayed, certain risks and injuries are accompanied, and the long-term effect is to be examined. Therefore, early diagnosis to detect early intervention and delay the progression of the disease are very important for preserving the vision of the patient.
Disclosure of Invention
The kit is high in sensitivity and strong in specificity, can determine whether mutation sites are mutated or not by only needing a small amount of DNA samples, achieves the aim of early screening, is beneficial to development of new drugs, and has good market application prospect.
The invention relates to a kit for detecting pathological myopia, which adopts the technical scheme that: the kit comprises a nucleic acid for amplificationKIAA1462Exo 3 of gene(ii) an agent for the gene fragment at the c.3385 locus of a daughter; the reagent comprises a primer pair, and the sequence of a sense primer of the primer pair is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA are provided.
The kit of the invention is used for detecting the pathological myopia related diseasesKIAA1462The kit for gene variation comprises a primer pair, wherein a DNA sample is subjected to PCR amplification through the primer pair, and then the amplified product is sequenced, so that the kit for gene variation is obtainedKIAA1462Whether the c.3385 site of the exon 3 of the gene is mutated or not is judged to be the pathological myopia of the type. The invention determinesKIAA1462The gene mutation is a pathogenic gene of pathological high myopia, and if the gene mutation is amplified and sequenced by using the kit of the invention KIAA1462The pathological myopia is determined if the T mutation of the c.3385 base of the 3 rd exon of the gene is C; the mutant sequence information is: ACA AT/CA GAA (-T-I/T-E-) isoleucine is mutated to threonine.KIAA1462 c.3385 T>The C mutation is directly related to the pathogenesis of the pathological myopia, and whether the mutation can be used for carrying out early gene diagnosis and typing evaluation on the pathological myopia is detected. The kit for detecting the mutant site sequence has high sensitivity and strong specificity, can be used for determining whether the mutant site is mutated or not by only needing a small amount of DNA samples, can obtain whether the result is the pathological myopia or not by only detecting one gene site, achieves the aim of early screening, is favorable for developing new medicaments, and has good market application prospect.
In a preferred embodiment, the reagent further comprises a Buffer solution, a mixed solution, a magnesium chloride solution, Taq enzyme with a concentration of 1U/. mu.L, DNA template with a concentration of 30 ng/. mu.L and secondary distilled water, wherein the Buffer solution is PCR Buffer, and the mixed solution is dNTP mix. The kit of the invention is also provided with PCR Buffer solution, dNTP mixture, magnesium chloride solution, Taq enzyme, DNA template and secondary distilled water, and the content of each reagent in the 25 mu L kit is generally as follows: taking 5 mu L of 10 multiplied PCR Buffer 1; each component in dNTP mix is 2mL, and 5 mu L is taken; taking 4 mu L of 2.5mL magnesium chloride solution; taking 2 mu L of Taq enzyme; mu.L of sense primer is 2 mu.L, and 2 mu.L of antisense primer is 10 mu.L; taking 5 mu L of DNA template; make up to 25. mu.L of redistilled water. These PCR Buffer, dNTP mix, magnesium chloride solution, Taq enzyme, DNA template and double distilled water are preferably a PCRmix kit from Tiangen corporation.
The invention relates to a use method of a kit for detecting pathological myopia, which adopts the technical scheme that: the method comprises the following steps: 1) taking the kit, and carrying out PCR amplification on a DNA sample by adopting a sense primer and an antisense primer to obtain a PCR product; 2) taking the PCR product obtained in the step 1), adding a PCR purification reagent, and carrying out purification reaction under the conditions of: keeping the temperature at 37 ℃, 20min, 75 ℃, 15min and 12 ℃ to obtain a purified product; 3) and (3) taking the purified product obtained in the step 2) as a template, performing sequencing treatment and sequencing.
In the using process of the kit, a sense primer and an antisense primer are firstly adopted to carry out PCR amplification on a DNA sample, the DNA sample is purified and then subjected to sequencing treatment, and the treated product is subjected to sequencing analysis to obtain the kitKIAA1462Whether the c.3385 site of the exon 3 of the gene is mutated or not is judged, so that whether the myopia is pathological or not is judged. The kit is convenient to use and simple to operate, can be used for determining whether the mutation site is mutated or not by only a small amount of DNA samples, can obtain the result of pathological myopia or not by only detecting one gene site, has high sensitivity and strong specificity, achieves the aim of early screening, is beneficial to development of new drugs, and has good market application prospect.
The biological sample from which the DNA sample of the present invention is derived is a human body fluid or tissue, including but not limited to blood, amniotic fluid, various tissues, etc.; extracting purified DNA from the sample, performing polymerase chain amplification reaction to obtain product, performing sequencing reaction on the product with primer pair, and searching whether the sample contains DNAKIAA1462Mutation of the gene. Usually, the DNA sample is genomic DNA derived from peripheral blood, dissolved in TE, and stored at a concentration of usually 30 ng/. mu.L in a freezer at-20 ℃.
As a preferred embodiment, in the step 1), the PCR amplification conditions are: 95 ℃ for 5 min; 35 cycles of 95 ℃, 30s, 65 ℃, 45s, 72 ℃, 45 s; 72 ℃ for 10 min; and keeping the temperature at 4 ℃. The PCR amplification condition of the invention is the existing conventional operation condition, the operation is convenient, the control is easy, the amplification effect is good, and the control is easy.
In a preferred embodiment, in step 2), the PCR purification reagent is ExoSAP-IT purification reagent, and the ratio of the addition volume of the purification reagent to the volume of the PCR product is 1: 5. The invention adopts a Sanger sequencing method, and preferably uses ExoSAP-IT purification reagent of USB company, namely US PCR purification reagent, so as to improve the purification effect.
The invention relates to an application of a kit for detecting pathological myopia, which adopts the technical scheme that: the kit is used for detecting pathological myopia diseases. The kit can be used for detecting pathological myopia diseases, has high sensitivity, strong specificity, convenient use and simple operation, achieves the aim of early screening, is beneficial to the development of new drugs and has good market application prospect.
Compared with the prior art, the invention has the beneficial effects that: the kit of the invention is used for detecting the pathological myopia related diseasesKIAA1462The kit for gene variation comprises an amplification primer pair, and DNA samples are subjected to PCR amplification and then sequencing through the primer pair, so as to obtain the kitKIAA1462Whether the c.3385 site of the exon 3 of the gene is mutated or not is judged to be the pathological myopia of the type. The kit for detecting the mutant site sequence has high sensitivity and strong specificity, can be used for determining whether the mutant site has variation only by a small amount of DNA samples, can obtain the result of pathological myopia only by detecting one gene site, is convenient to use and simple to operate, achieves the aim of early screening, is beneficial to development of new drugs, and has good market application prospect.
Drawings
FIG. 1 is a diagram of five generations of pathological myopia families according to the present invention;
FIG. 2 is a diagram showing a base sequence of a normal human of the present invention;
FIG. 3 is a base mutation sequence map of patient one of the present invention;
FIG. 4 is a base mutation sequence map of patient two according to the present invention;
FIG. 5 is a base mutation sequence map of patient III of the present invention;
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
The kit for detecting the pathological myopia comprises a kit for amplifyingKIAA1462An agent for a gene fragment at the c.3385 locus of exon 3 of a gene; the reagent comprises a primer pair, and the sequence of a sense primer of the primer pair is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA are provided.
Preferably, the reagent further comprises a Buffer solution, a mixed solution, a magnesium chloride solution, Taq enzyme with the concentration of 1U/muL, DNA template with the concentration of 30 ng/muL and secondary distilled water, wherein the Buffer solution is PCR Buffer, and the mixed solution is dNTP mix.
The invention relates to a use method of a kit for detecting pathological myopia, which comprises the following steps:
1) taking the kit, and carrying out PCR amplification on a DNA sample by adopting a sense primer and an antisense primer to obtain a PCR product;
2) taking the PCR product obtained in the step 1), adding a PCR purification reagent, and carrying out purification reaction under the conditions of: keeping the temperature at 37 ℃, 20min, 75 ℃, 15min and 12 ℃ to obtain a purified product;
3) and (3) taking the purified product obtained in the step 2) as a template, performing sequencing treatment and sequencing.
Preferably, in the step 1), the conditions for PCR amplification are: 95 ℃ for 5 min; 35 cycles of 95 ℃, 30s, 65 ℃, 45s, 72 ℃, 45 s; 72 ℃ for 10 min; and keeping the temperature at 4 ℃.
Further, in the step 2), the PCR purification reagent is ExoSAP-IT purification reagent, and the ratio of the addition volume of the purification reagent to the volume of the PCR product is 1: 5.
The invention relates to an application of a kit for detecting pathological myopia, which is used for detecting pathological myopia diseases.
Example one
KIAA1462Detection of Gene mutations
An autosomal dominant 5 generation pedigree, strictly following diagnostic criteria: the degree of myopia is less than or equal to-6.0D; characteristic ocular fundus changes include papillary arcus macula, leopard striatus ocular fundus, macular degeneration, posterior scleral staphyloma, and the like; age of onset before primary school; fourthly, the degree of myopia is progressively deepened; correcting vision to be less than 0.9; sixthly, excluding non-axial pathological myopia: such as keratoconus, spherical crystals, etc.; seventhly, the general syndrome is not accompanied; only one eye is needed to diagnose the pathological myopia, and the patient with the pathological myopia can be diagnosed; wherein, the second is the necessary condition. Pedigree survey collection was performed after phenotype was determined. Pedigrees were generated using Cyrillic software.
Collecting peripheral blood of at least three patients and one normal direct relative in a family, extracting genome DNA, preparing a cluster computer by using an Agilent Human All Exon set capturing chip for data processing, then, discovering that All variation numbers of the three patients are about 2-5 thousand through biological information analysis, filtering by using a public database, and removing normal controls side by side to obtain mutation numbers of 11 indels and 3 SNP. Finally, performing conventional PCR amplification and Sanger sequencing on all members in the family including patients and normal relatives, detecting 14 variable regions, performing co-segregation verification, and finding that all patients carry a unique co-segregation site, namely exon3 located in chr.10p11.23,KIAA1462 c.3385T>C。
the invention aims at an autosomal dominant inheritance pathologic myopia large body line in Shandong area as shown in figure 1, and basically excludes pathogenic chromosomeCan be used. Through the screening of the known myopia pathogenic genes ZNF644, CCDC111, SLC39A5, P4HA2, ARR3 and the like, no mutation site is found, and the result indicates that the family is possible to be a new pathogenic gene mutation. Then uses exon sequencing technology to search pathogenic gene and finds out KIAA1462c.3385T>C, base mutation occurs, the phenotype of all patients in the family is in cosegregation, and then the mutation is not found in the gene by sequencing normal members in the family and 200 normal controls, thereby determiningKIAA1462The gene mutation is the pathogenic gene of the pathological high myopia.
Example two
The invention relates to a kit for detecting pathological myopia, which comprises a kit for amplifyingKIAA1462An agent for a gene fragment at the c.3385 locus of exon 3 of a gene; the reagent comprises a primer pair, wherein the sequence of a sense primer of the primer pair is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA are provided. The reagent also comprises Buffer solution, mixed solution, magnesium chloride solution, Taq enzyme with the concentration of 1U/mu L, DNA template with the concentration of 30 ng/mu L and secondary distilled water, wherein the Buffer solution is PCR Buffer, and the mixed solution is dNTP mix. Wherein, the components and the dosage in the reagent are shown in the table 1.
TABLE 1 composition of reagents
Serial number Components Dosage of
1 10×PCR Buffer 5μL
2 dNTP mix 2mL each 5μL
3 2.5mL MgCl2 4μL
4 Taq enzyme 1U/. mu.L 2μL
5 Sense primer 10. mu.L 2μL
6 Antisense primer 10. mu.L 2μL
7 DNA template 30 ng/. mu.L 5μL
8 ddH2O Make up to 25. mu.L
EXAMPLE III
The invention relates to a use method of a kit for detecting pathological myopia, which comprises the following steps:
1) Extracting genome DNA: peripheral Blood genomic DNA was extracted using QIAamp DNA Blood Mini Kit (QIAGEN Co.); dissolving the obtained DNA in TE for storage, correcting the working concentration of the DNA to 30 ng/mu L, and storing in a refrigerator at the temperature of-20 ℃;
2) and (3) PCR amplification: the composition of the kit and a 25. mu.L PCR reaction system is shown in Table 1, and the sequence of the sense primer is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA, respectively; the conditions for PCR amplification were: 95 ℃ for 5 min; 35 cycles of 95 ℃, 30s, 65 ℃, 45s, 72 ℃, 45 s; 72 ℃ for 10 min; preserving the temperature at 4 ℃ to obtain a PCR product;
3) and (3) PCR product purification: taking 5 mu L of PCR product obtained in the step 2), adding 1 mu L of ExoSAP-IT (US PCR purification reagent) of USB company, and carrying out purification reaction under the conditions of: keeping the temperature at 37 ℃, 20min, 75 ℃, 15min and 12 ℃ to obtain a purified product;
4) sequencing by Sanger: taking a kit for sequencing, taking the purified product obtained in the step 3) as a template, and carrying out sequencing reaction by adopting a DNA fragment sequencing kit of ABI company under the sequencing reaction conditions: 35 cycles of 95 ℃, 20s, 55 ℃, 10s, 60 ℃, 5 min; preserving the temperature at 10 ℃ to obtain a sequencing product;
5) And (3) purifying a sequencing product: adding the sequencing product obtained in the step 4) into 25 muL of ethanol with the volume concentration of 75%, keeping the mixture away from light, standing for 15min, centrifuging at 3000r/min for 1min to obtain a precipitate, drying in the air, adding 9 muL of an upper machine buffer solution for dissolving, and performing sequencing analysis by using an ABI 3130XL sequencer.
According to the sequencing analysis result, when the T mutation of the c.3385 base of the 3 rd exon of the KIAA1462 gene is C, the myopia is pathological. The sequencing map of the c.3385 site of the KIAA1462 gene of a normal human is shown in the attached figure 2, and the sequencing map of the c.3385 site of the KIAA1462 gene of a patient with pathological myopia is shown in the attached figures 3, 4 and 5.
SEQ ID NO. 1: the KIAA1462 gene has the size of 102695bp, GeneID:57608, NCBI Reference Sequence: NM-001350001 and exon3 Sequence as follows, wherein bold bases in the Sequence represent the T → C mutation at position c.3385:
446 gtttt gtaatcaacc cccctcagca tggtcctctc 481 atcccccgac tggtaacgac caagcctacc ggagaagagg acggcaagaa gccaggagcc 541 agaagccgag ggagcacgaa aacctggagg ccagaggaat ggcccaagcc cacagcctgc 601 ctgtccacgt gagggagggt ccatgggaag ttggaggaag gtcagagcat gtgatgaaga 661 agccagtttg ggaagaagaa ttgcgaatgt caggtcctgc caagtggcag aacgtcagcc 721 tggaaagctg gaaccagcca aggaaattag ggaggcagat gtctgatgga gatggggaga 781 gactgtttca agacctgtac ccattcattc aaggagaaca tgtgttgaat tctcaaaaca 841 aagggaagtc tcgctcactg cctagagttc tttcccccga gagcctgagt tgcacggaaa 901 ttcccattcc attaaatgaa agacattcac ctaaaatgcc accgtatcct cccacttgcg 961 caccaaattt ggactccacg aggaattctg agaagagtgg ctgctcagcc ccatttcccc 1021 ggcctaagtt tgggaggccc ctcaagcccc catcttacag ctcgcaccag cagtctaggg 1081 gaggagcgga cagcagtgac tctcaggaca gccagcagat ggacgcctat gtccccaggc 1141 atgagctctg cctgtcagac cctggattgg aacctccagt gtacgtgcct ccgccctcat 1201 acagatcgcc cccgcagaac atcccaaacc cctacttgga agacacggtg cccataaatg 1261 tgtgtggcgg tcacagtcaa cagcagtctc cgaccgagaa ggctggggcc agcggtcagc 1321 ctccttcagg cccccctgga actgggaatg agtatggtgt gagcccccgc ttgcctcagg 1381 ggctccccgc acatccccga cctgtcactg cctatgacgg cttcgttcag tacattccct 1441 ttgatgatcc acggttacga cattttaaac tagctcagcc ccagggtttc tgtgaagaca 1501 taaagcttga cgataaatca tataactcca gtcctgtcac tgctcaagag ccggctcatg 1561 gaggaatgca gcctgatggt gccatttgga atccacagag cttaataccc ccgtcggggg 1621 atgagagagg cctggtcttg gccgattcca gcccccggtg gctgtggggc cagccccccg 1681 gggatgggga aaacagtggc ctccccaacc agagagaccg ctgtgtggca aggggacagt 1741 ggcctgatgt gagaggcagc cagcacgggc acactggaag acaagtttcc tccccttact 1801 cacagggcga gagcacctgc gaaactcaaa ccaagctcaa aaagttccaa actgggactc 1861 ggaccaagaa aagttcaaag aaaaaaatga acgagactat attttgcttg gtttctatcc 1921 cagtgaaatc agaatcacat ctgccagata gagatatgga caacaatgac ttaaagccca 1981 gtgctgatca aaagaatggg tctgataaga gcccggctct gcaagaacag agtctgctga 2041 gcatgtcttc caccgacctg gagctgcagg ccctcacagg aagcatgggt gggagaacgg 2101 agttccaaaa acaagatcta ggggaaccag aagaagacag acaaacaaat gacctcagtt 2161 tcatccacct tacaaagcac agagaactca agcattctgg ctcttggcca gggcaccggt 2221 acagagatca gcaaacacaa accagtttct ccgaggagcc ccaaagttcg cagctgctcc 2281 ctggtgcaaa gctgggaggg ccgagtcgtg cagcattgag tccaaaatgt tcagaccctg 2341 ctgcctccga agctcagacg cacacagcat tccctaccgg tgatcacaaa cagaggccaa 2401 gtgcccgtaa cctgaaaggt cacaggtccc tcagcccatc cagcaacagt gcgttctcaa 2461 ggacttcctt gtccgtggac caggcaccga cgccaaaagc aggccgaagt cagccctgcg 2521 tggatgtcca cgggcttgga gcccaccctg ggcctaagcg ggaggtggtg aagggggagc 2581 ccacgggccc ttgcaacagt aaacaactct ttgggcagtt tctcctgaaa ccggtcagcc 2641 gtcgtccctg ggatttgatc agtcagttag aaagttttaa caaggagctc caggaagagg 2701 aagaaagcag cagtagcagc agcagcagca gcagcagcag tgaggagagt gaggcggagc 2761 cgcagcagga gaaccgtgct cactgcagac aggaggatgt gggcttccgc ggaaacagcc 2821 cggaaatgag ggttgagcca cagccgagga tgtgggtgcc ggagagccct gtgtgtaggt 2881 cgggaagagg tgagagtaag tctgagagct ggagtgagga gctgcagcct ggccacccac 2941 gtgcctggcc tccatccccg ggccgctttc gcgtggaaga aggtggcggt gcacctttct 3001 gctcagcaga tggaagcacg agtgcagaga agagacacct ggaggttagc aacggaatgg 3061 acgagctggc aggtagccca tttcctgtga cgagaatgtc ttcaagatca agtgacgcaa 3121 aaccactgcc cgcgtcctat ccagctgaac ctagggagcc ccaggaaagt ccgaaaatca 3181 ccagtgcttt cagctctgtg aaaccaagtg aagcggtccc tcggaagttt gacagtggtg 3241 gagagagggg ggcagggctc ccactgtccc tgtctaacaa gaaccgaggg ctctcagctc 3301 cagacttacg gtctgtgggg ctcacccctg ggcaagaaca gggtgccagt gagctagagg 3361 ggtctttggg tgaagcaagc acaat/cagaaa tccccccagg tgagtccttg caagccaggg 3421 ctgcaaggat cctgggcatt gaggtggcgg tggagtccct cctgccgggc atccggagag 3481 cgggacagaa ccagcctgct gagcccgatg caagtgcctg caccccagag tccccccagg 3541 aagagttgct atctcgccca gcaccggcag atgtccccag ggtgtccact gatgcctttt 3601 atggcaggag gaagtgcggc tggaccaaga gccctctctt tgtaggggac agggacagtg 3661 ccaggcgggc tcctcaggct tttgagcact cagatgtgga cggggttgtc accagcacag 3721 accctgtccc tgagcctgag cccagcccct tggagtccaa gttcttcgaa caaaaggatg 3781 tggaaacaaa accacccttc aggtccactt tattccattt tgtagaaaga accccaagtg 3841 tggcaggctc tgaaaagaga cttagaagcc cttccaaagt gattgaaagt ttacaagaga 3901 aactggcctc cccgcctagg agagcagacc ctgaccgcct gatgagaatg aaagaggtga 3961 gctcagtgtc acggatgaga gtcctgagct tcaggaatgc cgactcccag gaggacgccg 4021 aggaattgaa ggccaccaca aggggccagg ccgggctccc gggaggcctt gtgtctcctg 4081 gcagtgggga ccgtgcccag agattgggcc actcactctc tgtgtccaag gacagcatct 4141 ccagggaaga gaaggagcat ccggcagcac aaaaggagaa gagcatggat caagacttct 4201 ggtgcccag
the length of the protein molecule coded by the gene KIAA1462 of SEQ ID NO.2 is 1350 amino acids, and the sequence of the p.I1074T mutation is as follows:
10 20 30 40 50 MYSVEDLLIS HGYKLSRDPP ASREDNPKGR QAARTGTRAG QGLQNGHEDG 60 70 80 90 100 PAALAHRKTS AGKGHVSDSE SRRSTPRGHG EPQSTSASRT SEAGFCNQPP 110 120 130 140 150 SAWSSHPPTG NDQAYRRRGR QEARSQKPRE HENLEARGMA QAHSLPVHVR 160 170 180 190 200 EGPWEVGGRS EHVMKKPVWE EELRMSGPAK WQNVSLESWN QPRKLGRQMS 210 220 230 240 250 DGDGERLFQD LYPFIQGEHV LNSQNKGKSR SLPRVLSPES LSCTEIPIPL 260 270 280 290 300 NERHSPKMPP YPPTCAPNLD STRNSEKSGC SAPFPRPKFG RPLKPPSYSS 310 320 330 340 350 HQQSRGGADS SDSQDSQQMD AYVPRHELCL SDPGLEPPVY VPPPSYRSPP 360 370 380 390 400 QNIPNPYLED TVPINVCGGH SQQQSPTEKA GASGQPPSGP PGTGNEYGVS 410 420 430 440 450 PRLPQGLPAH PRPVTAYDGF VQYIPFDDPR LRHFKLAQPQ GFCEDIKLDD 460 470 480 490 500 KSYNSSPVTA QEPAHGGMQP DGAIWNPQSL IPPSGDERGL VLADSSPRWL 510 520 530 540 550 WGQPPGDGEN SGLPNQRDRC VARGQWPDVR GSQHGHTGRQ VSSPYSQGES 560 570 580 590 600 TCETQTKLKK FQTGTRTKKS SKKKMNETIF CLVSIPVKSE SHLPDRDMDN 610 620 630 640 650 NDLKPSADQK NGSDKSPALQ EQSLLSMSST DLELQALTGS MGGRTEFQKQ 660 670 680 690 700 DLGEPEEDRQ TNDLSFIHLT KHRELKHSGS WPGHRYRDQQ TQTSFSEEPQ 710 720 730 740 750 SSQLLPGAKL GGPSRAALSP KCSDPAASEA QTHTAFPTGD HKQRPSARNL 760 770 780 790 800 KGHRSLSPSS NSAFSRTSLS VDQAPTPKAG RSQPCVDVHG LGAHPGPKRE 810 820 830 840 850 VVKGEPTGPC NSKQLFGQFL LKPVSRRPWD LISQLESFNK ELQEEEESSS 860 870 880 890 900 SSSSSSSSSE ESEAEPQQEN RAHCRQEDVG FRGNSPEMRV EPQPRMWVPE 910 920 930 940 950 SPVCRSGRGE SKSESWSEEL QPGHPRAWPP SPGRFRVEEG GGAPFCSADG 960 970 980 990 1000 STSAEKRHLE VSNGMDELAG SPFPVTRMSS RSSDAKPLPA SYPAEPREPQ 1010 1020 1030 1040 1050 ESPKITSAFS SVKPSEAVPR KFDSGGERGA GLPLSLSNKN RGLSAPDLRS 1060 1070 1080 1090 1100 VGLTPGQEQG ASELEGSLGE ASTI/TEIPPGE SLQARAARIL GIEVAVESLL 1110 1120 1130 1140 1150 PGIRRAGQNQ PAEPDASACT PESPQEELLS RPAPADVPRV STDAFYGRRK 1160 1170 1180 1190 1200 CGWTKSPLFV GDRDSARRAP QAFEHSDVDG VVTSTDPVPE PEPSPLESKF 1210 1220 1230 1240 1250 FEQKDVETKP PFRSTLFHFV ERTPSVAGSE KRLRSPSKVI ESLQEKLASP 1260 1270 1280 1290 1300 PRRADPDRLM RMKEVSSVSR MRVLSFRNAD SQEDAEELKA TTRGQAGLPG 1310 1320 1330 1340 1350 GLVSPGSGDR AQRLGHSLSV SKDSISREEK EHPAAQKEKS MDQDFWCPDS
compared with the prior art, the invention has the beneficial effects that: the kit of the invention is used for detecting the pathological myopia related diseasesKIAA1462The kit for gene variation comprises an amplification primer pair, and DNA samples are subjected to PCR amplification and then sequencing through the primer pair, so as to obtain the kit KIAA1462Whether the c.3385 site of the exon 3 of the gene is mutated or not is judged to be pathological myopia or not. The kit for detecting the mutant site sequence has high sensitivity and strong specificity, can be used for determining whether the mutant site has variation only by a small amount of DNA samples, can obtain the result of pathological myopia only by detecting one gene site, is convenient to use and simple to operate, achieves the aim of early screening, is beneficial to development of new drugs, and has good market application prospect.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Qingdao university
<120> kit for detecting pathological myopia and using method and application thereof
<130> 2018
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence (primer set upstream primer)
<400> 1
tgggcgagat agcaactctt 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence (primer pair downstream primer)
<400> 2
gaggttagca acggaatgga 20
<210> 3
<211> 3764
<212> DNA
<213> Artificial sequence (KIAA 1462 gene c.3385 bit amplification product)
<400> 3
gttttgtaat caacccccct cagcatggtc ctctcatccc ccgactggta acgaccaagc 60
ctaccggaga agaggacggc aagaagccag gagccagaag ccgagggagc acgaaaacct 120
ggaggccaga ggaatggccc aagcccacag cctgcctgtc cacgtgaggg agggtccatg 180
ggaagttgga ggaaggtcag agcatgtgat gaagaagcca gtttgggaag aagaattgcg 240
aatgtcaggt cctgccaagt ggcagaacgt cagcctggaa agctggaacc agccaaggaa 300
attagggagg cagatgtctg atggagatgg ggagagactg tttcaagacc tgtacccatt 360
cattcaagga gaacatgtgt tgaattctca aaacaaaggg aagtctcgct cactgcctag 420
agttctttcc cccgagagcc tgagttgcac ggaaattccc attccattaa atgaaagaca 480
ttcacctaaa atgccaccgt atcctcccac ttgcgcacca aatttggact ccacgaggaa 540
ttctgagaag agtggctgct cagccccatt tccccggcct aagtttggga ggcccctcaa 600
gcccccatct tacagctcgc accagcagtc taggggagga gcggacagca gtgactctca 660
ggacagccag cagatggacg cctatgtccc caggcatgag ctctgcctgt cagaccctgg 720
attggaacct ccagtgtacg tgcctccgcc ctcatacaga tcgcccccgc agaacatccc 780
aaacccctac ttggaagaca cggtgcccat aaatgtgtgt ggcggtcaca gtcaacagca 840
gtctccgacc gagaaggctg gggccagcgg tcagcctcct tcaggccccc ctggaactgg 900
gaatgagtat ggtgtgagcc cccgcttgcc tcaggggctc cccgcacatc cccgacctgt 960
cactgcctat gacggcttcg ttcagtacat tccctttgat gatccacggt tacgacattt 1020
taaactagct cagccccagg gtttctgtga agacataaag cttgacgata aatcatataa 1080
ctccagtcct gtcactgctc aagagccggc tcatggagga atgcagcctg atggtgccat 1140
ttggaatcca cagagcttaa tacccccgtc gggggatgag agaggcctgg tcttggccga 1200
ttccagcccc cggtggctgt ggggccagcc ccccggggat ggggaaaaca gtggcctccc 1260
caaccagaga gaccgctgtg tggcaagggg acagtggcct gatgtgagag gcagccagca 1320
cgggcacact ggaagacaag tttcctcccc ttactcacag ggcgagagca cctgcgaaac 1380
tcaaaccaag ctcaaaaagt tccaaactgg gactcggacc aagaaaagtt caaagaaaaa 1440
aatgaacgag actatatttt gcttggtttc tatcccagtg aaatcagaat cacatctgcc 1500
agatagagat atggacaaca atgacttaaa gcccagtgct gatcaaaaga atgggtctga 1560
taagagcccg gctctgcaag aacagagtct gctgagcatg tcttccaccg acctggagct 1620
gcaggccctc acaggaagca tgggtgggag aacggagttc caaaaacaag atctagggga 1680
accagaagaa gacagacaaa caaatgacct cagtttcatc caccttacaa agcacagaga 1740
actcaagcat tctggctctt ggccagggca ccggtacaga gatcagcaaa cacaaaccag 1800
tttctccgag gagccccaaa gttcgcagct gctccctggt gcaaagctgg gagggccgag 1860
tcgtgcagca ttgagtccaa aatgttcaga ccctgctgcc tccgaagctc agacgcacac 1920
agcattccct accggtgatc acaaacagag gccaagtgcc cgtaacctga aaggtcacag 1980
gtccctcagc ccatccagca acagtgcgtt ctcaaggact tccttgtccg tggaccaggc 2040
accgacgcca aaagcaggcc gaagtcagcc ctgcgtggat gtccacgggc ttggagccca 2100
ccctgggcct aagcgggagg tggtgaaggg ggagcccacg ggcccttgca acagtaaaca 2160
actctttggg cagtttctcc tgaaaccggt cagccgtcgt ccctgggatt tgatcagtca 2220
gttagaaagt tttaacaagg agctccagga agaggaagaa agcagcagta gcagcagcag 2280
cagcagcagc agcagtgagg agagtgaggc ggagccgcag caggagaacc gtgctcactg 2340
cagacaggag gatgtgggct tccgcggaaa cagcccggaa atgagggttg agccacagcc 2400
gaggatgtgg gtgccggaga gccctgtgtg taggtcggga agaggtgaga gtaagtctga 2460
gagctggagt gaggagctgc agcctggcca cccacgtgcc tggcctccat ccccgggccg 2520
ctttcgcgtg gaagaaggtg gcggtgcacc tttctgctca gcagatggaa gcacgagtgc 2580
agagaagaga cacctggagg ttagcaacgg aatggacgag ctggcaggta gcccatttcc 2640
tgtgacgaga atgtcttcaa gatcaagtga cgcaaaacca ctgcccgcgt cctatccagc 2700
tgaacctagg gagccccagg aaagtccgaa aatcaccagt gctttcagct ctgtgaaacc 2760
aagtgaagcg gtccctcgga agtttgacag tggtggagag aggggggcag ggctcccact 2820
gtccctgtct aacaagaacc gagggctctc agctccagac ttacggtctg tggggctcac 2880
ccctgggcaa gaacagggtg ccagtgagct agaggggtct ttgggtgaag caagcacaat 2940
agaaatcccc ccaggtgagt ccttgcaagc cagggctgca aggatcctgg gcattgaggt 3000
ggcggtggag tccctcctgc cgggcatccg gagagcggga cagaaccagc ctgctgagcc 3060
cgatgcaagt gcctgcaccc cagagtcccc ccaggaagag ttgctatctc gcccagcacc 3120
ggcagatgtc cccagggtgt ccactgatgc cttttatggc aggaggaagt gcggctggac 3180
caagagccct ctctttgtag gggacaggga cagtgccagg cgggctcctc aggcttttga 3240
gcactcagat gtggacgggg ttgtcaccag cacagaccct gtccctgagc ctgagcccag 3300
ccccttggag tccaagttct tcgaacaaaa ggatgtggaa acaaaaccac ccttcaggtc 3360
cactttattc cattttgtag aaagaacccc aagtgtggca ggctctgaaa agagacttag 3420
aagcccttcc aaagtgattg aaagtttaca agagaaactg gcctccccgc ctaggagagc 3480
agaccctgac cgcctgatga gaatgaaaga ggtgagctca gtgtcacgga tgagagtcct 3540
gagcttcagg aatgccgact cccaggagga cgccgaggaa ttgaaggcca ccacaagggg 3600
ccaggccggg ctcccgggag gccttgtgtc tcctggcagt ggggaccgtg cccagagatt 3660
gggccactca ctctctgtgt ccaaggacag catctccagg gaagagaagg agcatccggc 3720
agcacaaaag gagaagagca tggatcaaga cttctggtgc ccag 3764
<210> 4
<211> 3764
<212> DNA
<213> Artificial sequence (KIAA 1462 gene c.3385 site T → C mutation amplification product)
<400> 4
gttttgtaat caacccccct cagcatggtc ctctcatccc ccgactggta acgaccaagc 60
ctaccggaga agaggacggc aagaagccag gagccagaag ccgagggagc acgaaaacct 120
ggaggccaga ggaatggccc aagcccacag cctgcctgtc cacgtgaggg agggtccatg 180
ggaagttgga ggaaggtcag agcatgtgat gaagaagcca gtttgggaag aagaattgcg 240
aatgtcaggt cctgccaagt ggcagaacgt cagcctggaa agctggaacc agccaaggaa 300
attagggagg cagatgtctg atggagatgg ggagagactg tttcaagacc tgtacccatt 360
cattcaagga gaacatgtgt tgaattctca aaacaaaggg aagtctcgct cactgcctag 420
agttctttcc cccgagagcc tgagttgcac ggaaattccc attccattaa atgaaagaca 480
ttcacctaaa atgccaccgt atcctcccac ttgcgcacca aatttggact ccacgaggaa 540
ttctgagaag agtggctgct cagccccatt tccccggcct aagtttggga ggcccctcaa 600
gcccccatct tacagctcgc accagcagtc taggggagga gcggacagca gtgactctca 660
ggacagccag cagatggacg cctatgtccc caggcatgag ctctgcctgt cagaccctgg 720
attggaacct ccagtgtacg tgcctccgcc ctcatacaga tcgcccccgc agaacatccc 780
aaacccctac ttggaagaca cggtgcccat aaatgtgtgt ggcggtcaca gtcaacagca 840
gtctccgacc gagaaggctg gggccagcgg tcagcctcct tcaggccccc ctggaactgg 900
gaatgagtat ggtgtgagcc cccgcttgcc tcaggggctc cccgcacatc cccgacctgt 960
cactgcctat gacggcttcg ttcagtacat tccctttgat gatccacggt tacgacattt 1020
taaactagct cagccccagg gtttctgtga agacataaag cttgacgata aatcatataa 1080
ctccagtcct gtcactgctc aagagccggc tcatggagga atgcagcctg atggtgccat 1140
ttggaatcca cagagcttaa tacccccgtc gggggatgag agaggcctgg tcttggccga 1200
ttccagcccc cggtggctgt ggggccagcc ccccggggat ggggaaaaca gtggcctccc 1260
caaccagaga gaccgctgtg tggcaagggg acagtggcct gatgtgagag gcagccagca 1320
cgggcacact ggaagacaag tttcctcccc ttactcacag ggcgagagca cctgcgaaac 1380
tcaaaccaag ctcaaaaagt tccaaactgg gactcggacc aagaaaagtt caaagaaaaa 1440
aatgaacgag actatatttt gcttggtttc tatcccagtg aaatcagaat cacatctgcc 1500
agatagagat atggacaaca atgacttaaa gcccagtgct gatcaaaaga atgggtctga 1560
taagagcccg gctctgcaag aacagagtct gctgagcatg tcttccaccg acctggagct 1620
gcaggccctc acaggaagca tgggtgggag aacggagttc caaaaacaag atctagggga 1680
accagaagaa gacagacaaa caaatgacct cagtttcatc caccttacaa agcacagaga 1740
actcaagcat tctggctctt ggccagggca ccggtacaga gatcagcaaa cacaaaccag 1800
tttctccgag gagccccaaa gttcgcagct gctccctggt gcaaagctgg gagggccgag 1860
tcgtgcagca ttgagtccaa aatgttcaga ccctgctgcc tccgaagctc agacgcacac 1920
agcattccct accggtgatc acaaacagag gccaagtgcc cgtaacctga aaggtcacag 1980
gtccctcagc ccatccagca acagtgcgtt ctcaaggact tccttgtccg tggaccaggc 2040
accgacgcca aaagcaggcc gaagtcagcc ctgcgtggat gtccacgggc ttggagccca 2100
ccctgggcct aagcgggagg tggtgaaggg ggagcccacg ggcccttgca acagtaaaca 2160
actctttggg cagtttctcc tgaaaccggt cagccgtcgt ccctgggatt tgatcagtca 2220
gttagaaagt tttaacaagg agctccagga agaggaagaa agcagcagta gcagcagcag 2280
cagcagcagc agcagtgagg agagtgaggc ggagccgcag caggagaacc gtgctcactg 2340
cagacaggag gatgtgggct tccgcggaaa cagcccggaa atgagggttg agccacagcc 2400
gaggatgtgg gtgccggaga gccctgtgtg taggtcggga agaggtgaga gtaagtctga 2460
gagctggagt gaggagctgc agcctggcca cccacgtgcc tggcctccat ccccgggccg 2520
ctttcgcgtg gaagaaggtg gcggtgcacc tttctgctca gcagatggaa gcacgagtgc 2580
agagaagaga cacctggagg ttagcaacgg aatggacgag ctggcaggta gcccatttcc 2640
tgtgacgaga atgtcttcaa gatcaagtga cgcaaaacca ctgcccgcgt cctatccagc 2700
tgaacctagg gagccccagg aaagtccgaa aatcaccagt gctttcagct ctgtgaaacc 2760
aagtgaagcg gtccctcgga agtttgacag tggtggagag aggggggcag ggctcccact 2820
gtccctgtct aacaagaacc gagggctctc agctccagac ttacggtctg tggggctcac 2880
ccctgggcaa gaacagggtg ccagtgagct agaggggtct ttgggtgaag caagcacaac 2940
agaaatcccc ccaggtgagt ccttgcaagc cagggctgca aggatcctgg gcattgaggt 3000
ggcggtggag tccctcctgc cgggcatccg gagagcggga cagaaccagc ctgctgagcc 3060
cgatgcaagt gcctgcaccc cagagtcccc ccaggaagag ttgctatctc gcccagcacc 3120
ggcagatgtc cccagggtgt ccactgatgc cttttatggc aggaggaagt gcggctggac 3180
caagagccct ctctttgtag gggacaggga cagtgccagg cgggctcctc aggcttttga 3240
gcactcagat gtggacgggg ttgtcaccag cacagaccct gtccctgagc ctgagcccag 3300
ccccttggag tccaagttct tcgaacaaaa ggatgtggaa acaaaaccac ccttcaggtc 3360
cactttattc cattttgtag aaagaacccc aagtgtggca ggctctgaaa agagacttag 3420
aagcccttcc aaagtgattg aaagtttaca agagaaactg gcctccccgc ctaggagagc 3480
agaccctgac cgcctgatga gaatgaaaga ggtgagctca gtgtcacgga tgagagtcct 3540
gagcttcagg aatgccgact cccaggagga cgccgaggaa ttgaaggcca ccacaagggg 3600
ccaggccggg ctcccgggag gccttgtgtc tcctggcagt ggggaccgtg cccagagatt 3660
gggccactca ctctctgtgt ccaaggacag catctccagg gaagagaagg agcatccggc 3720
agcacaaaag gagaagagca tggatcaaga cttctggtgc ccag 3764
<210> 5
<211> 1350
<212> PRT
<213> Artificial sequence (KIAA 1462 Gene normally encoded protein molecule)
<400> 5
Met Tyr Ser Val Glu Asp Leu Leu Ile Ser His Gly Tyr Lys Leu Ser
1 5 10 15
Arg Asp Pro Pro Ala Ser Arg Glu Asp Asn Pro Lys Gly Arg Gln Ala
20 25 30
Ala Arg Thr Gly Thr Arg Ala Gly Gln Gly Leu Gln Asn Gly His Glu
35 40 45
Asp Gly Pro Ala Ala Leu Ala His Arg Lys Thr Ser Ala Gly Lys Gly
50 55 60
His Val Ser Asp Ser Glu Ser Arg Arg Ser Thr Pro Arg Gly His Gly
65 70 75 80
Glu Pro Gln Ser Thr Ser Ala Ser Arg Thr Ser Glu Ala Gly Phe Cys
85 90 95
Asn Gln Pro Pro Ser Ala Trp Ser Ser His Pro Pro Thr Gly Asn Asp
100 105 110
Gln Ala Tyr Arg Arg Arg Gly Arg Gln Glu Ala Arg Ser Gln Lys Pro
115 120 125
Arg Glu His Glu Asn Leu Glu Ala Arg Gly Met Ala Gln Ala His Ser
130 135 140
Leu Pro Val His Val Arg Glu Gly Pro Trp Glu Val Gly Gly Arg Ser
145 150 155 160
Glu His Val Met Lys Lys Pro Val Trp Glu Glu Glu Leu Arg Met Ser
165 170 175
Gly Pro Ala Lys Trp Gln Asn Val Ser Leu Glu Ser Trp Asn Gln Pro
180 185 190
Arg Lys Leu Gly Arg Gln Met Ser Asp Gly Asp Gly Glu Arg Leu Phe
195 200 205
Gln Asp Leu Tyr Pro Phe Ile Gln Gly Glu His Val Leu Asn Ser Gln
210 215 220
Asn Lys Gly Lys Ser Arg Ser Leu Pro Arg Val Leu Ser Pro Glu Ser
225 230 235 240
Leu Ser Cys Thr Glu Ile Pro Ile Pro Leu Asn Glu Arg His Ser Pro
245 250 255
Lys Met Pro Pro Tyr Pro Pro Thr Cys Ala Pro Asn Leu Asp Ser Thr
260 265 270
Arg Asn Ser Glu Lys Ser Gly Cys Ser Ala Pro Phe Pro Arg Pro Lys
275 280 285
Phe Gly Arg Pro Leu Lys Pro Pro Ser Tyr Ser Ser His Gln Gln Ser
290 295 300
Arg Gly Gly Ala Asp Ser Ser Asp Ser Gln Asp Ser Gln Gln Met Asp
305 310 315 320
Ala Tyr Val Pro Arg His Glu Leu Cys Leu Ser Asp Pro Gly Leu Glu
325 330 335
Pro Pro Val Tyr Val Pro Pro Pro Ser Tyr Arg Ser Pro Pro Gln Asn
340 345 350
Ile Pro Asn Pro Tyr Leu Glu Asp Thr Val Pro Ile Asn Val Cys Gly
355 360 365
Gly His Ser Gln Gln Gln Ser Pro Thr Glu Lys Ala Gly Ala Ser Gly
370 375 380
Gln Pro Pro Ser Gly Pro Pro Gly Thr Gly Asn Glu Tyr Gly Val Ser
385 390 395 400
Pro Arg Leu Pro Gln Gly Leu Pro Ala His Pro Arg Pro Val Thr Ala
405 410 415
Tyr Asp Gly Phe Val Gln Tyr Ile Pro Phe Asp Asp Pro Arg Leu Arg
420 425 430
His Phe Lys Leu Ala Gln Pro Gln Gly Phe Cys Glu Asp Ile Lys Leu
435 440 445
Asp Asp Lys Ser Tyr Asn Ser Ser Pro Val Thr Ala Gln Glu Pro Ala
450 455 460
His Gly Gly Met Gln Pro Asp Gly Ala Ile Trp Asn Pro Gln Ser Leu
465 470 475 480
Ile Pro Pro Ser Gly Asp Glu Arg Gly Leu Val Leu Ala Asp Ser Ser
485 490 495
Pro Arg Trp Leu Trp Gly Gln Pro Pro Gly Asp Gly Glu Asn Ser Gly
500 505 510
Leu Pro Asn Gln Arg Asp Arg Cys Val Ala Arg Gly Gln Trp Pro Asp
515 520 525
Val Arg Gly Ser Gln His Gly His Thr Gly Arg Gln Val Ser Ser Pro
530 535 540
Tyr Ser Gln Gly Glu Ser Thr Cys Glu Thr Gln Thr Lys Leu Lys Lys
545 550 555 560
Phe Gln Thr Gly Thr Arg Thr Lys Lys Ser Ser Lys Lys Lys Met Asn
565 570 575
Glu Thr Ile Phe Cys Leu Val Ser Ile Pro Val Lys Ser Glu Ser His
580 585 590
Leu Pro Asp Arg Asp Met Asp Asn Asn Asp Leu Lys Pro Ser Ala Asp
595 600 605
Gln Lys Asn Gly Ser Asp Lys Ser Pro Ala Leu Gln Glu Gln Ser Leu
610 615 620
Leu Ser Met Ser Ser Thr Asp Leu Glu Leu Gln Ala Leu Thr Gly Ser
625 630 635 640
Met Gly Gly Arg Thr Glu Phe Gln Lys Gln Asp Leu Gly Glu Pro Glu
645 650 655
Glu Asp Arg Gln Thr Asn Asp Leu Ser Phe Ile His Leu Thr Lys His
660 665 670
Arg Glu Leu Lys His Ser Gly Ser Trp Pro Gly His Arg Tyr Arg Asp
675 680 685
Gln Gln Thr Gln Thr Ser Phe Ser Glu Glu Pro Gln Ser Ser Gln Leu
690 695 700
Leu Pro Gly Ala Lys Leu Gly Gly Pro Ser Arg Ala Ala Leu Ser Pro
705 710 715 720
Lys Cys Ser Asp Pro Ala Ala Ser Glu Ala Gln Thr His Thr Ala Phe
725 730 735
Pro Thr Gly Asp His Lys Gln Arg Pro Ser Ala Arg Asn Leu Lys Gly
740 745 750
His Arg Ser Leu Ser Pro Ser Ser Asn Ser Ala Phe Ser Arg Thr Ser
755 760 765
Leu Ser Val Asp Gln Ala Pro Thr Pro Lys Ala Gly Arg Ser Gln Pro
770 775 780
Cys Val Asp Val His Gly Leu Gly Ala His Pro Gly Pro Lys Arg Glu
785 790 795 800
Val Val Lys Gly Glu Pro Thr Gly Pro Cys Asn Ser Lys Gln Leu Phe
805 810 815
Gly Gln Phe Leu Leu Lys Pro Val Ser Arg Arg Pro Trp Asp Leu Ile
820 825 830
Ser Gln Leu Glu Ser Phe Asn Lys Glu Leu Gln Glu Glu Glu Glu Ser
835 840 845
Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Glu Glu Ser Glu Ala
850 855 860
Glu Pro Gln Gln Glu Asn Arg Ala His Cys Arg Gln Glu Asp Val Gly
865 870 875 880
Phe Arg Gly Asn Ser Pro Glu Met Arg Val Glu Pro Gln Pro Arg Met
885 890 895
Trp Val Pro Glu Ser Pro Val Cys Arg Ser Gly Arg Gly Glu Ser Lys
900 905 910
Ser Glu Ser Trp Ser Glu Glu Leu Gln Pro Gly His Pro Arg Ala Trp
915 920 925
Pro Pro Ser Pro Gly Arg Phe Arg Val Glu Glu Gly Gly Gly Ala Pro
930 935 940
Phe Cys Ser Ala Asp Gly Ser Thr Ser Ala Glu Lys Arg His Leu Glu
945 950 955 960
Val Ser Asn Gly Met Asp Glu Leu Ala Gly Ser Pro Phe Pro Val Thr
965 970 975
Arg Met Ser Ser Arg Ser Ser Asp Ala Lys Pro Leu Pro Ala Ser Tyr
980 985 990
Pro Ala Glu Pro Arg Glu Pro Gln Glu Ser Pro Lys Ile Thr Ser Ala
995 1000 1005
Phe Ser Ser Val Lys Pro Ser Glu Ala Val Pro Arg Lys Phe Asp
1010 1015 1020
Ser Gly Gly Glu Arg Gly Ala Gly Leu Pro Leu Ser Leu Ser Asn
1025 1030 1035
Lys Asn Arg Gly Leu Ser Ala Pro Asp Leu Arg Ser Val Gly Leu
1040 1045 1050
Thr Pro Gly Gln Glu Gln Gly Ala Ser Glu Leu Glu Gly Ser Leu
1055 1060 1065
Gly Glu Ala Ser Thr Ile Glu Ile Pro Pro Gly Glu Ser Leu Gln
1070 1075 1080
Ala Arg Ala Ala Arg Ile Leu Gly Ile Glu Val Ala Val Glu Ser
1085 1090 1095
Leu Leu Pro Gly Ile Arg Arg Ala Gly Gln Asn Gln Pro Ala Glu
1100 1105 1110
Pro Asp Ala Ser Ala Cys Thr Pro Glu Ser Pro Gln Glu Glu Leu
1115 1120 1125
Leu Ser Arg Pro Ala Pro Ala Asp Val Pro Arg Val Ser Thr Asp
1130 1135 1140
Ala Phe Tyr Gly Arg Arg Lys Cys Gly Trp Thr Lys Ser Pro Leu
1145 1150 1155
Phe Val Gly Asp Arg Asp Ser Ala Arg Arg Ala Pro Gln Ala Phe
1160 1165 1170
Glu His Ser Asp Val Asp Gly Val Val Thr Ser Thr Asp Pro Val
1175 1180 1185
Pro Glu Pro Glu Pro Ser Pro Leu Glu Ser Lys Phe Phe Glu Gln
1190 1195 1200
Lys Asp Val Glu Thr Lys Pro Pro Phe Arg Ser Thr Leu Phe His
1205 1210 1215
Phe Val Glu Arg Thr Pro Ser Val Ala Gly Ser Glu Lys Arg Leu
1220 1225 1230
Arg Ser Pro Ser Lys Val Ile Glu Ser Leu Gln Glu Lys Leu Ala
1235 1240 1245
Ser Pro Pro Arg Arg Ala Asp Pro Asp Arg Leu Met Arg Met Lys
1250 1255 1260
Glu Val Ser Ser Val Ser Arg Met Arg Val Leu Ser Phe Arg Asn
1265 1270 1275
Ala Asp Ser Gln Glu Asp Ala Glu Glu Leu Lys Ala Thr Thr Arg
1280 1285 1290
Gly Gln Ala Gly Leu Pro Gly Gly Leu Val Ser Pro Gly Ser Gly
1295 1300 1305
Asp Arg Ala Gln Arg Leu Gly His Ser Leu Ser Val Ser Lys Asp
1310 1315 1320
Ser Ile Ser Arg Glu Glu Lys Glu His Pro Ala Ala Gln Lys Glu
1325 1330 1335
Lys Ser Met Asp Gln Asp Phe Trp Cys Pro Asp Ser
1340 1345 1350
<210> 6
<211> 1350
<212> PRT
<213> Artificial sequence (KIAA 1462 gene c.3385 site T → C mutant coding protein molecule)
<400> 6
Met Tyr Ser Val Glu Asp Leu Leu Ile Ser His Gly Tyr Lys Leu Ser
1 5 10 15
Arg Asp Pro Pro Ala Ser Arg Glu Asp Asn Pro Lys Gly Arg Gln Ala
20 25 30
Ala Arg Thr Gly Thr Arg Ala Gly Gln Gly Leu Gln Asn Gly His Glu
35 40 45
Asp Gly Pro Ala Ala Leu Ala His Arg Lys Thr Ser Ala Gly Lys Gly
50 55 60
His Val Ser Asp Ser Glu Ser Arg Arg Ser Thr Pro Arg Gly His Gly
65 70 75 80
Glu Pro Gln Ser Thr Ser Ala Ser Arg Thr Ser Glu Ala Gly Phe Cys
85 90 95
Asn Gln Pro Pro Ser Ala Trp Ser Ser His Pro Pro Thr Gly Asn Asp
100 105 110
Gln Ala Tyr Arg Arg Arg Gly Arg Gln Glu Ala Arg Ser Gln Lys Pro
115 120 125
Arg Glu His Glu Asn Leu Glu Ala Arg Gly Met Ala Gln Ala His Ser
130 135 140
Leu Pro Val His Val Arg Glu Gly Pro Trp Glu Val Gly Gly Arg Ser
145 150 155 160
Glu His Val Met Lys Lys Pro Val Trp Glu Glu Glu Leu Arg Met Ser
165 170 175
Gly Pro Ala Lys Trp Gln Asn Val Ser Leu Glu Ser Trp Asn Gln Pro
180 185 190
Arg Lys Leu Gly Arg Gln Met Ser Asp Gly Asp Gly Glu Arg Leu Phe
195 200 205
Gln Asp Leu Tyr Pro Phe Ile Gln Gly Glu His Val Leu Asn Ser Gln
210 215 220
Asn Lys Gly Lys Ser Arg Ser Leu Pro Arg Val Leu Ser Pro Glu Ser
225 230 235 240
Leu Ser Cys Thr Glu Ile Pro Ile Pro Leu Asn Glu Arg His Ser Pro
245 250 255
Lys Met Pro Pro Tyr Pro Pro Thr Cys Ala Pro Asn Leu Asp Ser Thr
260 265 270
Arg Asn Ser Glu Lys Ser Gly Cys Ser Ala Pro Phe Pro Arg Pro Lys
275 280 285
Phe Gly Arg Pro Leu Lys Pro Pro Ser Tyr Ser Ser His Gln Gln Ser
290 295 300
Arg Gly Gly Ala Asp Ser Ser Asp Ser Gln Asp Ser Gln Gln Met Asp
305 310 315 320
Ala Tyr Val Pro Arg His Glu Leu Cys Leu Ser Asp Pro Gly Leu Glu
325 330 335
Pro Pro Val Tyr Val Pro Pro Pro Ser Tyr Arg Ser Pro Pro Gln Asn
340 345 350
Ile Pro Asn Pro Tyr Leu Glu Asp Thr Val Pro Ile Asn Val Cys Gly
355 360 365
Gly His Ser Gln Gln Gln Ser Pro Thr Glu Lys Ala Gly Ala Ser Gly
370 375 380
Gln Pro Pro Ser Gly Pro Pro Gly Thr Gly Asn Glu Tyr Gly Val Ser
385 390 395 400
Pro Arg Leu Pro Gln Gly Leu Pro Ala His Pro Arg Pro Val Thr Ala
405 410 415
Tyr Asp Gly Phe Val Gln Tyr Ile Pro Phe Asp Asp Pro Arg Leu Arg
420 425 430
His Phe Lys Leu Ala Gln Pro Gln Gly Phe Cys Glu Asp Ile Lys Leu
435 440 445
Asp Asp Lys Ser Tyr Asn Ser Ser Pro Val Thr Ala Gln Glu Pro Ala
450 455 460
His Gly Gly Met Gln Pro Asp Gly Ala Ile Trp Asn Pro Gln Ser Leu
465 470 475 480
Ile Pro Pro Ser Gly Asp Glu Arg Gly Leu Val Leu Ala Asp Ser Ser
485 490 495
Pro Arg Trp Leu Trp Gly Gln Pro Pro Gly Asp Gly Glu Asn Ser Gly
500 505 510
Leu Pro Asn Gln Arg Asp Arg Cys Val Ala Arg Gly Gln Trp Pro Asp
515 520 525
Val Arg Gly Ser Gln His Gly His Thr Gly Arg Gln Val Ser Ser Pro
530 535 540
Tyr Ser Gln Gly Glu Ser Thr Cys Glu Thr Gln Thr Lys Leu Lys Lys
545 550 555 560
Phe Gln Thr Gly Thr Arg Thr Lys Lys Ser Ser Lys Lys Lys Met Asn
565 570 575
Glu Thr Ile Phe Cys Leu Val Ser Ile Pro Val Lys Ser Glu Ser His
580 585 590
Leu Pro Asp Arg Asp Met Asp Asn Asn Asp Leu Lys Pro Ser Ala Asp
595 600 605
Gln Lys Asn Gly Ser Asp Lys Ser Pro Ala Leu Gln Glu Gln Ser Leu
610 615 620
Leu Ser Met Ser Ser Thr Asp Leu Glu Leu Gln Ala Leu Thr Gly Ser
625 630 635 640
Met Gly Gly Arg Thr Glu Phe Gln Lys Gln Asp Leu Gly Glu Pro Glu
645 650 655
Glu Asp Arg Gln Thr Asn Asp Leu Ser Phe Ile His Leu Thr Lys His
660 665 670
Arg Glu Leu Lys His Ser Gly Ser Trp Pro Gly His Arg Tyr Arg Asp
675 680 685
Gln Gln Thr Gln Thr Ser Phe Ser Glu Glu Pro Gln Ser Ser Gln Leu
690 695 700
Leu Pro Gly Ala Lys Leu Gly Gly Pro Ser Arg Ala Ala Leu Ser Pro
705 710 715 720
Lys Cys Ser Asp Pro Ala Ala Ser Glu Ala Gln Thr His Thr Ala Phe
725 730 735
Pro Thr Gly Asp His Lys Gln Arg Pro Ser Ala Arg Asn Leu Lys Gly
740 745 750
His Arg Ser Leu Ser Pro Ser Ser Asn Ser Ala Phe Ser Arg Thr Ser
755 760 765
Leu Ser Val Asp Gln Ala Pro Thr Pro Lys Ala Gly Arg Ser Gln Pro
770 775 780
Cys Val Asp Val His Gly Leu Gly Ala His Pro Gly Pro Lys Arg Glu
785 790 795 800
Val Val Lys Gly Glu Pro Thr Gly Pro Cys Asn Ser Lys Gln Leu Phe
805 810 815
Gly Gln Phe Leu Leu Lys Pro Val Ser Arg Arg Pro Trp Asp Leu Ile
820 825 830
Ser Gln Leu Glu Ser Phe Asn Lys Glu Leu Gln Glu Glu Glu Glu Ser
835 840 845
Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Ser Glu Glu Ser Glu Ala
850 855 860
Glu Pro Gln Gln Glu Asn Arg Ala His Cys Arg Gln Glu Asp Val Gly
865 870 875 880
Phe Arg Gly Asn Ser Pro Glu Met Arg Val Glu Pro Gln Pro Arg Met
885 890 895
Trp Val Pro Glu Ser Pro Val Cys Arg Ser Gly Arg Gly Glu Ser Lys
900 905 910
Ser Glu Ser Trp Ser Glu Glu Leu Gln Pro Gly His Pro Arg Ala Trp
915 920 925
Pro Pro Ser Pro Gly Arg Phe Arg Val Glu Glu Gly Gly Gly Ala Pro
930 935 940
Phe Cys Ser Ala Asp Gly Ser Thr Ser Ala Glu Lys Arg His Leu Glu
945 950 955 960
Val Ser Asn Gly Met Asp Glu Leu Ala Gly Ser Pro Phe Pro Val Thr
965 970 975
Arg Met Ser Ser Arg Ser Ser Asp Ala Lys Pro Leu Pro Ala Ser Tyr
980 985 990
Pro Ala Glu Pro Arg Glu Pro Gln Glu Ser Pro Lys Ile Thr Ser Ala
995 1000 1005
Phe Ser Ser Val Lys Pro Ser Glu Ala Val Pro Arg Lys Phe Asp
1010 1015 1020
Ser Gly Gly Glu Arg Gly Ala Gly Leu Pro Leu Ser Leu Ser Asn
1025 1030 1035
Lys Asn Arg Gly Leu Ser Ala Pro Asp Leu Arg Ser Val Gly Leu
1040 1045 1050
Thr Pro Gly Gln Glu Gln Gly Ala Ser Glu Leu Glu Gly Ser Leu
1055 1060 1065
Gly Glu Ala Ser Thr Thr Glu Ile Pro Pro Gly Glu Ser Leu Gln
1070 1075 1080
Ala Arg Ala Ala Arg Ile Leu Gly Ile Glu Val Ala Val Glu Ser
1085 1090 1095
Leu Leu Pro Gly Ile Arg Arg Ala Gly Gln Asn Gln Pro Ala Glu
1100 1105 1110
Pro Asp Ala Ser Ala Cys Thr Pro Glu Ser Pro Gln Glu Glu Leu
1115 1120 1125
Leu Ser Arg Pro Ala Pro Ala Asp Val Pro Arg Val Ser Thr Asp
1130 1135 1140
Ala Phe Tyr Gly Arg Arg Lys Cys Gly Trp Thr Lys Ser Pro Leu
1145 1150 1155
Phe Val Gly Asp Arg Asp Ser Ala Arg Arg Ala Pro Gln Ala Phe
1160 1165 1170
Glu His Ser Asp Val Asp Gly Val Val Thr Ser Thr Asp Pro Val
1175 1180 1185
Pro Glu Pro Glu Pro Ser Pro Leu Glu Ser Lys Phe Phe Glu Gln
1190 1195 1200
Lys Asp Val Glu Thr Lys Pro Pro Phe Arg Ser Thr Leu Phe His
1205 1210 1215
Phe Val Glu Arg Thr Pro Ser Val Ala Gly Ser Glu Lys Arg Leu
1220 1225 1230
Arg Ser Pro Ser Lys Val Ile Glu Ser Leu Gln Glu Lys Leu Ala
1235 1240 1245
Ser Pro Pro Arg Arg Ala Asp Pro Asp Arg Leu Met Arg Met Lys
1250 1255 1260
Glu Val Ser Ser Val Ser Arg Met Arg Val Leu Ser Phe Arg Asn
1265 1270 1275
Ala Asp Ser Gln Glu Asp Ala Glu Glu Leu Lys Ala Thr Thr Arg
1280 1285 1290
Gly Gln Ala Gly Leu Pro Gly Gly Leu Val Ser Pro Gly Ser Gly
1295 1300 1305
Asp Arg Ala Gln Arg Leu Gly His Ser Leu Ser Val Ser Lys Asp
1310 1315 1320
Ser Ile Ser Arg Glu Glu Lys Glu His Pro Ala Ala Gln Lys Glu
1325 1330 1335
Lys Ser Met Asp Gln Asp Phe Trp Cys Pro Asp Ser
1340 1345 1350

Claims (3)

1. Detect pathologic myopia's kitThe method is characterized in that: the kit comprises a nucleic acid for amplificationKIAA1462An agent for a gene fragment at the c.3385 locus of exon 3 of a gene;
the reagent comprises a primer pair, and the sequence of a sense primer of the primer pair is as follows: TGGGCGAGATAGCAACTCTT, the sequence of the antisense primer of the primer pair is: GAGGTTAGCAACGGAATGGA are provided.
2. The kit for detecting pathological myopia according to claim 1, wherein:
the reagent also comprises a Buffer solution, a mixed solution, a magnesium chloride solution, Taq enzyme with the concentration of 1U/mu L, a DNA template with the concentration of 30 ng/mu L and secondary distilled water, wherein the Buffer solution is PCR Buffer, and the mixed solution is dNTP mix.
3. Use of a kit for the detection of pathological myopia according to claim 1 or 2, characterized in that:
the kit is used for preparing medicines for detecting pathological myopia diseases.
CN201910016654.6A 2019-01-08 2019-01-08 Kit for detecting pathological myopia and use method and application thereof Expired - Fee Related CN109609618B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910016654.6A CN109609618B (en) 2019-01-08 2019-01-08 Kit for detecting pathological myopia and use method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910016654.6A CN109609618B (en) 2019-01-08 2019-01-08 Kit for detecting pathological myopia and use method and application thereof

Publications (2)

Publication Number Publication Date
CN109609618A CN109609618A (en) 2019-04-12
CN109609618B true CN109609618B (en) 2021-11-26

Family

ID=66016340

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910016654.6A Expired - Fee Related CN109609618B (en) 2019-01-08 2019-01-08 Kit for detecting pathological myopia and use method and application thereof

Country Status (1)

Country Link
CN (1) CN109609618B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007100578A2 (en) * 2006-02-22 2007-09-07 Washington State University Research Foundattion A simplified qtl mapping approach for screening and mapping novel markers associated with beef marbling
CA2718392A1 (en) * 2008-03-14 2009-09-17 Genoscreen Biomarkers for alzheimer's disease
CN101892306A (en) * 2009-04-03 2010-11-24 四川省医学科学院（四川省人民医院） Screening test kit for detecting pathologic moyopia
WO2014152355A2 (en) * 2013-03-14 2014-09-25 The Broad Institute, Inc. Osteosarcoma-associated risk markers and uses thereof
CN106987618A (en) * 2016-01-21 2017-07-28 张培祥 The multiple gene mononucleotide polymorphism Sites Combinations related to statins personalized medicine and its application
CN108165635A (en) * 2016-12-07 2018-06-15 南京农业大学 KIAA1462 gene promoter areas variant sites and its application on egg laying performance of goose is improved

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007100578A2 (en) * 2006-02-22 2007-09-07 Washington State University Research Foundattion A simplified qtl mapping approach for screening and mapping novel markers associated with beef marbling
CA2718392A1 (en) * 2008-03-14 2009-09-17 Genoscreen Biomarkers for alzheimer's disease
CN101892306A (en) * 2009-04-03 2010-11-24 四川省医学科学院（四川省人民医院） Screening test kit for detecting pathologic moyopia
WO2014152355A2 (en) * 2013-03-14 2014-09-25 The Broad Institute, Inc. Osteosarcoma-associated risk markers and uses thereof
CN106987618A (en) * 2016-01-21 2017-07-28 张培祥 The multiple gene mononucleotide polymorphism Sites Combinations related to statins personalized medicine and its application
CN108165635A (en) * 2016-12-07 2018-06-15 南京农业大学 KIAA1462 gene promoter areas variant sites and its application on egg laying performance of goose is improved

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
A coronary artery disease-associated gene product, JCAD/KIAA1462, is a novel;Masaya Akashi等;《Biochemical and Biophysical Research Communications》;20110822;224-229 *
A Functional Mutation in KIAA1462 Promoter Decreases Glucocorticoid Receptor Affinity and Affects Egg-Laying Performance in Yangzhou Geese;Mengyuan Xia等;《Molecular Sciences》;20180521;1-16 *
KIAA1462, A Coronary Artery Disease Associated Gene, Is a Candidate Gene for Late Onset Alzheimer Disease in APOE Carriers;Deborah G. Murdock等;《The PLOS one》;20131212;1-9 *

Also Published As

Publication number Publication date
CN109609618A (en) 2019-04-12

Similar Documents

Publication Publication Date Title
Bisceglia et al. VSX1 mutational analysis in a series of Italian patients affected by keratoconus: detection of a novel mutation
Brancati et al. A locus for autosomal dominant keratoconus maps to human chromosome 3p14–q13
Liu et al. Identification of a CRYAB mutation associated with autosomal dominant posterior polar cataract in a Chinese family
Shimizu et al. Age-dependent prevalence of mutations at the GLC1A locus in primary open-angle glaucoma
Stoffel et al. Missense glucokinase mutation in maturity–onset diabetes of the young and mutation screening in late–onset diabetes
Lu et al. Replication study supports CTNND2 as a susceptibility gene for high myopia
Jin et al. Detecting genetic variations in hereditary retinal dystrophies with next-generation sequencing technology
Sheikh et al. Mutational spectrum of the CYP1B1 gene in Pakistani patients with primary congenital glaucoma: novel variants and genotype-phenotype correlations
CN110241202A (en) Retinal pigment degeneration mutational site and its application
CN111893179B (en) Molecular marker of myopia-related susceptibility gene, detection primer set and application thereof
US20040248092A1 (en) Methods of screening for parkinsons&#39;s disease
CN114107452B (en) Marfan syndrome detection kit based on FBN1 gene insertion mutation
CN102251045B (en) Screening kit for detecting high myopia
CN107723359B (en) Congenital cataract pathogenic gene and application thereof, detection primer and detection kit
Zhang et al. Mutational screening of 10 genes in Chinese patients with microphthalmia and/or coloboma
CN101892306B (en) Screening test kit for detecting pathologic moyopia
Mohebi et al. Identification of a de novo 3bp deletion in CRYBA1/A3 gene in autosomal dominant congenital cataract
CN109609618B (en) Kit for detecting pathological myopia and use method and application thereof
Yousefian et al. Primary angle closure glaucoma-associated genetic polymorphisms in Northeast Iran
CN110551728A (en) FOXC1 gene mutant and application thereof
Van Schil et al. A nonsense mutation in FAM161A is a recurrent founder allele in Dutch and Belgian individuals with autosomal recessive retinitis pigmentosa
CN110484623A (en) A kind of RB1 mutated gene, primer, detection method, kit and application
CN108866067B (en) Pathogenic mutation of Leber congenital amaurosis and detection reagent thereof
Zhao et al. Chinese family with atypical granular corneal dystrophy type I caused by the typical R555W mutation in TGFBI
Long et al. Genotype-phenotype correlations in Chinese patients with TGFBI gene-linked corneal dystrophy

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20211126

CF01 Termination of patent right due to non-payment of annual fee