CN112048507A

CN112048507A - Cloning and application of miRNA for enhancing rice blast resistance

Info

Publication number: CN112048507A
Application number: CN202010883620.XA
Authority: CN
Inventors: 王加峰; 侯艳; 郭涛; 陈淳; 杨瑰丽; 肖武名; 黄翠红; 王慧; 陈志强
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-08-28
Filing date: 2020-08-28
Publication date: 2020-12-08
Anticipated expiration: 2040-08-28
Also published as: CN112048507B

Abstract

The invention discloses cloning and application of miRNA for enhancing rice blast resistance, belonging to the technical field of plant genetic engineering. The nucleotide sequence of the miRNA is shown in SEQ ID NO 1. The inventors of the present invention identified and confirmed that miRNA-T34 can regulate basic immune response of rice by inhibiting the expression of LOC _ Os02g39410 and LOC _ Os01g46500, thereby positively regulating rice blast resistance. By combining with the over-expression miRNA technology to up-regulate miRNA-T34, the rice blast resistance can be obviously improved, and the application prospect is good.

Description

Cloning and application of miRNA for enhancing rice blast resistance

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to cloning and application of miRNA for enhancing rice blast resistance.

Background

The rice blast is a destructive disease caused by Magnaporthe oryzae (Magnaporthe oryzae), and causes enormous economic loss in rice paddy areas (Yi et al, 2004). Practice proves that identifying and utilizing broad-spectrum resistance genes to carry out rice disease resistance breeding is the most economic and effective strategy for preventing and treating rice blast (Deng et al, 2006). Until now, researchers used to identify more than 80 rice blast resistance genes from different disease-resistant varieties, the identified and cloned genes were distributed on 11 chromosomes except the No. 3 chromosome in the form of single genes or gene clusters, and the multiple disease-resistant genes were distributed in clusters and mainly existed on the 6 th, 11 th and 12 th chromosomes. Although a batch of disease-resistant or disease-tolerant high-yield varieties are bred all over the country, the resistance sources of the newly bred varieties are simplified slightly on the whole; the long-term single use of individual disease-resistant genes can cause the variation of corresponding non-toxic genes, so that part of the resistance genes used for variety breeding can not have lasting resistance after multi-generation transmission, and large-area outbreak can be caused under the environmental condition suitable for rice blast germs. Therefore, there is a need to develop a new durable disease-resistant variety by means of multi-way widening of resistance sources and combining multi-gene polymerization breeding, biotechnology and the like.

miRNAs are small non-coding RNAs with the length of about 21-24nt, and belong to an effective post-transcriptional gene regulatory factor. Protein-encoding genes are primarily base-paired by complementarity, resulting in mRNA degradation or translational inhibition, thereby modulating a number of cellular functions and processes, including cell proliferation, differentiation, apoptosis, as well as stress and pathogen defense (Bartel et al, 2004), among others. Numerous miRNAs have been found in different plants, which not only regulate growth and development, but also important physiological processes (Mallory et al, 2006; Jones-Rhoades et al, 2006; Li et al; Bartel et al, 2004; Zhang et al, 2013). Some miRNAs even participate in combating pathogen infestation by modulating the NBS-LRR class (Zhai et al, 2011). For example, NTA-miR6019 and NTA-miR6020 guide sequence-specific cleavage of a transcript of TIR-NBS-LRR immunoreceptor N, which confers tobacco plant resistance to Tobacco Mosaic Virus (TMV). In tobacco, the super miRNA family miR482 is directed against NBS-LRR disease resistance genes, with a coiled-up domain at the N-terminus. In addition, some miRNAs are also involved in the cleavage of NBS-LRR gene and produce phased tandem siRNAs.

For example, the method for improving the black-streaked dwarf virus resistance of rice by using artificial miRNA and the special double-stranded RNA thereof (Chinese patent CN102676510A) invented by Wangxingjun et al disclose a method for improving the black-streaked dwarf virus resistance of rice by using artificial miRNA and the special double-stranded RNA thereof, and we also disclose a miRNA related to blast disease resistance and application thereof in the previous period (Chinese patent ZL201711155567.6), wherein the miRNA mainly targets a negative regulation disease-resistant gene Pik-H4 to regulate the disease resistance, and the research shows that the regulation of the expression of the miRNA can be used for enhancing the disease resistance of plants. And the miRNA related to the disease-resistant reaction of the rice blast is further analyzed and cloned, so that a new idea can be provided for better controlling and reducing the damage of the rice blast to rice and enhancing the disease resistance of plants, and the miRNA has important application value.

Disclosure of Invention

In order to overcome the defects and shortcomings of the prior art, the primary object of the present invention is to provide a miRNA for enhancing rice blast resistance. It improves rice blast resistance by targeted negative regulation of LOC _ Os02g39410 and LOC _ Os01g 46500.

Another object of the present invention is to provide the use of the above-mentioned miRNA for enhancing rice blast resistance. The rice blast resistance can be obviously enhanced by over-expressing the miRNA, and the rice blast resistance of rice can be improved by over-expressing the miRNA in the rice.

The purpose of the invention is realized by the following technical scheme:

a miRNA for enhancing rice blast resistance has a nucleotide sequence shown as follows (also shown as SEQ ID NO: 1):

5'-GUGGGGCGGCGGUGGUGGCGG-3'。

the nucleotide sequence of the gene coding the miRNA for enhancing the rice blast resistance is shown as follows (also shown as SEQ ID NO: 2):

5'-GTGGGGCGGCGGTGGTGGCGG-3'。

the nucleotide sequence of the precursor corresponding to the above miRNA for enhancing rice blast resistance is shown as follows (also shown as SEQ ID NO: 3):

5'-GCCCGCGGCGGUGGGGCGGCGGUGGUGGCGGCGAAGGUGAUGGACAGGAAGGAGCUGGCCGGGAGGAACAAGGAAGGGCGGGCGAGAACCGAGAGGGAGAUCCUCGAGGCCGUCGACCACCCCUUCCUCCCGCGCCUCUACGGCGUGGCCGAGGGGGAUCGCUGGUCCUGCCUCCUCACCGAGUUCUGCCCCGGCGGCGACCUCCACGUCCUCCGCCAGCGGCAGCCGCACCGCCGCUUCACCGAGUCCGCCGUCAGGUA-3'。

the nucleotide sequence of the gene encoding the corresponding precursor of the above miRNA for enhancing rice blast resistance is shown as follows (also shown as SEQ ID NO: 4):

5'-GCCCGCGGCGGTGGGGCGGCGGTGGTGGCGGCGAAGGTGATGGACAGGAAGGAGCTGGCCGGGAGGAACAAGGAAGGGCGGGCGAGAACCGAGAGGGAGATCCTCGAGGCCGTCGACCACCCCTTCCTCCCGCGCCTCTACGGCGTGGCCGAGGGGGATCGCTGGTCCTGCCTCCTCACCGAGTTCTGCCCCGGCGGCGACCTCCACGTCCTCCGCCAGCGGCAGCCGCACCGCCGCTTCACCGAGTCCGCCGTCAGGTA-3'。

the miRNA for enhancing the rice blast resistance and/or the corresponding precursor thereof are applied to the improvement of the rice blast resistance of rice.

The miRNA for enhancing rice blast resistance and/or the corresponding precursor thereof are applied to cultivation of rice blast resistant rice.

The application is to improve the resistance of rice to rice blast germs by promoting the over-expression of the miRNA in the rice by utilizing a genetic engineering technology.

The genetic engineering technology is preferably an over-expression miRNA technology.

A method for cultivating rice blast resistant rice by using an over-expression miRNA technology comprises the following steps: amplifying to obtain a precursor sequence corresponding to the miRNA related to the rice blast resistance, constructing the precursor sequence on a pOX carrier to obtain an overexpression carrier, and transforming rice by adopting agrobacterium-mediated transformation to obtain rice blast-resistant rice; the method specifically comprises the following steps:

(1) performing reverse transcription on total RNA of rice leaves to obtain cDNA, and performing PCR amplification on the cDNA serving as a template and T34-OX-F and T34-OX-R serving as primers to obtain a target fragment;

(2) performing double enzyme digestion on the purified target fragment by using Hind III and BamH I, and then connecting the target fragment with a pOX carrier subjected to the same double enzyme digestion to obtain a connection product;

(3) directly transforming the ligation product into an escherichia coli competent cell, selecting a single colony for culture, extracting plasmids for Hind III and BamH I enzyme digestion identification and colony PCR identification, and continuously performing sequencing identification on transformants with the two detection results meeting the requirements to obtain a successfully constructed over-expression vector;

(4) and (3) carrying out agrobacterium-mediated rice genetic transformation on the overexpression vector to obtain the rice blast resistant rice.

The rice in the step (1) is preferably a rice high rice blast resistance strain H4.

The nucleotide sequences of the primers T34-OX-F and T34-OX-R in the step (1) are shown as follows:

T34-OX-F：5’-CCAAGCTTAAACCCACCTCATCACCACC-3’；

T34-OX-R：5’-CGGGATCCGGACGGAGGGAGTAACTTTTCC-3’。

the PCR amplification reaction system in the step (1) comprises the following components in every 50 mu L of reaction system: 2X Phanta Max Buffer 25. mu.L, template DNA 1. mu.L, forward and reverse primers 2. mu.L each, Phanta Max Super-Fidelity DNA Polymerase 1. mu.L, dNTP Mix (10mM each) 1. mu.L, ddH₂And (4) metering the residual quantity of O.

The reaction conditions for the PCR amplification in step (1) are preferably: pre-denaturation at 95 ℃ for 3 min; 32 cycles of 94 ℃ for 15s, 60 ℃ for 15s, and 72 ℃ for 90 s; finally, extension is carried out for 5min at 72 ℃.

In the connected reaction system in the step (2), the pOX carrier and the target fragment are preferably prepared according to the molar ratio of 1:3-3: 1.

The reaction conditions for the ligation described in step (2) are preferably: ligation was performed at 22 ℃ for 2h or 16 ℃ overnight.

The time for selecting the single colony in the step (3) is preferably 2 days after transformation, and the culture time is preferably 7-9 h.

The primer sequences used for sequencing in step (3) are as follows:

UBI-seq：5’-TTGTCGATGCTCACCCTGTTG-3’。

the inventor inoculates rice blast germ GDYJ7 to high-rice blast resistance rice material H4 and rice blast susceptible varieties in early stage, identifies a plurality of new miRNAs which are induced and expressed by rice blast germ stress by constructing a small RNA sequencing library, wherein the miRNA target genes relate to a plurality of defense genes related to disease resistance, such as transcription factors, protein kinases, phytohormones and the like, and further verifies that part of miRNAs can specifically negatively regulate the expression of some disease-resistant related target genes.

Further sequencing of the degradants indicated that miRNA-T34 might target some genes involved in the regulation of rice blast resistance.

Northern blot expression verification proves that miRNA-T34 really exists in anti-infection rice leaves. The miRNA-T34 is regulated and controlled by rice blast germs, the expression level in the susceptible material is increased and then decreased, and the expression level is maintained at a lower level; and the expression level of the disease-resistant material is decreased and then increased, and then decreased. Tissue-specific expression analysis showed that miRNA-T34 is expressed mainly in stems, leaves and internodes, and not in roots.

The target gene prediction indicates that the miRNA-T34 may target mRNA of a protein phosphatase 2C family gene LOC _ Os02g39410 and a F-box domain containing protein LOC _ Os01g46500 respectively. GFP-tobacco transient expression system proves that miRNA-T34 can cut mRNA of LOC _ Os02g39410 and LOC _ Os01g46500 or inhibit translation of the mRNA, and reduce expression of protein of the mRNA, thereby improving resistance of rice to rice blast.

The disease resistance detection results of transgenic plants after miRNA-T34 overexpression or miRNA-T34 knockout in rice show that the rice blast resistance is enhanced by miRNA-T34 overexpression, the sensitivity of rice to rice blast bacteria is increased by miRNA-T34 knockout and target simulation, and the basic immune response of rice is regulated by miRNA-T34 through negative regulation of the expression of LOC _ Os02g39410 and LOC _ Os01g 46500.

The molecular mechanism of miRNA-T34 and its target gene is deeply explored, which has important theoretical and application values.

Compared with the prior art, the invention has the following advantages and effects:

the invention identifies and proves that miRNA-T34 can regulate the basic immune response of rice, and the miRNA-T34 is over-expressed by the pOX vector, so that the resistance of the rice to rice blast can be obviously improved, and the application prospect is good.

Drawings

FIG. 1 is a diagram showing the result of Northern blot detecting the expression of miRNA-T34.

FIG. 2 is a diagram showing the analysis of the real-time fluorescent quantitative PCR results; wherein, A is the expression pattern of miRNA-T34, B is the expression pattern of target gene LOC _ Os02g39410, and C is the expression pattern of target gene LOC _ Os01g 46500.

FIG. 3 is a graph showing the results of verification of transient expression of GFP-tobacco; wherein, A is singly injected LOC _ Os02g39410, B is singly injected GFP-LOC _ Os02g39410 and overexpression vector OX-miRNA-T34, C is singly injected GFP-LOC _ Os01g46500, and D is singly injected GFP-LOC _ Os01g46500 and overexpression vector OX-miRNA-T34.

FIG. 4 is a graph showing the results of the disease resistance assay of transgenic material; wherein, A is a wild plant, B is an over-expression miRNA-T34(OX-miRNA-T34) plant, and C is a knock-out miRNA-T34(KO-miRNA-T34) plant.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The raw materials and equipment used in the invention are all conventional commercial products and can be directly obtained by market purchase if no special description is made.

The primer sequences used in the embodiments of the present invention were synthesized by Shanghai Jun Biotechnology, Inc.

Example 1 Northern blot detection of expression of miRNA-T34

1. Extraction of total RNA from rice leaves

1) Get 3The two soft accounts of the-4-leaf stage rice high-blast-resistance rice strain H4 and susceptible varieties (the two soft accounts of the rice high-blast-resistance rice strain H4 and the susceptible varieties are in the literature, "rice blast-resistance protein Pik₂Cloning of the-H4 Gene and screening of the interacting protein [ J]Guangdong agricultural science, 2014, (04): 156-;

2) adding chloroform at a ratio of 200 μ L per 100mg leaf, mixing, centrifuging at 13,000rpm and 4 deg.C for 15min, removing the middle layer and lower layer organic phase, and collecting the upper layer water phase in a new centrifuge tube;

3) adding 600 μ L isopropanol, mixing, standing at room temperature for 20min, centrifuging at 13,000rpm at 4 deg.C for 20min, discarding supernatant, washing with 70% anhydrous ethanol once, centrifuging, collecting precipitate, and dissolving in DDH without RNase after ethanol evaporation₂Freezing and storing in O water at-80 deg.c for use.

2. Biotin mediated Northern blot analysis

Referring to the methods in "Shenjiangqiang, Rice stress response small RNA screening and 3 'untranslated region micro-inverted repeat sequence inhibition translation research [ D ].2017 ], a probe 5'-GTGGGGCGGCGGTGGTGGCGG-3'was designed according to the mature sequence of miRNA-T34, and a biotin label was added at the 3' end. And then 100-500 mu g of the total RNA obtained in the step 1 is taken for polyacrylamide gel electrophoresis separation, after electrotransfer for 3h, the membrane is placed in an ultraviolet crosslinking instrument for 1200J crosslinking for 2min, and then the nylon membrane is transferred to a hybridization furnace for prehybridization for 30min at 50 ℃ so as to fix the RNA on the nylon membrane. The nylon membrane is prehybridized, hybridized and washed by using a probe, and then the expression condition of miRNA-T34 is detected by using a chemiluminescence method biotin detection kit of Biyuntian biotechnology. The results are shown in FIG. 1.

The result shows that the miRNA-T34 can be correctly expressed in the plants of Zhongerweizhan and H4, and the miRNA really exists in the plants of Zhongerweizhan and H4.

Example 2 quantitative analysis of the role of miRNA-T34 in Rice blast resistance

Primer design for RNA reverse transcription and real-time quantitative PCR

The stem-loop PCR primers were designed based on the precursor sequence (SEQ ID NO:3) predicted by the miRNA-T34 sequence, and the primer sequences were as follows:

(1) RT primer sequences

5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGCCACC-3’(SEQ ID NO:5)

(2) miRNA-T34 forward primer

5’-GCGTTTTGAAACGGAGGGAGC-3’(SEQ ID NO:6)

Designing qRT-PCR detection primers of the following target genes according to the coding sequences of the target genes:

(3) LOC _ Os02g39410 forward primer

5’-ACATCAACACAACCCCGAG-3’(SEQ ID NO:7)

(4) LOC _ Os02g39410 reverse primer

5’-ATCTAACCCCAAAACTCCCTG-3’(SEQ ID NO:8)

(5) LOC _ Os01g46500 forward primer

5’-CTTGACGATGCAAATGACGC-3’(SEQ ID NO:9)

(6) LOC _ Os01g46500 reverse primer

5’-ACAACCCCTGAGTGTTCAAAC-3’(SEQ ID NO:10)

qRT-PCR detection primers of the reference gene:

(7) u6 Forward primer

5’-TACAGATAAGATTAGCATGGCCCC-3’(SEQ ID NO:11)

(8) U6 reverse primer

5’-GGACCATTTCTCGATTTGTACGTG-3’(SEQ ID NO:12)

2. Plant cultivation and rice blast pathogen infection

In the second soft occupation and H4-3 leaf stage of greenhouse planting, the gelatin solution of rice blast germ GDYJ7 (disclosed in the literature 'WuPeng Bing, identification of rice MicroRNA responding to rice blast germ infection and preliminary function research (D), 2019') spores is uniformly sprayed on the surface of leaves (the concentration of conidia is 5 x 10)⁵mL), the inoculated seedlings are moisturized in a dark room at 25 ℃ for 24 hours, and then moisturized for 7-10 days, and then the disease condition is investigated.

3. Extraction of total RNA from rice leaves

The same as in example 1.

4. Reverse transcription and reverse transcription system

Ordinary reverse transcription: mu.g of total RNA sample stored at-80 ℃ was sampled, and 1. mu.L of Oligo (dT16) (10mmol/L) was added thereto using RNase free ddH₂O to a total volume of 12. mu.L, mixed and placed in a water bath at 65 ℃ for 5min, immediately placed on ice, and 4. mu.L of 5 XTRT b. mu.ffer, 2. mu.L of dNTP (10mmol/L), 1. mu.L of RNase inhibitor (10U/. mu.L) and 1. mu.L of ReverTroace were added to the tube and mixed. Place the tube in a PCR instrument, set up the reaction program: 10min at 30 ℃, 60min at 42 ℃, 5min at 99 ℃ and 5min at 25 ℃ to obtain first strand cDNA, and storing in a refrigerator at-20 ℃.

Reverse transcription of miRNA: mu.l of DNase-treated RNA was taken, added with 1.5. mu.l of a primer mixture (0.25. mu.l of RT primer (10mmol/L), 0.25. mu.l of dNTP (10mmol/L) and 1. mu.l of DEPC. and then centrifuged slightly, incubated at 65 ℃ for 5min, immediately placed on ice for 3 min. 1. mu.l of 5 XFirst strand buffer, 0.5. mu.l of 0.1mol/L DTT, 0.15. mu.l of RRI and 0.15. mu.l of Superscript III were prepared into a mixture, 1.8. mu.l of each tube was added, centrifuged, placed on a PCR instrument, at 16 ℃ for 30min, 50 ℃ for 30min, 85 ℃ for 5min, 25 ℃ for 1min, and the reverse transcription product was placed at-20 ℃ for further use.

5. Real-time fluorescent quantitative PCR analysis

(1) Real-time quantitative PCR reaction system

The quantitative reagent of Novovoxam company is selected to quantify miRNA, and the reaction system is as follows: 10 μ L AceQ qPCR SYBR Green Master Mix, 0.8 μ L each 10 μmol/L upstream and downstream primers, 0.4 μ L ROX Reference Dye1, 0.2 μ L cDNA (miRNA reverse transcription product), sterile water make-up to 20 μ L, for quantitative detection. The quantitative PCR instrument sets the reaction program as follows: 5min at 95 ℃; 10s at 95 ℃, 30s at 60 ℃ and 40 cycles. All reactions were performed in triplicate with U6 as the reference gene.

(2) Analysis of results

By use of 2^-ΔΔCtThe method was performed to analyze the results, which are shown in fig. 2. The results of real-time fluorescent quantitative PCR analysis show that the expression of miRNA-T34 is induced by rice blast germs, the expression level in the susceptible material shows a trend of ascending first and then descending and is maintained at a lower expression level; and the expression quantity of the disease-resistant material is firstly reduced and then increasedAnd the expression quantity of target genes LOC _ Os02g39410 and LOC _ Os01g46500 is obviously reduced after the rice blast disease is inoculated by anti-and susceptible materials after the rice blast disease is infected by the rice blast bacteria and is maintained at a lower level. In the transgenic material, the expression level of the target gene is basically consistent with the expectation and basically has an inverse relation with the change of the expression quantity of the microRNA. This suggests that miRNA-T34 has the potential to regulate rice blast resistance through the regulation of target genes LOC _ Os02g39410 and LOC _ Os01g 46500.

Example 3 Targeted Gene validation of miRNA-T34

1. Construction of target Gene-GFP fusion protein expression vector

The target gene is cloned to GFP expression system vector backbone p35S-GFP (disclosed in the literature, "Wei et al. A novel Co-expression protocol based on expression vector expression for extruding protein-protein in rice [ J ]. Plant Mol Biol Rep, 2013") by recombinant cloning, using about 200bp containing miRNA-T34 recognition region as a target segment. The specific operation is as follows:

selecting two enzyme cutting sites of BamH I and Sal I from p35S-GFP to cut a p35S-GFP vector, and recovering and purifying through agarose gel for later use;

a recombinant cloning primer is designed according to an enzyme digestion site, cDNA of the common reverse transcription in the embodiment 2 is used as a template to amplify a target section of a target gene (a PCR reaction system is 20 mu L: 2 mu L10 XPCR buffer solution, positive and negative primers are 0.6 mu L (10 mu mol/L) respectively, dNTP is 0.3 mu L (10mmol/L), 0.3 mu L Taq DNA polymerase (5U/mu L), 1 mu L template and double distilled water are complemented to 20 mu L, an amplification reaction PCR program is that denaturation is carried out at 94 ℃ for 3min, denaturation is carried out at 94 ℃ for 30s, annealing is carried out at 55 ℃ for 30s, extension is carried out at 72 ℃ for 60s, reaction is carried out for 35 cycles, extension is carried out at 72 ℃ for 5min, and the target section is recovered and purified through agarose gel.

Then, the target fragment of the target gene was ligated into p35S-GFP by homologous recombination using BamH I and Sal I, and the reaction system was ligated: 1. mu.L of Exnase II, 2. mu.L of 5 × CE II Buffer, 10-100ng of target gene fragment, 25-100ng of p 35S-GFP; reaction conditions are as follows: and (3) carrying out water bath at 37 ℃ for 30min, transforming the escherichia coli DH5a, detecting, and transforming the cloning vector with successful sequencing verification into agrobacterium tumefaciens EHA105 by an electric excitation method, and storing the cloning vector in glycerol at-80 ℃ in an ultralow temperature refrigerator for later use.

1. Planting of Bunsen tobacco, agrobacterium mediated transient transformation and fluorescence analysis

This tobacco (disclosed in "Zhang T, Zheng Q F, Yi X et al. effective RNA resistance in plants by harnessing CRISPR immune system. plant Biotechnol J,2018,16(8): 1415-1423") was seeded and then cultured to 5-6 leaves in each 12h of light/dark at 25 ℃.

The reference "Chenxiang Song, Li sweet, Zhou Shao Li, Zhao Yu (2018). exogenous protein is transiently expressed in tobacco leaves. Bio-101: e1010127.DOI: 10.21769/BioProtoc.1010127" for Agrobacterium injection, specifically:

1) inoculating agrobacterium transformed with GFP-target gene fusion protein expression vector on a culture dish added with 20mg/L rifampicin and 50mg/L kanamycin by streak, and culturing in dark at 28 ℃ for 2-3 d;

2) selecting a single colony, inoculating the single colony into 5mL of LB culture solution containing corresponding antibiotics, and culturing at 28 ℃ and 250rpm for 24 h;

3) then diluting the bacterial liquid by 50-100 times in LB culture liquid containing 0.4mmol/L AS (acetosyringone), 10mmol/L MES (2- (N-morpholino) ethanesulfonic acid) and corresponding antibiotics, and culturing at 28 deg.C and 250 rpm;

4) OD of bacterial liquid₆₀₀After the value reached 0.8-1.0, the cells were centrifuged at 4,000rpm for 10min at room temperature to collect the cells, and MgCl was added at a concentration of 10mmol/L₂OD of the cells in solution₆₀₀Adjusting the value to 1.0, adding 100mmol/L AS according to the proportion of adding 2 mu L of bacterial liquid per ml, and standing for more than 3 h;

5) taking tobacco in 5-6 leaf stage, sucking bacterial liquid with 1mL injector, slowly permeating bacterial liquid into epidermal cells from back of leaf, and normally culturing after injection (12 h each at 25 deg.C in light/dark).

And 3-5d later, cutting leaves around the injection site, enabling the back face to face upwards, and observing the expression condition of the target protein under a fluorescence microscope. The results are shown in FIG. 3. The result shows that when GFP-LOC _ Os02g39410 and GFP-LOC _ Os01g46500 are respectively and independently injected into tobacco, green fluorescence can be normally observed, and after the GFP-LOC _ Os02g and GFP-LOC _ Os01g46500 are injected together with an overexpression vector OX-miRNA-T34 of miRNA-T34 (the specific preparation method is referred to example 4), the luminous intensity of the green fluorescence is obviously reduced, and the miRNA-T34 can inhibit the expression of GFP-target gene fusion protein corresponding to a target gene.

Example 4 construction of transgenic Rice overexpressing miRNA-T34 and knocking out miRNA-T34

Using pOX (disclosed in literature "cloning and functional analysis [ D ]. 2012" of SDG711 and SDG723 of Lichao rice) as an over-expression vector, and driving over-expression of miRNA-T34 by using a UBI promoter; the miRNA-T34 knockout is carried out by using CRISPR/Cas9 technology. The method comprises the following specific steps:

construction of an overexpression vector for miRNA-T34

The miRNA-T34 precursor sequence fragment is obtained by amplification by using the cDNA of the ordinary reverse transcription in the example 2 as a template, and the required primers are as follows:

forward primer Pre-miRNA-T34F:

5’-CCAAGCTTAAACCCACCTCATCACCACC-3’(SEQ ID NO:13)；

reverse primer Pre-miRNA-T34R:

5’-CGGGATCCGGACGGAGGGAGTAACTTTTCC-3’(SEQ ID NO:14)。

the reaction system is as follows: 2X Phanta Max Buffer 25. mu.L, template DNA 1. mu.L, forward and reverse primers 2. mu.L each, Phanta Max Super-Fidelity DNA Polymerase 1. mu.L, dNTP Mix (10mM each) 1. mu.L, ddH₂O make up to 50. mu.L.

The reaction conditions are as follows: pre-denaturation at 95 ℃ for 3min, at 94 ℃ for 15s, at 60 ℃ for 15s, at 72 ℃ for 90s, for 32 cycles, and finally extension at 72 ℃ for 5 min.

Detecting a PCR product by 1% agarose gel electrophoresis, recovering a target fragment, connecting the fragment to a pOX vector by using Hind III and BamH I (in a connection reaction system, the pOX vector and the target fragment are prepared according to a molar ratio of 1:3-3:1, and the reaction condition is that the pOX vector and the target fragment are connected for 2h at 22 ℃ or overnight connection at 16 ℃), converting a connecting product into DH5 alpha competent cells, picking out a single clone at the 2 nd after the conversion, culturing for about 8h, extracting a plasmid, converting the obtained cloning vector into a strain DH5 alpha, carrying out enzyme digestion identification on Hind III and BamHI, carrying out colony PCR and subsequent sequencing identification (used primer sequence: UBI-seq: 5'-TTGTCGATGCTCACCCTGTTG-3'), and obtaining an OX-miRNA-T34 vector.

Construction of miRNA-T34 knockout vector

The construction of the knockout vector is described in "Ma X L, Zhang Q, Zhu Q, et al. A robust CRISPR/Cas9 system for meeting, high-efficiency multiplex gene editing in monocot and dicotplants, mol Plant 2015,8: 1274-. Firstly, designing a website according to the CRISPR/Cas9 online target of miRNA-T34 mature sequence and precursor thereof: http:// criprp. hzau.edu.cn/CRISPR 2/two gRNA targets (5'-CCGACATACGGTTTGTCCGG-3' and 5'-CCGAGAGGGAGATCCTCGAG-3') are designed, and primers are designed according to the targets. The primers required were as follows:

forward primer U3F:

5’-GGCACCGACATACGGTTTGTCCGG-3’(SEQ ID NO:15)；

reverse primer U3R:

5’-AAACCCGGACAAACCGTATGTCGG-3’(SEQ ID NO:16)；

forward primer U6 aF:

5’-GCCGCCGAGAGGGAGATCCTCGAG-3’(SEQ ID NO:17)；

reverse primer U6 aR:

5’-AAACCTCGAGGATCTCCCTCTCGG-3’(SEQ ID NO:18)。

the following experiments were performed: (1) preparation of double-chain linker: respectively taking the upstream primers and the downstream primers of 1 pair of gRNA oligonucleotide chains with equal amount of each target spot, mixing (the final concentration is 1 mu mol/L), treating at 95 ℃ for 30s, and then moving to room temperature to cool to finish annealing;

(2) enzyme digestion: preparing 20 mu L reaction systems by taking pYL-U3-gRNA and pYL-U6a-gRNA plasmids (the plasmids are disclosed in the documents of Ma XL, Zhang Q, Zhu Q, et al. A robusts CRISPR/Cas9 system for meeting, high-efficiency multiplex gene editing in monocot and dicotplants. mol Plant,2015,8: 1274-broken 1284) for 1 mu g each, and carrying out enzyme inactivation by using 5-10U Bsa I (NEB) for 20min and treating at 70 ℃ for 10 min;

(3) ligation and PCR amplification: respectively connecting the enzyme-cut pYL-U3-gRNA and pYL-U6a-gRNA plasmids with respective corresponding double-chain heads, then respectively amplifying gDNA (DNA sequence corresponding to the gRNA) by using primers B1 '/B2 and B2'/BL, firstly carrying out reaction for 30 cycles at 95 ℃ for 1min, and then carrying out reaction at 95 ℃ for 15s, 60 ℃ for 15s and 68 ℃ for 30 s; the primer sequences used were as follows:

B1’:5’-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3’(SEQ ID NO:19)；

B2:5’-AGCGTGGGTCTCGTCAGGGT CCATCCACTCCAAGCTC-3’(SEQ ID NO:20)；

B2’:5’-TTCAGAGGTCTCTCTGACACTGGAATCGGCA GCAAAGG-3’(SEQ ID NO:21)；

BL:5’-AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC-3’(SEQ ID NO:22)。

(4) and (3) purifying, enzyme cutting and connecting the product: recovering and mixing all target gDNA PCR products, performing enzyme digestion for 30min at 37 ℃ by using 20U Bsa I, and then processing for 5min at 75 ℃; the recovered pYLCRISPR/Cas9-MT (I) vector (disclosed in "Ma X L, Zhang Q, Zhu Q, et al. A robust CRISPR/Cas9 system for restriction, high-efficiency multiplex genome editing in monocot and dicotplants. mol Plant,2015,8: 1274. sup. 1284") fragments after the enzyme-cleaved fragments are purified and digested with Bsa I are ligated with T4 DNA ligand (NEB) at 20 ℃ for 2 h;

(5) transformation and plasmid sequencing: after the ligation product is transformed into DH5a competent cells, selecting a monoclonal for inoculation and culture, extracting plasmids, performing enzyme digestion identification by using Asc I, selecting a clone verified to be correct by enzyme digestion (AscI), and sending the clone to Thermo Fisher Scientific company for sequencing to obtain a KO-miRNA-T34 vector.

2. Construction of transgenic Rice

OX-miRNA-T34 vector and KO-miRNA-T34 vector were transformed into Agrobacterium tumefaciens EHA105, reference "Hiei Y, Ohta S, Komari T, Kumashiro T.efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the foundations of the T-D NA.plant J., 1994,6: 271-282", respectively, by electric stimulation, using indica rice line H4, mature seeds of Zhongdi soft occupation, and subculturing the calli after 21D; subculturing for one time for 10 days, and selecting the embryogenic callus with good state after subculturing for 2 days for the infection of the agrobacterium tumefaciens EHA105 of the vector; after co-culture for 3 days, screening resistant callus, screening by using a 50mg/L hygromycin culture medium, and screening once every 2 weeks; selecting the resistance callus with good state to perform pre-differentiation culture for 2 weeks, performing differentiation culture for 2 weeks, and transplanting the differentiated seedling into a rooting culture medium to obtain a transgenic plant. Performing PCR detection on hygromycin gene Hyg (the used primer is HygR-F/HygR-R), and performing PCR detection on miRNA-T34 precursor gene (the used primer is T34-F/T34-R), so as to obtain transgenic positive plants which over-express miRNA-T34 or knock-out miRNA-T34. The primer sequences used were as follows:

HygR-F：5’-AAGATGTTGGCGACCTCGTATT-3’(SEQ ID NO:23)；

HygR-R：5’-CGTGCTTTCAGCTTCGATGTAG-3’(SEQ ID NO:24)；

T34-F：5’-GCCCGCGGCGGTGGGGCGGC-3’(SEQ ID NO:25)；

T34-R：5’-TACCTGACGGCGGACTCGGTGAAGCGG-3’(SEQ ID NO:26)。

example 5 analysis of disease resistance of transgenic Rice overexpressing miRNA-T34 and knocking out miRNA-T34

Disease resistance of transgenic progeny positive plants was tested, and the inoculation method was as described in example 2. The results are counted after 7-9 days, and the results are shown in FIG. 4.

The results show that after the rice blast germs are inoculated, the number and the size of scabs of the miRNA-T34 overexpression transgenic plants are reduced, the disease resistance is obviously enhanced, the scabs of the leaves of the miRNA-T34 knockout plants are large and are seriously diffused, part of the leaves are directly withered, and the resistance is obviously reduced.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> cloning and application of miRNA for enhancing rice blast resistance

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> miRNA for enhancing resistance to rice blast

<400> 1

guggggcggc ggugguggcg g 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Gene encoding miRNA that enhances resistance to Rice blast

<400> 2

gtggggcggc ggtggtggcg g 21

<210> 3

<211> 260

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> precursors corresponding to miRNA

<400> 3

gcccgcggcg guggggcggc ggugguggcg gcgaagguga uggacaggaa ggagcuggcc 60

gggaggaaca aggaagggcg ggcgagaacc gagagggaga uccucgaggc cgucgaccac 120

cccuuccucc cgcgccucua cggcguggcc gagggggauc gcugguccug ccuccucacc 180

gaguucugcc ccggcggcga ccuccacguc cuccgccagc ggcagccgca ccgccgcuuc 240

accgaguccg ccgucaggua 260

<210> 4

<211> 260

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Gene encoding corresponding precursor of miRNA

<400> 4

gcccgcggcg gtggggcggc ggtggtggcg gcgaaggtga tggacaggaa ggagctggcc 60

gggaggaaca aggaagggcg ggcgagaacc gagagggaga tcctcgaggc cgtcgaccac 120

cccttcctcc cgcgcctcta cggcgtggcc gagggggatc gctggtcctg cctcctcacc 180

gagttctgcc ccggcggcga cctccacgtc ctccgccagc ggcagccgca ccgccgcttc 240

accgagtccg ccgtcaggta 260

<210> 5

<211> 52

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> RT primer sequences

<400> 5

gtcgtatcca gtgcagggtc cgaggtattc gcactggata cgacccgcca cc 52

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> miRNA-T34 forward primer

<400> 6

gcgttttgaa acggagggag c 21

<210> 7

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> LOC _ Os02g39410 Forward primer

<400> 7

acatcaacac aaccccgag 19

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> LOC _ Os02g39410 reverse primer

<400> 8

atctaacccc aaaactccct g 21

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> LOC _ Os01g46500 Forward primer

<400> 9

cttgacgatg caaatgacgc 20

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> LOC _ Os01g46500 reverse primer

<400> 10

acaacccctg agtgttcaaa c 21

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> U6 Forward primer

<400> 11

tacagataag attagcatgg cccc 24

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> U6 reverse primer

<400> 12

ggaccatttc tcgatttgta cgtg 24

<210> 13

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward primer Pre-miRNA-T34F

<400> 13

ccaagcttaa acccacctca tcaccacc 28

<210> 14

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse primer Pre-miRNA-T34R

<400> 14

cgggatccgg acggagggag taacttttcc 30

<210> 15

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward primer U3F

<400> 15

ggcaccgaca tacggtttgt ccgg 24

<210> 16

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse primer U3R

<400> 16

aaacccggac aaaccgtatg tcgg 24

<210> 17

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> Forward primer U6aF

<400> 17

gccgccgaga gggagatcct cgag 24

<210> 18

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> reverse primer U6aR

<400> 18

aaacctcgag gatctccctc tcgg 24

<210> 19

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer B1'

<400> 19

ttcagaggtc tctctcgcac tggaatcggc agcaaagg 38

<210> 20

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer B2

<400> 20

agcgtgggtc tcgtcagggt ccatccactc caagctc 37

<210> 21

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer B2'

<400> 21

ttcagaggtc tctctgacac tggaatcggc agcaaagg 38

<210> 22

<211> 37

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> primer BL

<400> 22

agcgtgggtc tcgaccgggt ccatccactc caagctc 37

<210> 23

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> HygR-F

<400> 23

aagatgttgg cgacctcgta tt 22

<210> 24

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> HygR-R

<400> 24

cgtgctttca gcttcgatgt ag 22

<210> 25

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> T34-F

<400> 25

gcccgcggcg gtggggcggc 20

<210> 26

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> T34-R

<400> 26

tacctgacgg cggactcggt gaagcgg 27

Claims

1. A miRNA for enhancing rice blast resistance, which is characterized in that: the nucleotide sequence is shown in SEQ ID NO. 1.

2. A gene encoding the miRNA for enhancing rice blast resistance of claim 1, wherein: the nucleotide sequence is shown in SEQ ID NO. 2.

3. The corresponding precursor of the miRNA for enhancing rice blast resistance of claim 1, wherein: the nucleotide sequence is shown in SEQ ID NO. 3.

4. A gene encoding a corresponding precursor of the rice blast resistance-enhancing miRNA of claim 1, wherein: the nucleotide sequence is shown in SEQ ID NO. 4.

5. Use of the miRNA of claim 1 and/or its corresponding precursor for increasing rice blast resistance.

6. Use according to claim 5, characterized in that: by utilizing a genetic engineering technology, the over-expression of the miRNA in the rice is promoted, so that the resistance of the rice to rice blast germs is improved.

7. Use according to claim 6, characterized in that: the genetic engineering technology is an over-expression miRNA technology.

8. A method for cultivating rice blast resistant rice by using an over-expression miRNA technology is characterized by comprising the following steps: the method comprises the following steps:

(1) performing reverse transcription on the total RNA of the rice leaves to obtain cDNA, and performing PCR amplification on the cDNA serving as a template and T34-OX-F and T34-OX-R serving as primers to obtain a target fragment;

9. The method for culturing rice blast resistant rice using an over-expressed miRNA technology of claim 8, wherein:

T34-OX-F：5’-CCAAGCTTAAACCCACCTCATCACCACC-3’；

T34-OX-R：5’-CGGGATCCGGACGGAGGGAGTAACTTTTCC-3’；

the primer sequences used for sequencing in step (3) are as follows:

UBI-seq：5’-TTGTCGATGCTCACCCTGTTG-3’。

10. the method for culturing rice blast resistant rice using an over-expressed miRNA technology of claim 8, wherein:

the rice in the step (1) is a rice high-rice-blast-resistance strain H4;

the PCR amplification reaction system in the step (1) comprises the following components in every 50 mu L of reaction system: 2 × Phanta Max Buffer25 μ L, template DNA 1 μ L, forward and reverse primers 2 μ L each, Phanta Max Super-Fidelity DNA Polymerase 1 μ L, dNTP Mix 1 μ L, ddH₂Measuring the residual O quantity;

the reaction conditions of the PCR amplification in the step (1) are as follows: pre-denaturation at 95 deg.C for 3min, at 94 deg.C for 15s, at 60 deg.C for 15s, at 72 deg.C for 90s, for 32 cycles, and final extension at 72 deg.C for 5 min;

in the connected reaction system in the step (2), the pOX carrier and the target fragment are prepared according to the molar ratio of 1:3-3: 1;

the reaction conditions of the connection in the step (2) are as follows: ligation was performed at 22 ℃ for 2h or 16 ℃ overnight;

and (4) selecting the single colony in the step (3) as the transformed 2 nd day, wherein the culture time is 7-9 h.