CN114807174B

CN114807174B - Genetic locus for reversely regulating resistance of rice to rice blast bacteria and application thereof

Info

Publication number: CN114807174B
Application number: CN202210590549.5A
Authority: CN
Inventors: 刘立娜; 李成云; 李进斌; 杨宝明; 王一; 吴奇; 浦鑫; 余萍
Original assignee: Yunnan Agricultural University; Institute of Agricultural Environment and Resources of Yunnan Academy of Agricultural Sciences
Current assignee: Yunnan Agricultural University; Institute of Agricultural Environment and Resources of Yunnan Academy of Agricultural Sciences
Priority date: 2022-05-27
Filing date: 2022-05-27
Publication date: 2024-02-20
Anticipated expiration: 2042-05-27
Also published as: CN114807174A

Abstract

The invention provides a genetic locus for reversely regulating and controlling rice blast fungus resistance and application thereof, belonging to the technical field of plant genetic engineering. The nucleotide sequence of the genetic locus is shown as SEQ ID NO. 1. The invention constructs an over-expression vector and a strain containing the genetic locus XLO-047603 complete sequence, converts the over-expression vector and the strain into a rice disease-resistant variety to obtain an over-expression mutant strain, and inoculates a rice blast strain, and a disease investigation result shows that the over-expression mutant strain reduces the resistance of rice to rice blast bacteria; the knockdown vector transformed seedlings are constructed to inoculate a plurality of strains of the rice blast fungi, and disease investigation results prove that the knockdown transformed seedlings inhibit the expression of XLO_ 047603 and can obviously improve the resistance of rice to different strains of the rice blast fungi. Experiments show that the genetic locus XLO_ 047603 plays a reverse regulation role in the defense response of rice to rice blast. The invention provides a new strategy and genetic resource for cultivating a novel rice variety with broad-spectrum rice blast resistance, and has very important theoretical significance and application value.

Description

Genetic locus for reversely regulating resistance of rice to rice blast bacteria and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a genetic locus for reversely regulating and controlling rice blast fungus resistance and application thereof.

Background

China is a large agricultural country with long-term farming civilization, with 7% of the world land being used to keep up with nearly 22% of the world population. The grain crops in China mainly comprise rice, wheat and corn, but a plurality of pathogenic fungi seriously endanger the yield and quality of the grain crops, and if rice blast called 'rice cancer' is generated, the rice blast brings great threat to the safety of rice in China and even the world every year. Rice blast causes significant economic losses worldwide. The pathogenic bacteria can infect different parts of the rice, wherein the rice yield loss caused by leaf blast and neck blast is most serious. It was counted that rice blast reduced rice yield by 10-30% (Talbot, 2003). Rice is a food crop from which more than half of the world's population depends, and by the year 2030, it was shown by the international food policy institute analysis that humans should produce 1.38 times the current rice yield over a smaller planting area to meet the population growth needs (Wilson and Talbot, 2009). In view of the severe situation, we need to know the disease resistance of rice deeply, and reduce the loss of rice yield and quality caused by rice blast bacteria as much as possible.

Crop immunization is one of the most economical, sustainable and ecologically relevant disease management strategies. Plants have evolved two layers of the natural immune system in long-term interaction with pathogenic bacteria, pathogen-associated molecular Pattern-triggered immunity (PTI, pattern-Triggered Immunity) and effector-triggered immunity (ETI). The disease resistance genes are found based on ETI reaction, which accords with the genetic theory of gene pair, namely, pathogenic genes of rice blast bacteria and disease resistance genes of rice are in one-to-one correspondence, however, the disease resistance triggered by single genes often loses the resistance effect of the pathogenic bacteria after 2-3 years of crop planting due to rapid variation of the pathogenic bacteria. At present, a broad-spectrum and durable disease-resistant crop variety is lacking. PTI is the first line of defense against pathogen infection in plants, and a series of quick response mechanisms including accumulation of active oxygen and callose are generated, so that the enhancement of PTI composition can be used as a new strategy to widely improve the effectiveness of ETI on various diseases in crops (Yuan et al, 2021; nagou et al, 2022), and the development of broad-spectrum and durable disease-resistant varieties is expected. Therefore, the inventor researches constitutive genetic loci in rice materials, and discovers that the constitutive genetic loci have obvious difference with XLO_ 047603 on the basis of the genetic resistance and disease-sensitive rice through gene network analysis of differential expression genetic loci, so that the expression of genes related to chitinase synthesis is inhibited, and PTI reaction of rice to rice blast bacteria infection is inhibited. The genetic locus is not reported in the literature at present. The invention identifies a genetic locus for reversely regulating the resistance of rice to rice blast bacteria, and provides valuable information for regulating the interaction of rice and rice blast.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings in the prior art and provide a genetic locus for reversely regulating and controlling the resistance of rice to rice blast bacteria and application thereof.

The above object of the present invention is achieved by the following technical solutions:

a genetic locus for reversely regulating and controlling the resistance of rice to rice blast bacteria is shown in SEQ ID NO. 1. The gene is proved to be positioned on the 11 th chromosome of rice, and the total length is 815bp. The invention has important application value for molecular genetic breeding of important grain crop disease-resistant varieties such as rice and the like.

The invention also protects a knockdown expression vector containing the genetic locus for reversely regulating and controlling rice blast resistance and recombinant bacteria of the plant knockdown expression vector.

The invention also protects the application of the genetic locus for reversely regulating and controlling the rice blast resistance, the plant knockdown expression vector or the recombinant bacteria in improving the rice blast resistance.

The application steps in improving the rice blast resistance of the rice comprise: transforming the plant knockdown expression vector containing the genetic locus for reversely regulating and controlling the rice blast resistance into agrobacterium, preparing agrobacterium suspension, and transforming the agrobacterium suspension or the recombinant bacterium into infected rice to obtain rice plant with the rice blast resistance, so that the genetic locus for reversely regulating and controlling the rice blast resistance is not expressed or is expressed lowly, thereby improving the rice plant resistance to the rice blast.

A second object of the present invention is to provide the use of said genetic locus for the reverse regulation of rice blast resistance in the identification of rice blast resistance.

The identification steps of the rice blast resistance in the rice by utilizing the genetic locus for reversely regulating the rice blast resistance comprise the following steps:

1) Extracting total RNA of rice to be detected;

2) Preparing cDNA by reverse transcription;

3) Using the cDNA as a template, using the sequence as shown in SEQ ID NO:14 and SEQ ID NO:15, the reverse regulation of the rice to the rice blast resistance genetic locus high expression of rice variety as disease resistance variety, the reverse regulation of the rice to the rice blast resistance genetic locus low expression or not expression of rice variety as disease resistance variety.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention provides a genetic locus XLO_ 047603 for reversely regulating and controlling rice blast resistance, application thereof in identifying rice blast resistance and application thereof in improving rice blast resistance. The nucleotide sequence of the genetic locus which is obtained by screening and has strong relevance to PTI is shown as SEQ ID NO: 1.

2. The genetic locus can be used for identifying the rice blast resistance of the rice, that is to say, the genetic locus can be used as a molecular marker for identifying the rice blast resistance of the rice variety.

3. The invention constructs the expression vector and the strain containing the genetic locus. After the genetic locus obtained by the invention is over-expressed, the obtained over-expressed transformed seedling is inoculated with a rice blast strain, and the disease investigation shows that the transcript is highly expressed in the disease-resistant variety and is infected by the rice blast strain; the knockdown carrier transformed seedling is inoculated with the rice blast strain, and the disease investigation result shows that the expression of the transcript is inhibited in the infected variety, so that the disease resistance of the rice to the rice blast bacteria infection can be improved, and the genetic locus (XLO_ 047603) is proved to reversely regulate the resistance of the rice to the rice blast bacteria.

4. Experiments prove that the genetic locus XLO_ 047603 plays a negative regulation role in defending response of different over-expression strains of rice to Pyricularia oryzae. The invention provides a new strategy and genetic resource for cultivating new rice disease-resistant varieties, in particular new rice blast-resistant varieties, and has very important theoretical significance and application value.

Drawings

FIG. 1 is a sequence position diagram of a genetic locus XLO-047603;

FIG. 2 is an enzyme digestion map and map of the over-expression vector XLO_ 047603, annotated: ecorV cleavage gave 4 bands: 1134bp;1168bp;2691bp;5324bp. The Marker stripe size is: 5000bp;3000bp;2000bp;1000bp;750bp;500bp;250bp;100bp;

FIG. 3 shows the results of gene detection of rice seedlings transformed with over-expressed XLO_ 047603, and is given by: the left to right sample order is: a Marker; a negative control; OE86-1; OE86-2; OE86-3; OE86-12; OE86-13; OE86-16; OE86-19;

FIG. 4 shows the index change of the over-expressed strain XLO_ 047603;

FIG. 5 is a graph of phenotypic symptoms of an XLO-047603 over-expressed strain;

FIG. 6 is a schematic diagram of the knockdown vector of XLO-047603;

FIG. 7 shows the results of gene detection of knocked-down (XLO-047603) rice seedlings, notes: the left to right sample order is: a positive control; a Marker; a negative control; d86-1; d86-2; d86-3; d86-4; d86-5; d86-6; d86-7; d86-8; d86-9; d86-10; d86-13;

FIG. 8 is a graph showing the change in disease index of the XLO_ 047603 knockdown mutant strain;

FIG. 9 is a diagram of the phenotype symptoms of the XLOC_047603 knockdown strain;

FIG. 10 is a graph showing the expression level of XLOC_047603 amplified by using the designed primers in various rice plants.

Detailed Description

The invention is further illustrated in the following drawings and specific examples, which are not intended to limit the invention in any way. Unless specifically stated otherwise, the reagents, methods and apparatus employed in the present invention are those conventional in the art.

Reagents and materials used in the following examples are commercially available unless otherwise specified. The primer sequences used were all synthesized by the Wohan long-range biotechnology Co.

Example 1: screening of genetic locus XLO_ 047603

1.1 materials

Host material: the rice disease-sensitive variety LTH and a near-line rice variety IRBLsh-S carrying a resistance gene Pish.

Rice blast bacterial strain: y92-66b.

1.2 Experimental methods

1.2.1 sample collection

Three leaves one heart stage rice seedling spray inoculation (spore concentration: 1×10) ⁵ Moisture more than 98%, darkness, heat preservation at 28 ℃ for 24 hours, and collecting samples, wherein each sample is collected and fully unfolded rice leaves (leaf 2 and leaf 3) are placed into liquid nitrogen for quick freezing and then stored in an ultra-low temperature refrigerator. Each sample was subjected to 3 biological replicates. The remaining seedlings were transferred to the greenhouse for further cultivation and disease investigation was performed at 7 d. Wherein LTH lesions are rated 0-2 as disease resistant (R) and 3-5 as disease susceptible (S) (Li et al, 2014); disease index = Σ (number of individual disease plants x number of corresponding stages)/(total number of investigation x highest number of stages) ×100, t test for difference significance analysis.

1.2.2 transcriptional profiling and sequencing

Total RNA of extracted rice leaves is detected by 1.0% agarose gel electrophoresisRNA quality, spectrophotometry to detect RNA purity, qubie to detect RNA concentration, and Agilent 2100 to detect RNA integrity. And (5) detecting qualified RNA to construct a library and sequencing. The basic steps are as follows: (1) rRNA was removed and then the rRNA residues were removed by ethanol precipitation. (2) Using the kitUltra ^TM Directional RNA Library Prep Kit, NEB, usa). (3) purifying the product. (4) Agilent 2100 detects library quality. The library qualified for detection was sequenced by using an IlluminaHiseq 2000 sequencing platform by the company limited of biological information technology of origin caused by beijing nozali, obtaining reads of about 125bp length.

1.2.3 analysis of the genetic loci for differential expression, screening XLOC047603

The edge software package (Robinson et al 2010) was used to identify differentially expressed genetic loci. Compared with corresponding mock after the treatment of the inoculated strain, the genetic locus p-value with obvious difference of the expression quantity is less than 0.05, and lg FC is more than or equal to 1 or less than or equal to-1 is used as a candidate genetic locus for research.

1.3 experimental results

(1) Genetic locus analysis of differential expression

The genetic background of different disease-resistant rice materials is analyzed, and the result shows that the chitinase catalysis process in the disease-resistant varieties has obvious difference in chitinase activity related gene expression between the disease-resistant varieties and the disease-resistant varieties. Gene network analysis and R script analysis were used to find that PTI composed chitinase-related gene was significantly and negatively correlated with genetic locus XLO_ 047603 (R) ² >0.9 and FDR<0.05 Indicated that XLO_ 047603 and PTI constitute chitinase related genes have significant negative regulation effects.

(2) Screening for a genetic locus XLO_ 047603 with differential expression

Co-expression results show that in the strongly related genetic locus, XLO_ 047603 is closely related to the chitinase related gene composed of PTI, and the resistance of rice to rice blast is probably reversely regulated. XLOC_047603, the whole length 567bp, is located on rice chromosome 11, and the sequence position diagram is shown in FIG. 1 and the sequence is shown in SEQ ID NO. 1. The genetic locus is the newly discovered transcript.

Example 2 construction of overexpression vector at genetic locus XLO-047603 and genetic transformation

In order to verify the disease resistance of the genetic locus for reversely regulating rice to rice blast bacteria, an over-expression vector containing the complete sequence of the XLO_ 047603 genetic locus is constructed, agrobacterium is transformed and then transformed into a rice disease-resistant variety, and the function of reversely regulating the disease resistance is verified.

2.1 materials

Transformation of rice wild type: disease-resistant variety IRBLsh-S.

Inoculating strains: y92-66b and Guy11.

2.2 Experimental methods

2.2.1 construction of the overexpression vector

(1) Rice leaf genome DNA extraction

Using a genomic DNA purification kit (Promega, A1120), rice seedling DNA was extracted and purified according to the instructions. 1.5% agarose gel electrophoresis detects the integrity of DNA, and the obtained genome DNA has single band and no dragging, and represents that the genome DNA has good integrity and is used for subsequent experiments.

(2) Designing and synthesizing primers required by an over-expression vector:

XLOC_047603-O(+)：cagtCGTCTCacaactgtcatcttaaggcgtaact

XLOC_047603-O(-)：cagtCGTCTCatacaggtttttgccaattccattt

the size of the product fragment shown in SEQ ID NO. 2-3 is 567bp.

(3) PCR reaction

A50. Mu.L PCR reaction was performed, involving DNA templates: 1 μl; buffer: 5. Mu.L; mg of ²⁺ ：4μL；dNTP：2μL；P+：2μL；P-：2μL；H ₂ O: 34. Mu.L; taq enzyme: 2U. The PCR reaction procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing and extending for 45s at 50 ℃; extending at 72 ℃ for 12s; cycling for 30 times and extending at 72 ℃ for 10min.

(4) Agarose gel electrophoresis and product recovery

The sizes of the PCR products detected by 1.5% agarose electrophoresis are 567bp respectively; the electrophoresis fragment was excised, subjected to sol recovery, and the recovery procedure was performed as described in the kit, and DNA (labeled iDNAX 2) was recovered by dissolving it in water in a total volume of 30. Mu.L, and used for carrier ligation after detection.

(5) Vector and iDNAX2 cleavage and purification

The vector and iDNAX2 were digested with 20. Mu.L (Buffer: 13. Mu.L; H) ₂ O:13 μL; basI/Eco3II:1 μl; pBWA (V) HS-ccdB or iDNAX2:4 μl). And the enzyme digestion is carried out for 1h at 37 ℃. The vector and recovered fragment cleavage products were combined and purified using a PCR purification kit (labeled PBWA-iDNAX 2) for ligation reactions.

(6) Ligation reaction and product transformation competence and plaque PCR identification

10. Mu.L of the reaction system (Buffer: 1. Mu.L; H) ₂ O: 5.5. Mu.L; t4 ligase: 1 μl; PBWA-idrax 2:2.5 μl). And (3) connecting at 20 ℃ for 1h to obtain a connecting product. 5-10. Mu.L of the ligation product was transformed into E.coli competent cells, transformed into (kanamycin) resistant plates, and incubated at 37℃for 12h for plaque PCR identification. 10 bacterial plaques were picked up for 1.5mL EP tube-connected bacteria and PCR identification, 25. Mu.L of the PCR reaction system (template: 1. Mu.L; buffer: 2.5. Mu.L; mg) ²⁺ ：4μL；dNTP：1μL；HS)35seq/35seq(G)：1μL；NOSseq-R/Noseq(G)：1μL；H ₂ O: 16.5. Mu.L; taq enzyme: 10U). The PCR reaction procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing and extending for 45s at 50 ℃; extending at 72 ℃ for 12s; cycling for 30 times and extending at 72 ℃ for 10min.

2.0% agarose electrophoresis detects fragments with target bands of about 157 bp. Taking bacterial solutions corresponding to 1-3 positive strips, taking 100 mu L of bacterial solutions, carrying out sample feeding and sequencing, inoculating the rest 400 mu L of bacterial solutions into a resistant LB containing 5-10mL (kanamycin), shaking a test tube, and after the result to be sequenced comes out, correctly taking a tube of bacterial solution to extract plasmids (named pBWA (V) HS-OE-LLN-47603).

2.2.2 vector transformation of Agrobacterium

The identified correct over-expression vector plasmid pBWA (V) HS-OE-LLN-47603 is transformed into agrobacterium EHA105, and agrobacterium single colony is picked and placed in culture solution for shake culture. And (3) placing the cultured bacterial liquid into a centrifuge tube, centrifuging, and taking the supernatant to prepare an agrobacterium suspension for rice transformation.

2.2.3 conversion of disease-resistant Rice variety IRBLsh-S

(1) Taking mature wild disease-resistant rice variety IRBLsh-S seeds, selecting sterile and full high-quality seeds, mechanically dehulling, sterilizing, and inoculating into a callus induction culture medium, wherein the formula of the culture medium is as follows: MS+2, 4-D2.0 mg/L+20 g/L sugar.

(2) Picking out callus with the size of 0.2cm multiplied by 0.2cm, and placing the callus in agrobacterium suspension for infection for 5min; then placing the callus on a co-culture medium for culture, wherein the co-culture medium comprises the following formula: MS+NAA 0.2mg/L+6-BA 1.0mg/L.

(3) Resistant callus culture: taking out the callus, airing, and transferring the callus to a screening culture medium for first screening; the initial calli with the growing resistant calli were transduced onto new medium for a second selection. The formula of the sieve culture medium is as follows: MS+2, 4-D0.2-0.5 mg/L+50mg/L hygromycin; the second-sieve culture medium is as follows: MS+2, 4-D0.2-0.5 mg/L+80mg/L hygromycin.

(4) Selecting resistant callus for bud culture: transferring the selected callus into a bud differentiation medium, and placing the callus into a constant temperature culture room for waiting differentiation into seedlings; growing to about 1cm, and moving to rooting culture medium for strengthening seedling. The formula of the differentiation medium is as follows: MS+NAA 0.2-0.5 mg/L+6-BA 1.0mg/L; the rooting culture medium comprises the following formula: MS and NAA are 0.2-0.4 mg/L.

(5) The primers for amplifying the rooting seedlings by using hygromycin genes are hyg (280) +:5'-ACGGTGTCGTCCATCACAGTT TGCC-3', the post primer is hyg (280) -:5'-TTCCGGAAGTGCTTGACATTGGGGA-3', the sequence of which is shown as SEQ ID NO. 4-5, and the annealing temperature is 56 ℃. The PCR product obtained after amplification is detected by 1.5% agarose gel electrophoresis, and a gel imaging system detects the product band type and analyzes the product band type to confirm that the conversion is successful. And (5) hardening seedlings in a rooting Miao Wen room, and culturing until T1 generation seeds are harvested.

2.2.4XLOC_047603 over-expression transformed seedlings identification of disease resistance

(1) Transformed seedling culture

Seedling raising adopts a seedling raising tray method. Mixing rice soil, humus soil and plant ash uniformly according to a ratio of 1:1:1 before sowing, and carrying out sun exposure and disinfection. Selecting full riceSeed disinfection (1.5% naclo disinfection soak for 5min, clean water rinse until there is no smell of sodium hypochlorite). And respectively placing the sterilized T1 generation seeds of the over-expression transformed seedlings and the seeds of the wild LTH into a sterilized culture dish, and continuously soaking the seeds in clear water. Accelerating germination in a constant temperature incubator at 28 ℃ until the germination appears white, and sowing the germination in a seedling raising tray. Rice grows to a three-leaf one-heart stage (about 21 d) for inoculation of Pyricularia oryzae spores (1×10) ⁵ personal/mL) test.

(2) Disease investigation and sampling

And transferring the rice seedlings which are subjected to dark culture for 24 hours after spray inoculation to a greenhouse, carrying out disease degree investigation in 7d, determining 0-2 level of disease spots as disease resistance (R), determining 3-5 level as disease susceptibility (S), and calculating the disease index. Disease index = Σ (number of diseased leaves at each stage x representative value at each stage)/(total number of investigated leaves x representative value at highest stage) ×100, and disease-resistant rice variety IRBLsh-S is used as a control.

2.3 experimental results

(1) Successful construction of rice genetic locus XLO_ 047603 over-expression vector

The nucleotide sequence of the candidate rice XLO_ 047603 is utilized to successfully construct an over-expression vector of XLO_ 047603, and a vector restriction map and a vector map are shown in FIG. 2.

(2) Transformed seedling with successful over-expression of gene detection XLO_ 047603

An over-expression vector was constructed from the XLO_ 047603 sequence and transformed into IRBLsh-S to form an over-expression strain of XLO_ 047603 (OE 86). IRBLsh-S is resistant to Y92-66b infection. By gene detection, the different over-expressed strains (OE 86-1; OE86-2; OE86-3; OE86-12; OE86-13; OE86-16; OE86-19; OE 86-24) were positive strains (FIG. 3). All positive transformants were used for subsequent disease resistance identification.

(3) Response changes of rice XLO_ 047603 over-expressed lines to strain infection

The experimental results show that: the over-expressed strains (OE 86-1; OE86-2; OE86-3; OE86-12; OE86-13; OE86-16; OE86-19; OE 86-24) showed different degrees of susceptibility to infection with Y92-66b (FIG. 4, FIG. 5), with disease indices of 24.4 respectively; 25.2;45.0;16.7;40.5;36.3;44.0;28.0, which is significantly higher than the disease index of the disease-resistant control IRBLsh-S by 7.03. The results further demonstrate that: XLOC047603 reverse regulates rice resistance to Pyricularia oryzae.

Example 3: construction of knock-down expression vector at genetic locus XLO_ 047603 and genetic transformation

In order to apply the genetic locus for reversely regulating and controlling the resistance of rice to rice blast bacteria, a knockdown vector is constructed, and the rice transformed seedlings with disease resistance are obtained.

3.1 materials

Transforming a rice wild type disease-sensitive variety: LTH.

Inoculating rice blast bacterial strain: y92-66b and Guy11.

3.2 Experimental methods

3.2.1 vector construction

(1) Rice leaf genome DNA extraction

(2) The following three pairs of primers were synthesized

XLO-047603-F primer:

XLOC_047603-F(+):cagtCGTCTCacaacgaacacatgcatcagttcattct

XLOC_047603-F(-):cgatCGTCTCacagggttctgaacctaaatagcgtgat

loop primer:

Loop(+):cgatGGTCTCacctgcaggtctagtttttctcct

Loop(-):cgatGGTCTCagcccgggctctgtaactatcatc

XLO-047603-R primer:

XLOC_047603(+):cagtCGTCTCagggcgcttctgaacctaaatagcgtgat

XLOC_047603-R(-):cgatCGTCTCatacagaacacatgcatcagttcattct

the sequence is shown as SEQ ID NO. 6-11.

(3) PCR reaction

3 PCR reaction of 50 mu L system is carried out on the primers respectively, and DNA template: 1 μl; buffer: 5. Mu.L; mg of ²⁺ ：4μL；dNTP：2μL；P+：2μL；P-：2μL；H ₂ O: 34. Mu.L; taq enzyme: 2U. The PCR procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing and extending for 45s at 50 ℃; extending at 72 ℃ for 12s; the cycle number is 30 times, and the extension is carried out for 10min at 72 ℃.

(4) Agarose gel electrophoresis and product recovery

1.5% agarose electrophoresis detects that the sizes of 3 pairs of primer PCR products are 202bp, 200bp and 202bp respectively; the electrophoresis fragment was excised, put into the same system, subjected to sol recovery, and the recovery procedure was performed according to the kit instructions, and DNA (labeled LDNAX 2) was recovered by dissolving with water in a total volume of 30. Mu.L, and used for carrier ligation after detection.

(5) Vector and LDNAX2 enzyme digestion and purification

The vector and LDNAX2 were digested with 20. Mu.L of system D, buffer:13 μL; h ₂ O:13 μL; basI/Eco3II:1 μl; pBWA (V) HS-ccdB or LDNAX2: 4. Mu.L. And the enzyme digestion is carried out for 1h at 37 ℃. The vector and recovered fragment cleavage products were combined and purified using a PCR purification kit (labeled PBWA-LDNAX 2) for ligation reactions.

10. Mu.L of the reaction system (Buffer: 1. Mu.L; H) ₂ O: 5.5. Mu.L; t4 ligase: 1 μl; PBWA-LDNAX2:2.5 μl). And (3) connecting at 20 ℃ for 1h to obtain a connecting product. 5-10. Mu.L of ligation product was transformed into E.coli competent, transformed into (kanamycin) resistant plates and incubated at 37℃for 12h for plaque PCR identification. 10 plaques were picked and 1.5mL EP tube joint bacteria and PCR identified simultaneously. 25. Mu.L of PCR reaction system (template: 1. Mu.L; buffer: 2.5. Mu.L; mg) ²⁺ : 4. Mu.L; dNTP:1 μl; HS) 35seq/35seq (G): 1 μl; NOSeq-R/Noseq (G): 1 μl; H2O: 16.5. Mu.L; taq enzyme: 10U). The PCR reaction procedure was: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s; annealing and extending for 45s at 50 ℃; extending at 72 ℃ for 12s; the cycle number is 30 times, and the extension is carried out for 10min at 72 ℃.

The 1.5% agarose electrophoresis detects fragments with the target band of about 194 bp. Taking bacterial solutions corresponding to 1-3 positive strips, taking 100 mu L of bacterial solutions, carrying out sample feeding and sequencing, inoculating the rest 400 mu L of bacterial solutions into a resistant LB containing 5-10mL (kanamycin), shaking a test tube, and after the result to be sequenced comes out, correctly taking a tube of bacterial solution to extract plasmids (named pBWA (V) HS-RNAi-LLN-2018-3).

3.2.2 vector transformation of Agrobacterium

The identified correct knocked-down vector plasmid pBWA (V) HS-RNAi-LLN-2018-3 is transformed into agrobacterium EHA105, and agrobacterium single colony is picked and placed in culture solution for shake culture. And (3) placing the cultured bacterial liquid into a centrifuge tube, centrifuging, and taking the supernatant to prepare an agrobacterium suspension for rice transformation.

3.2.3 transformation of rice-susceptible variety LTH

(1) Mature wild rice LTH seeds are taken, sterile and full high-quality seeds are selected, mechanically dehulled, sterilized and inoculated into a callus induction culture medium, and the culture medium comprises the following formula: MS+2, 4-D2.0 mg/L+20 g/L sugar.

(5) The primers for amplifying the rooting seedlings by using hygromycin genes are hyg (280) +:5'-ACGGTGTCGTCCATCACAGTT TGCC-3', the post primer is hyg (280) -: the 5'-TTCCGGAAGTGCTTGACATTGGGGA-3' sequence is shown in SEQ ID NO. 12-13 for PCR amplification, and the annealing temperature is 56 ℃. The PCR product obtained after amplification is detected by 1.5% agarose gel electrophoresis, and a gel imaging system detects the product band type and analyzes the product band type to confirm that the conversion is successful. And (5) hardening seedlings in a rooting Miao Wen room, and culturing until T1 generation seeds are harvested.

Disease resistance identification of 3.2.4XLOC047603 knockdown transformed seedlings

(1) Transformed seedling culture

Seedling raising adopts a seedling raising tray method. Mixing rice soil, humus soil and plant ash uniformly according to a ratio of 1:1:1 before sowing, and carrying out sun exposure and disinfection. The full rice seeds were selected for sterilization (1.5% naclo sterilization soak for 5min, and rinsed with clear water until there was no smell of sodium hypochlorite). And respectively placing the sterilized T1 generation seeds of the knocked-down transformed seedlings and the seeds of the wild LTH into a sterilized culture dish, and continuously soaking in clear water. Accelerating germination in a constant temperature incubator at 28 ℃ until the germination appears white, and sowing the germination in a seedling raising tray. The rice was grown to a trefoil one heart stage (about 21 d) for inoculation experiments.

(2) Disease investigation and sampling

The seedlings of rice cultured in the dark for 24 hours after spray inoculation are transferred to a greenhouse, 7d is inoculated for investigation of the disease degree, 0-2 grade of disease spots are identified as disease resistance (R), 3-5 grade are identified as disease susceptibility (S), and the disease index is calculated, wherein the disease index = Σ (number of disease leaves at each stage x representative value at each stage)/(total leaf number of investigation x highest representative value) ×100. LTH is used as a disease-sensitive control variety.

3.3 experimental results

(1) Successful construction of rice XLOC_047603 knockdown vector

The knockdown vector of XLO_ 047603 is successfully constructed by using the nucleotide sequence of the candidate rice XLO_ 047603, and a vector restriction map and a vector map are shown in FIG. 6.

(2) Gene detection XLOC_047603 successful knockdown transformed seedlings

A knockdown vector was constructed from the XLO_ 047603 sequence and transformed into the LTH wild type to obtain an XLO_ 047603 knockdown transformant (D86). Through gene detection, different knockdown strains (D86-1; D86-2; D86-3; D86-4; D86-5; D86-6; D86-7; D86-8; D86-9; D86-10; D86-13; D86-14; D86-15; D86-16) are positive strains (FIG. 7) and can be used for subsequent disease resistance identification.

(3) Response changes of rice XLO_ 047603 knockdown lines to strain infection

The data indicate that: the knockdown lines (D86-1; D86-2; D86-3; D86-5; D86-6; D86-7; D86-9; D86-10; D86-14; D86-15; D86-16) exhibited a different degree of resistance to Y92-66b infection compared to the wild-type control (FIG. 8, FIG. 9), with a disease index of 37.0, respectively; 41.7;36.4;36.8;35.4;23.6;31.0;34.8;33.6;47.9;46.1, significantly lower than the disease index 71.6 of the susceptibility control LTH. The results prove that: the XLOC047603 rice knockdown line increased its resistance response to rice blast.

Example 4: fluorescent quantitative PCR (polymerase chain reaction) detection of expression quantity of rice XLO_ 047603 and identification of disease resistance of different rice varieties

4.1 materials

Variety of rice: susceptible varieties LTH and resistant varieties IRBLsh-S.

Rice blast bacterial strain: strain Y92-66b; strain Guy11.

4.2 Experimental methods

4.2.1 extraction of RNA from Rice leaves

RNA extraction kit for extracting total RNA of rice leavesSuper total RNA extraction kit LS 1040), performed according to the instructions, with slight modifications.

4.2.2RNA reverse transcription

Reverse transcription of the RNA that was detected to be acceptable was performed using a reverse transcription kit (GoScriptTM Reverse Transcription System, A5001) according to the protocol.

4.2.3 fluorescent quantitative verification of candidate genetic locus expression level

In order to determine and develop a rapid method for detecting the expression quantity of the XLO_ 047603 genetic locus, a fluorescent quantitative PCR specific primer is designed for detecting the expression of the genetic locus, total RNA of each sample is extracted, and qRT-PCR verification is carried out after reverse transcription. qRT-PCR reaction system (performed in dark conditions and on ice): cDNA 2.0. Mu.L; SYBR Premix Ex Taq II 10.0.0 μL; 0.4. Mu.L of a front primer; 0.4. Mu.L of post-primer; RNA-free water was added to a total volume of 20. Mu.L. The primers used were xloc_047603PF: TCCTCTGTCGGTCTGTCCTA; xloc_047603PR: GCCTCCAACAAACAGACTTGT, the sequence of which is shown in SEQ ID NO. 14-15. The product size was 106bp.

And after the preparation of the reaction system is completed, fully and uniformly mixing, and loading the sample after sealing the membrane. Ct value detection was performed using a fluorescent quantitative PCR instrument (Bio-Rad Thermal Cycler, USA). The reaction procedure is: pre-denaturation at 95℃for 3min; denaturation at 95℃for 20s; annealing and extending for 20s at 58 ℃; collecting fluorescent signals at 65 ℃; the number of cycles was 45. Dissolution profile parameters: the temperature is raised from 60 ℃, and a fluorescence signal is acquired for one cycle when the temperature is raised by 0.5 ℃ for 80 cycles. Each sample was set up with 3 biological replicates, 3 technical replicates, ct values recorded, and relative expression levels calculated.

4.3 experimental results

The expression level of XLO_ 047603 in host rice after LTH and IRBLsh-S and inoculation of strain Y92-66b, or Guy11 is shown in FIG. 10, and the qRT-PCR detection result is consistent with the sequencing result. Experimental results show that the expression level of the molecular marker XLO_ 047603 developed by us in the rice infected variety LTH and the rice infected variety IRBLsh-S has a significant difference, the size of the product is 106bp, and the sequence of the product is shown as SEQ ID NO: 16: the method comprises the following steps:

TCCTCTGTCGGTCTGTCCTACATCCTTCAGTTATCAGTGCCAGATCAATGATCACAAGAGTTGATATTTTGGAGACCACAAATGCACAAGTCTGTTTGTTGGAGGC。

the primer and the product can accurately reflect the variation of the expression quantity of XLO_ 047603. Therefore, the molecular markers (i.e., primers) and products used in the qRT-PCR detection can be used for the detection of the expression level of XLO_ 047603; can be used for disease resistance identification of different rice varieties, namely, the rice variety with high expression level is a rice blast-infected variety containing the reverse genetic locus, and the rice variety with low expression or no expression is a rice blast-resistant variety without the reverse genetic locus.

SEQUENCE LISTING

<110> institute of agricultural environmental resource at academy of agricultural sciences of Yunnan province

Yunnan Agricultural University

<120> genetic locus for reverse regulation of rice blast resistance and use thereof

<130> 1221

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 567

<212> RNA

<213> Rice (Oryza sativa L.)

<400> 1

ugucaucuua aggcguaacu aaaugacaua gccgguccca agcccggaaa aaggaggagg 60

ggauauaauc uuguauacuu cuauauugaa augaugcucu gcugcuaaau acaucauuug 120

auauuuucuu ggaaguuucu gcacuuuuau caagcuaauu ucaucuucag uaauggauca 180

gaauaguuau ggagagucau ccacucuguu uaauuguuca acaaaucuga uucuagacua 240

uuuuaguuug accucauuac aguccaguuu uccaguaaaa gcaauuugga ugaacacaug 300

caucaguuca uucuccucug ucggucuguc cuacauccuu caguuaucag ugccagauca 360

augaucacaa gaguugauau uuuggagacc acaaaugcac aagucuguuu guuggaggcu 420

uuaguauuuu ucaugaucaa aacuggugca gaaaacaucu guuaucacau aucacgcuau 480

uuagguucag aacauaauua ugaagcacau gaucaacaaa uaaaaaugau gaauuuaaau 540

ucaugaaaaa uggaauuggc aaaaacc 567

<210> 2

<211> 35

<212> DNA

<213> artificial sequence

<400> 2

cagtcgtctc acaactgtca tcttaaggcg taact 35

<210> 3

<211> 35

<212> DNA

<213> artificial sequence

<400> 3

cagtcgtctc atacaggttt ttgccaattc cattt 35

<210> 4

<211> 25

<212> DNA

<213> artificial sequence

<400> 4

acggtgtcgt ccatcacagt ttgcc 25

<210> 5

<211> 25

<212> DNA

<213> artificial sequence

<400> 5

ttccggaagt gcttgacatt gggga 25

<210> 6

<211> 38

<212> DNA

<213> artificial sequence

<400> 6

cagtcgtctc acaacgaaca catgcatcag ttcattct 38

<210> 7

<211> 38

<212> DNA

<213> artificial sequence

<400> 7

cgatcgtctc acagggttct gaacctaaat agcgtgat 38

<210> 8

<211> 34

<212> DNA

<213> artificial sequence

<400> 8

cgatggtctc acctgcaggt ctagtttttc tcct 34

<210> 9

<211> 34

<212> DNA

<213> artificial sequence

<400> 9

cgatggtctc agcccgggct ctgtaactat catc 34

<210> 10

<211> 39

<212> DNA

<213> artificial sequence

<400> 10

cagtcgtctc agggcgcttc tgaacctaaa tagcgtgat 39

<210> 11

<211> 38

<212> DNA

<213> artificial sequence

<400> 11

cgatcgtctc atacagaaca catgcatcag ttcattct 38

<210> 12

<211> 25

<212> DNA

<213> artificial sequence

<400> 12

acggtgtcgt ccatcacagt ttgcc 25

<210> 13

<211> 25

<212> DNA

<213> artificial sequence

<400> 13

ttccggaagt gcttgacatt gggga 25

<210> 14

<211> 20

<212> DNA

<213> artificial sequence

<400> 14

tcctctgtcg gtctgtccta 20

<210> 15

<211> 21

<212> DNA

<213> artificial sequence

<400> 15

gcctccaaca aacagacttg t 21

<210> 16

<211> 106

<212> DNA

<213> artificial sequence

<400> 16

tcctctgtcg gtctgtccta catccttcag ttatcagtgc cagatcaatg atcacaagag 60

ttgatatttt ggagaccaca aatgcacaag tctgtttgtt ggaggc 106

Claims

1. The genetic locus for reversely regulating and controlling the resistance of the rice to the rice blast bacteria is characterized in that the nucleotide sequence of the genetic locus is shown as SEQ ID NO. 1.

2. The use of the genetic locus for reversely regulating rice blast resistance in improving rice blast fungus disease resistance according to claim 1, wherein: the way to improve the disease resistance of rice blast bacteria is to inhibit the expression of the genetic locus.

3. A plant knockdown expression vector comprising the genetic locus for reverse regulation of rice blast resistance of claim 1.

4. A recombinant bacterium comprising a plant knockdown expression vector of claim 3 that inversely modulates a genetic locus for resistance to rice blast.

5. Use of the plant knockdown expression vector according to claim 3 for increasing rice blast resistance, characterized in that: transforming the plant knockdown vector of claim 3 into agrobacterium, preparing agrobacterium suspension, transforming into susceptible rice to obtain rice plant with rice blast resistance, and enabling the genetic locus of the rice with the reverse regulation of rice resistance to rice blast bacteria in the rice to be not expressed or be expressed lowly, thereby improving the rice plant resistance to rice blast bacteria.