CN113106115B

CN113106115B - Application of rice OsPDCD5 gene in reducing amylose content in rice

Info

Publication number: CN113106115B
Application number: CN202010996571.0A
Authority: CN
Inventors: 罗小金; 董世青; 辛晓云; 杨金水
Original assignee: Suzhou Jinxin Biotechnology Co ltd
Current assignee: Suzhou Jinxin Biotechnology Co ltd
Priority date: 2020-09-21
Filing date: 2020-09-21
Publication date: 2024-05-10
Anticipated expiration: 2040-09-21
Also published as: CN113106115A

Abstract

The application belongs to the technical field of gene editing breeding, and particularly discloses application of a rice OsPDCD5 gene in reducing amylose content in rice, namely, a target fragment is firstly selected in a CDS region of the rice OsPDCD5 gene, then a target sequence of the target fragment selected in the CDS region of the rice OsPDCD5 gene is inserted into a pBWA (V) H-cas9 plasmid to obtain a pBWA (V) H-cas9-OsPDCD5 recombinant plasmid, the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is then transformed into indica rice Chang Hui T025, and the amylose percentage content of the screened indica rice Changhui T025-4 mutant strain and the screened T025-7 mutant strain is 18.47 percent and 18.04 percent respectively, which is reduced by 15.7-17.7 percent relative to the amylose percentage content of 21.91 percent of wild indica rice Changhui T025.

Description

Application of rice OsPDCD5 gene in reducing amylose content in rice

Technical Field

The application relates to the technical field of gene editing breeding, in particular to application of a rice OsPDCD5 gene in reducing amylose content in rice.

Background

Rice is one of the most important food crops in the world, and about 1/3 of the population worldwide takes rice as the main food. With the development of economy and the improvement of the living standard of people, the change of the consumer market, the rice quality is increasingly focused and valued by people, and the improvement of the rice quality becomes an important task in front of us. The amylose content determines to a large extent the quality of the cooking and eating quality of rice. Genome site-directed editing is a genetic targeting technique that artificially modifies specific loci of a genome in an organism, and genetic information changes caused by the genetic information changes can be stably transferred between generations. CRISPR/Cas is the latest gene editing technology, can perform site-directed cleavage on DNA and initiate non-homologous end-binding repair or homologous recombination repair and other approaches in cells to repair broken DNA, and can cause mutation such as deletion, insertion or replacement of genome bases in the repair process. At present, a CRISPR/Cas9 system is utilized at home and abroad to reconstruct a plurality of properties of rice, including: tillering angle, premature senility of leaf, cold resistance, rice quality, etc.

Related documents report that the overexpression of OsPDCD5 can induce rice transgenic plants to show the characteristic of programmed death, such as genome DNA fragmentation, total protein reduction, premature death of plants and the like, namely, the OsPDCD5 participates in the regulation of the growth and development process of rice.

The application selects a target fragment in the CDS region of the OsPDCD5 gene, constructs the target fragment into a knockout carrier, and then transfers the knockout carrier into indica rice variety T025 so as to obtain a knockout line with improved important economic characters.

Disclosure of Invention

In order to reduce the amylose content in rice, the application provides an application of a rice OsPDCD5 gene in reducing the amylose content in rice.

The application of the rice OsPDCD5 gene in reducing the amylose content in rice adopts the following technical scheme:

The application relates to an application of a rice OsPDCD5 gene in reducing amylose content in rice, firstly selecting a target fragment in a CDS region of the rice OsPDCD5 gene, then taking a pBWA (V) H-cas9 plasmid as an expression vector, inserting a target fragment selected in the CDS region of the rice OsPDCD5 gene, namely 20 nucleotides in 66 nucleotides of a second exon, into a pBWA (V) H-cas9 plasmid to obtain a pBWA (V) H-cas9-OsPDCD5 recombinant plasmid, then transforming the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into indica Chang recovery T025, and carrying out PCR detection and first-generation sequencing screening to obtain mutant strains of indica Chang recovery T025-4 and T025-7 with reduced amylose content.

(1) Selection of target sequences

The rice OsPDCD5 gene structure is shown in the figure 1, and mainly comprises UTR (non-coding region) at the 5 'end and UTR at the 3' end, 6 exons, 5 introns, the first exon only contains ATG3 bases, the second to sixth exons are 66, 50, 65, 72 and 39 bases respectively, and the size of the ruler at the upper right corner is 100bp;

Rice OsPDCD5 gene (GenBank: AY 327105), the full length of the landing gene sequence is 4421bp, and the cDNA sequence is shown in SEQ ID NO:1, SEQ ID NO: the underlined highlighting part in 1 is 387bp of coding region length, 154bp of 5 'end non-coding region length and 389bp of 3' end non-coding region length; the target sequence selected by the coding region is 20 nucleotides in 66 nucleotides of the second exon, and the sequence is shown as SEQ ID NO:2 is shown in the figure; encoding 129 amino acids, the sequence of which is shown in SEQ ID NO:3 is shown in the figure;

(2) Construction of expression vector containing target sequence in OsPDCD5 Gene

The method comprises the steps of adopting pBWA (V) H-cas9 as a vector, constructing a pBWA (V) H-cas9-OsPDCD5 plasmid for rice OsPDCD5 gene targeting by using a target sequence of a rice OsPDCD5 gene coding region as shown in SEQ.ID NO2 as a target site, and finally obtaining the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

(3) Transformation of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid

The recombinant plasmid pBWA (V) H-cas9-OsPDCD5 was transformed into Agrobacterium EHA105 (available from Shanghai Weidi Biotechnology Co., ltd., agrobacterium tumefaciens) by the following method

① Adding 10 mu L of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells according to the proportion of 10% by volume, sequentially placing for 30min on ice, immersing in liquid nitrogen for 5min in a water bath at 37 ℃ to finish conversion and obtain agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

② Adding 110 mu L of the obtained agrobacteria EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 500 mu L of LB liquid culture medium (Sangon Biotech, B540111) without antibiotics according to the proportion of 22% by volume, and fermenting for 3-4 hours at the temperature of 28 ℃ and the rotating speed of 150-160rpm to obtain fermentation liquor;

③ Centrifuging the fermentation liquor obtained by ② at 4000rpm for 10min to collect thalli, uniformly mixing the thalli collected by centrifugation with supernatant obtained by centrifuging which is 10-11% of the volume of the fermentation liquor, and then coating the mixture on an LB plate medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin (the preparation method of the LB plate medium comprises 1000ml LB liquid medium and 15g agar powder (Genebase Gene Tech, A-2180) +three antibiotics), culturing for 36-72h at 28 ℃, and forming bacterial plaques on the LB plate medium;

carrying out plaque PCR identification on the toothpick picked plaque in an LB liquid medium, wherein the plaque successfully identified by the PCR identification is a transformant which is agrobacterium EHA105 containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid and is named EHA105/cas9-OsPDCD5;

1 bacterial plaque with positive strips successfully identified by PCR is picked, 1.5ml of EP tube is inoculated and placed in a shaking table at 28 ℃ for culture, so that agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is obtained;

The 1.5ml EP tube contains 1ml of LB liquid medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin;

(4) Induction and culture of T025 mature seed callus

Taking T025 mature seeds, removing shells, under the aseptic condition, soaking and washing the T025 mature seeds with 70% ethanol for 10min, then washing the T025 mature seeds with aseptic water for 5 times, then soaking the T025 mature seeds in 0.1% mercury chloride aqueous solution for 20min, and then washing the T025 mature seeds with aseptic water for 3 times to obtain aseptic T025 mature seeds;

Then inoculating the obtained sterile T025 mature seeds into an induction culture medium, performing induction callus for 15-20 days under the dark condition of controlling the temperature to be 26-28 ℃, transferring into a new induction culture medium or a secondary culture medium, and continuously inducing callus for 7-10 days to obtain callus;

(5) Infection with Agrobacterium

① Inoculating 500ul of agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 50ml of LB liquid medium containing 50ug/ml rifampicin and 50ug/ml kanamycin, controlling the temperature to be about 16 hours in a shaking table at 28 ℃, measuring OD600 every 5 minutes until the concentration OD600 of the agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is about 0.8, and collecting the seed liquid;

② Suspending

The obtained agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.8 is centrifugally enriched for 1 time in a 50ml centrifuge tube, is suspended in 50ml of dyeing liquid, and is continuously cultured until OD600 apprxeq 0.1 at the temperature of 28 ℃ and the rotating speed of 200 rpm;

③ Infection with

Airing the callus cultured in the step (4) on sterile filter paper, transferring the callus to an agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.1 at one time, uniformly mixing, controlling the rotating speed to be 150rpm, mixing for 15-20 min, and pouring out bacterial liquid to obtain infected callus;

④ Co-cultivation

Placing the infected callus obtained in the step ③ on sterile filter paper to suck the bacterial liquid, then inoculating the infected callus into an N ₆ D-AS culture medium, and performing dark culture for 2-3 days at a temperature of 22 ℃ in an incubator, wherein a bacterial membrane is arranged on the contact part of the infected callus and the N ₆ D-AS culture medium to obtain the callus infected by the agrobacterium EHA 105;

In the co-culture process, the incubator is not required to be opened frequently so as to avoid too large temperature change and generate a water film;

(6) Screening of resistant callus

① Respectively adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing with sterile water until effluent liquid is clear and transparent, pouring out the sterile water, adding the callus infected by the agrobacterium EHA105 into an N ₆ D liquid culture medium containing 500mg/L of timentin, controlling the rotating speed to be 100rpm, mixing for 15-20min, pouring out the N ₆ D liquid culture medium containing 500mg/L of timentin, washing with sterile water, adding the N ₆ D liquid culture medium containing 500mg/L of timentin, 100rpm,15-20min, and pouring out the N ₆ D liquid culture medium containing 500mg/L of timentin;

repeating the above actions for 2-3 times to obtain a callus infected by agrobacterium EHA105 with weak resistance to timentin;

② Then pouring the callus infected by the agrobacterium EHA105 of the weak anti-timentin obtained in ① on sterile filter paper to be blotted for about 2 hours to obtain the callus infected by the agrobacterium EHA105 of the weak anti-timentin;

③ Transferring the dried weak-resistance-te-meitin callus infected by the agrobacterium EHA105 into an N ₆ D liquid culture medium containing 250mg/L te-meitin, and performing dark culture for 7-10D at 28 ℃ without adding hygromycin B to obtain a crude product of the strong-te-resistance-resistant callus infected by the agrobacterium EHA 105;

(7) Placing the crude product of the calli with strong timentin resistance, which is obtained in the step (6) and is infected by agrobacterium tumefaciens EHA105, on a selective culture medium flat plate containing 500mg/L of timentin and 50mg/L of hygromycin B for first screening culture, and controlling the temperature to be 28 ℃ for 15-20 d in the screening culture process;

Repeating the above screening process for one time to obtain pale yellow pure product of the calli infected by the agrobacterium EHA105 with strong resistance to the timentin and the hygromycin B;

(8) Differentiation of resistant callus

Transferring the pale yellow pure product of the calli infected by the agrobacterium EHA105 with the resistance of the strong timentin and the hygromycin B into an MS differentiation medium, culturing for 15-20 d under the illumination condition, replacing the MS differentiation medium once, culturing for 15-20 d under the continuous illumination condition until 1-5cm green buds grow out, stripping off the surrounding redundant calli, cutting off roots, reserving about 0.5cm long, and transferring into a rooting medium for rooting culture to obtain seedlings;

The obtained seedlings have the height of about 10-15cm, the root system is vigorous, and the seedlings are strong by cutting the root, cutting the leaves and carrying out transfer culture again on the seedlings which are too tiny;

Adding 1cm deep normal temperature sterilized water into the obtained seedling, performing transitional culture for 2 days in an environment with the relative humidity of more than 50% at the temperature of 25-30 ℃, then cleaning a culture medium attached to the root, transplanting the seedling into a container with sterilized soil, and transferring the seedling to a greenhouse for culture for 115-125 days to obtain a T0 generation of transformed plant;

Culturing the T0 generation of transformed plants at the temperature of 28 ℃ in a greenhouse until seeds are established, and obtaining T1 seeds;

and harvesting the T1 seeds, and then carrying out seedling raising, transplanting and seed collection to obtain the T2 generation seeds, namely the indica rice Changhui T025 mutant strain with low amylose content.

The application is described by taking indica rice Changhui T025 as an example, and the obtained 2 indica rice Changhui T025 mutant plants are indica rice Changhui T025-4 plants and indica rice Changhui T025-7 plants respectively, but the application of the defective OsPDCD5 gene in reducing the amylose content in other rice varieties is not limited.

The application has the following beneficial effects:

The application of the OsPDCD5 gene in reducing the amylose content of rice is characterized in that a target sequence selected from the CDS region of the OsPDCD5 gene is constructed into a knockout carrier and is transferred into wild type Chang-Hui T025, the plant heights and main spike lengths of the obtained indica Chang-Hui T025-4 and indica Chang-Hui T025-7 mutant strains are obviously increased, the tiller number and average spike number are also obviously increased, and the tiller numbers of the indica Chang-Hui T025-4 and indica Chang-Hui T025-7 mutant strains are respectively increased by 32.11 percent and 13.76 percent relative to the wild type Chang-Hui T025; the average grain number is increased by 6.58 percent and 14.18 percent respectively;

Further, compared with wild type indica rice Changhui T025, the thousand seed weight of the obtained indica rice Changhui T025-4 and indica rice Changhui T025-7 mutant strains and the single plant yield are obviously improved, the thousand seed weight is respectively improved by 18.26 percent and 12.14 percent, and the single plant yield is respectively improved by 31.35 percent and 31.82 percent.

Further, compared with wild type Changhui T025, the amylose content of the obtained mutant strains of Changhui T025-4 and Changhui T025-7 is obviously reduced, and the amylose content of the mutant strains of Changhui T025-4 and Changhui T025-7 is respectively reduced by 15.7% -17.7%.

Drawings

FIG. 1 shows the gene structure of OsPDCD5 of rice;

FIG. 2 is a schematic diagram of the structure of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

FIG. 3a is a diagram showing the phenotype of growth of indica Changhui T025-4 mutant and wild-type indica Changhui T025 plants at maturity;

FIG. 3b is a graph showing seed particle size morphology of the mutant indica Changhui T025-4 and wild-type indica Changhui T025;

FIG. 4a is a graph showing the phenotype of growth of indica Changhui T025-7 mutant and wild-type indica Changhui T025 plants at maturity;

FIG. 4b is a graph showing seed particle size morphology of indica Changhui T025-7 mutant and wild-type indica Changhui T025;

FIG. 5 shows the amylose content of wild type Changhui T025, changhui T025-4 and T025-7 mutants.

Detailed Description

The application will now be further illustrated by means of specific examples in conjunction with the accompanying drawings without limiting the application.

Amylose content determination of OsPDCD5 mutant line

A. 2-3 g of rice flour sample which is sieved by a sieve with 0.25mm aperture is prepared by using the polished rice sample, and the rice flour sample is placed in a 100mL volumetric flask. 1.0mL of 95% ethanol was added, the flask was gently shaken to wet and disperse the sample, 9.0mL of 1.00mol/L sodium hydroxide solution was added to slowly flow down the neck wall, and the flask was rotated to rinse the sample adhered to the wall. And (3) placing the volumetric flask in a boiling water bath, boiling for 10min, taking out, cooling to room temperature, and adding distilled water to fix the volume. 5.0mL of the sample solution is sucked, added into a volumetric flask which is filled with half of distilled water and is 100mL of acetic acid solution with the concentration of 1.0mL of 1.00mol/L is added into the volumetric flask, the sample is acidified, 1.50mL of iodine solution is added, and the mixture is fully and uniformly shaken. Constant volume with distilled water, standing for 20min. A blank solution was prepared by replacing the sample with 5mL of 0.09mol/L sodium hydroxide solution. The blank solution was used to adjust the zero point at the wavelength of 620nm of the spectrophotometer and the absorbance value of the colored sample solution was measured.

B. Drawing a standard curve:

and weighing 0.1000g of each standard sample with high, medium and low known amylose content, which is stored for more than three days under the same condition as the sample to be measured, and simultaneously measuring the standard sample and the sample to be measured by using the improved simplified method. Drawing a standard curve or a regression equation listing the curve by taking amylose of a standard sample as an ordinate and a corresponding absorbance value as an abscissa:

Y＝a+bx

Wherein: y-amylose content of the sample; a-standard curve intercept; b-slope of standard curve; x-absorbance values of samples.

C. representation of results

The amylose content of rice samples is expressed as a percentage of amylose based on dry weight of the samples, and the absorbance value of the samples can be directly read from a standard curve of straight-chain starch or can be obtained from a regression equation of the standard curve. The measurement is repeated once, and the relative difference between the results of the two measurements is less than 1%.

The composition of the various media used in the examples of the present application is shown in the following table:

(Note: autoclave at 115 ℃ C. For 20 min)

The experimental methods used in the specific examples of the present application are conventional methods unless otherwise specified, and materials, reagents, etc. used, unless otherwise specified, are commercially available.

Example 1

The application of the rice OsPDCD5 gene in reducing the amylose content in rice specifically comprises the following steps:

(1) Construction of pBWA (V) H-cas9-OsPDCD5 vector:

① The cleavage site Eco31I (BsaI) was designed in primers yjstgt (+): CAGTGGTCTCAGGCACCCAGAGTTGGAAGCTA (the sequence of which is shown in SEQ ID NO: 4) and yjstgt (-): CAGTGGTCTCAAAACGATAGCTTCCAACTCTG (the sequence of which is shown in SEQ ID NO: 5), and then primers yjstgt (+) and yjstgt (-) were used to amplify a target sequence of 20bp in the CDS region of the OsPDCD5 gene, the nucleotide sequence of which is: ACCCAGAGTTGGAAGCTATC, a PCR product (the sequence of which is shown as SEQ ID NO: 5) comprising the cleavage site Eco31I (BsaI) is obtained: CAGTGGTCTCAGGCACCCAGAGTTGGAAGCTATCGTTTTGAGACCAGTG, the PCR product was designated OsPDCD5;

② Recovering the PCR product OsPDCD5 from the rubber tapping after agarose electrophoresis, and purifying the DNA fragment by using a kit (Sangon Biotech, B518131) to obtain a PCR purified product OsPDCD5;

③ Preparing an enzyme digestion connecting system, wherein the total volume of the enzyme digestion connecting system is 20 mu L, and the composition and the content of each raw material in the enzyme digestion connecting system are as follows:

20ul of the digestion connection system prepared according to the composition and the content is subjected to 5cycles at 37 ℃ for 20min in a PCR instrument (Bio-Rad S THERMAL CYCLER); 37 ℃ for 10min;20 ℃ for 10min; after treatment at 37 ℃ for 20min, pBWA (V) H-cas9-OsPDCD5 ligation product is obtained;

④ Sucking 5-10 mu L of pBWA (V) H-cas9-OsPDCD5 connection product in the step ③, adding into escherichia coli DH5 alpha-competent cells (purchased from Shanghai Weidi biotechnology Co., ltd.), incubating on ice for 30min, performing heat shock at 42 ℃ for 1min, incubating on ice for 2min, adding 900 mu L of LB culture medium, and culturing at 37 ℃ for 1H to perform activation resurrection of escherichia coli DH5 alpha-competent cells;

coating the recovered escherichia coli DH5 alpha competent cells on LB solid plates containing Tu Kana mycin, culturing for 12 hours in an inverted mode in a 37 ℃ incubator, and carrying out plaque PCR identification on the obtained escherichia coli DH5 alpha monoclonal;

⑤ Selecting 10 bacterial plaques for carrying out bacterial plaque PCR identification (Li Hua, liu Yanlin and the like, and applying a colony PCR technology to recombinant plasmid screening and identification, and judging whether the connection is successful or not by the university of northwest agriculture and forestry science and technology report (natural science edition), 9 th month of 2004, 32 nd volume, 35-37 pages);

identification primer pbw2+: GGCGTCTTCTACTGGTGCTA (the sequence of which is shown as SEQ ID NO: 6), pbw 2-: GTCTTTACGGCGAGTTCTGT (the sequence of which is shown as SEQ ID NO: 7), the length of the amplified fragment is 422bp (the sequence of which is shown as SEQ ID NO: 8), and the amplified PCR stock solution is subjected to agarose gel electrophoresis to detect whether positive bands (422 bp size) exist;

Taking agarose electrophoresis to detect 3 corresponding bacterial plaques with positive bands, inoculating the bacterial plaques into a 1.5mlEP tube containing 700ul of LB culture solution (Sangon Biotech, B540111), performing shake culture at 37 ℃ for 3 hours, taking bacterial liquid, sequencing, and obtaining a sequence shown in SEQ ID NO:8, consistency judgment;

Sequencing results and sequences shown in SEQ ID NO:8, taking 500ul of bacterial liquid with the same consistency as bacterial liquid with the correct sequencing result, performing bacterial protection (500 ul of 50% glycerol+500 ul of LB bacterial liquid), inoculating 200ul of bacterial liquid into 2ml of LB culture liquid, performing shake cultivation for 12 hours at 37 ℃, extracting plasmid grains by using a plasmid extraction kit (Sangon Biotech, B518191) to obtain pBWA (V) H-cas9-OsPDCD5 recombinant plasmid, wherein the structural diagram is shown in figure 2, and the plasmid contains a 35S promoter, a U6 promoter, a target sequence of an OsPDCD5 gene, cas9 protein, an NOS terminator, and screening hygromycin resistance and the like;

(2) Transformation of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid

① Adding 10 mu L of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 100 mu L of Agrobacterium EHA105 competent cells, sequentially placing on ice for 30min, immersing in liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to obtain the Agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

② 110 mu L of the agrobacteria EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid obtained above were added to 500 mu L of LB liquid medium (Sangon Biotech, B540111, manufactured by Sangon Biotech) without antibiotics, and fermentation was carried out at a temperature of 28℃and a rotation speed of 150-160rpm for 3-4 hours to obtain a fermentation broth;

③ Centrifuging the obtained fermentation broth at 4000rpm for 10min to collect thalli, uniformly mixing the supernatant obtained after centrifuging the thalli collected by centrifugation with 60ul, and then coating the mixture on an LB plate medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin (preparation method of LB plate medium: 1000ml LB liquid medium +15g agar powder (Genebase Gene Tech, A-2180) +three antibiotics) at 28 ℃ for 36-72h, and forming bacterial plaques on the LB plate medium;

10 plaques were picked and 1.5ml of EP tube-connected bacteria and PCR was performed simultaneously to determine whether the ligation was successful, and the primers used were Pbw2+: GGCGTCTTCTACTGGTGCTA (the sequence of which is shown as SEQ ID NO: 6), pbw2-: GTCTTTACGGCGAGTTCTGT (the sequence of which is shown as SEQ ID NO: 7), the length of the amplified fragment is 422bp (the sequence of which is shown as SEQ ID NO: 8), and the amplified PCR stock solution is subjected to agarose gel electrophoresis to detect whether positive bands (422 bp size) exist;

(3) Induction and culture of T025 mature seed callus

Taking T025 mature seeds, removing shells, under the aseptic condition, soaking and washing the seeds for 10min by using 70% ethanol, then washing the seeds for 5 times by using aseptic water, then transferring the seeds into a mercuric chloride aqueous solution with the volume percentage concentration of 0.1% for soaking for 20min, and then washing the seeds for 3 times by using aseptic water to obtain aseptic T025 mature seeds;

Then inoculating the obtained sterile T025 mature seeds into an MS induction solid culture medium plate, inoculating 10 sterile T025 mature seeds on each MS induction solid culture medium plate with the diameter of 90mm, inoculating 10 plates, culturing for about 15 days under the dark condition at the temperature of 28 ℃ until the calli are available, stripping the induced calli for subculture, removing endosperm and embryo, transferring the calli into a new MS induction solid culture medium, and continuing culturing for 7-10 days to obtain calli;

if the stripped callus is bigger, the callus can be thinned by forceps at the step;

Note that: drying the MS-induced solid culture medium for more than 1h in a sterile operation table after pouring the plate, and sucking the transferred callus on sterile filter paper to ensure that no water film exists between the callus and the MS-induced solid culture medium during the subculture;

(4) Infection with Agrobacterium

① Inoculating 500ul of the agrobacterium EHA105 seed solution containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid obtained in the step (2) into 50ml of LB liquid medium containing 50ug/ml rifampicin and 50ug/ml kanamycin, culturing in a shaking table at the temperature of 28 ℃ for about 16 hours, measuring OD600 every 5 minutes until the concentration OD600 of the agrobacterium EHA105 seed solution containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is about 0.8, and collecting the seed solution;

② Suspending

The obtained agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.8 is centrifugated and enriched for 1 time in a 50ml centrifuge tube, suspended in 50ml invasive solution, and continuously cultured until OD600 apprxeq 0.1 is reached with the temperature of 28 ℃ and the rotating speed of 200rpm, thus obtaining the agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.1;

③ Infection with

Airing the callus cultured in the step (3) on sterile filter paper, transferring the callus to an agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.1 at one time, uniformly mixing, controlling the rotating speed to be 150rpm, mixing for 15-20 min, and pouring out bacterial liquid to obtain infected callus;

④ Co-cultivation

Placing the infected callus obtained in the step ③ on sterile filter paper to be dried by suction, then inoculating the callus into an N ₆ D-AS culture medium, and performing dark culture for 2-3 days at the temperature of 22 ℃ to obtain the callus infected by the agrobacterium EHA105, wherein a bacterial membrane exists at the contact part of the infected callus and the N ₆ D-AS culture medium;

(5) Screening of resistant callus

① Adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing with sterile water until effluent liquid is clear and transparent, pouring sterile water, adding the callus infected by the agrobacterium EHA105 into an N ₆ D liquid culture medium containing 500mg/L of timentin, controlling the rotating speed to be 100rpm, mixing for 15-20min, pouring out the N ₆ D liquid culture medium containing 500mg/L of timentin, and washing with sterile water;

repeating the above mentioned callus infected by agrobacterium EHA105 to be added into N ₆ D liquid culture medium containing 500mg/L of timentin, controlling the rotation speed to be 100rpm, mixing for 15-20min, then pouring out N ₆ D liquid culture medium containing 500mg/L of timentin until the process of sterile water washing is 2-3 times, obtaining the callus infected by agrobacterium EHA105 with weak anti-timentin;

③ Transferring the dried weak anti-termitidine callus infected by the agrobacterium EHA105 into an N ₆ D liquid culture medium containing 250mg/L of termitidine, and performing dark culture for 7-10D at 28 ℃ without adding hygromycin B to obtain a crude product of the strong anti-termitidine callus infected by the agrobacterium EHA 105;

(6) Placing the crude product of the callus which is obtained in the step (5) and has strong anti-timentin and is infected by agrobacterium EHA105 on a selective culture medium flat plate containing 500mg/L of the timentin and 50mg/L of the hygromycin B for first screening culture, and controlling the temperature to be 28 ℃ for 15-20 d in the screening culture process;

Repeating the screening and culturing process for one time to obtain pure callus with strong resistance to timentin and hygromycin B, which is infested by agrobacterium EHA 105;

(7) Differentiation of resistant callus

Transferring the obtained pure product of the callus which has strong resistance to the timentin and the hygromycin B and is infected by the agrobacterium EHA105 into an MS differentiation medium, culturing for 15-20 d under the illumination condition, then replacing the MS differentiation medium once, continuing culturing for 15-20 d under the illumination condition until 1-5cm green buds grow out, stripping off the superfluous callus around, cutting off roots, reserving about 0.5cm long, and transferring into a rooting medium for rooting culture to obtain 10-15cm seedlings;

Cutting roots, cutting leaves and performing transfer culture again on the obtained too fine seedlings to strengthen the seedlings;

Adding 1cm deep normal temperature sterilized water into 10-15cm seedlings, performing transitional culture for 2 days in an environment with the relative humidity of more than 50% at the temperature of 25-30 ℃, then cleaning rooting culture medium attached to roots, transplanting the rooting culture medium into a container with sterilized soil, and transferring the rooting culture medium to a greenhouse for culturing for 115-125 days to obtain T0 generation transformed plants;

(8) Screening and detection of transformed plants

① The PCR amplification is adopted to detect candidate T0 generation transformed plants, and the amplification primers used are as follows: hyg-CX-S: AGATGTTGGCGACCTCGTATT (the sequence of which is shown as SEQ ID NO: 9); hyg-CX-A: AAGATCGTTATGTTTATCGGCACT (the sequence of which is shown as SEQ ID NO: 10), detecting whether the T0 generation transformed plant contains hygromycin B screening markers, and obtaining 21 transformed plants containing hygromycin B screening markers;

Culturing 21 transformed plants (namely T0 generation, the numbers are T0-1, T0-2 and … … T0-21) containing hygromycin B screening markers at the temperature of 28 ℃ in a greenhouse until the transformed plants form seeds, namely T1 generation, and seeding the harvested T1 generation seeds (20 seeds are sown for seedling raising in each number, 10 seedlings are randomly selected) in 2017 for 6 months in a seedling field of Taicang base of Jiangsu complex denier university, transplanting seedlings in 7 months, growing in a field condition, obtaining T2 generation seeds when the single plants are harvested in 10 ten days in the same year, and simultaneously taking leaves of the corresponding single plants;

② Plant screening and detection of CDS region mutation of OsPDCD5

Leaves corresponding to the T2 generation seed individual were obtained in the above step (1), genomic DNA was extracted, and OsPCDC detection primer MPCD6-F was used: TGGAGGGAGTACATGTTTTAGGTG (whose sequence is shown as SEQ ID NO: 11) and MPCD6-R: ATAAACATGGTTGACAAATAGAGC (the sequence of which is shown as SEQ ID NO: 12), performing PCR, running the PCR product on agarose gel electrophoresis, and setting the target band sequence of 427bp as SEQ ID NO: 13).

The purpose of the PCR sequencing is to detect whether mutation occurs in the 20bp target sequence of the OsPDCD5 of the single strain obtained in the step (1); comparing the sequencing result with the standard SEQ ID NO: after 2 sequences, we found that the 20bp target sequence of OsPDCD5 was changed in 9 plants obtained in the step (8), that is, the 9 plants were plants in which the target sequence of OsPDCD5 gene was mutated, and designated as T025-1-T025-9, and only T025-4 and T025-7 were homozygous lines (DNA was double-stranded, and only one DNA strand of OsPDCD5 target sequence was likely to be mutated), and T025-4 and T025-7 were used as subjects.

The sequencing results of the target sequences at 20bp of indica rice Changhui T025, indica rice Changhui T025-4 and indica rice Changhui T025-7 are as follows:

wherein indica rice Changhui T025 is wild type, is an original 20bp target sequence of OsPDCD5, and has a sequence shown in SEQ ID NO: 2. as shown, indica rice Changhui T025-4 and T025-7 are mutant strains in which the target sequence of OsPDCD5 is mutated;

Compared with wild type Changhui T025, the mutant strain Changhui T025-4 is obtained by inserting an A base into the 3 rd-4 th base at the 3' -end of a 20bp target sequence, and the sequence is shown as SEQ ID NO: 14;

compared with wild indica rice Changhui T025, the mutant strain of the indica rice Changhui T025-7 is obtained by deleting GCTA four bases at the 3' -end of a 20bp target sequence, and the sequence of the mutant strain is shown as SEQ ID NO: 15;

(9) Investigation and statistics of yield and quality traits of OsPDCD5 transgenic T ₃ generation population

Seeds (generation T2) of the mutant strains of indica rice Changhui T025-4 and T025-7 and wild type indica rice Changhui T025 (as a control) are sowed in a seedling bed of a Taicang base of university of Jiangsu province for 6 months, transplanted in the seedling bed of 7 months, transplanted in the seedling bed of 30 plants in each region, the row spacing is 6 inch multiplied by 6 inch, 10 plants in each row are repeated for 3 times (90 seeds are planted together), and the seeds are grown in a field condition.

And counting 30 single plants in each region in the maturity period, calculating an average value, and counting yield traits. Seeds of each of the repeated plants (i.e., 30 seeds were collected together, which was T3 generation) were then mixed and 500g of the rice amylose content was measured from each repetition (total 3 repetitions). The above statistics are as follows:

Statistical table of yield and quality characteristics of wild type Chang Hui T025, chang Hui T025-4 and T025-7 mutant strains

As can be seen from the above table, the plant height and main spike length of the mutant strains of indica rice Changhui T025-4 and T025-7 are obviously increased compared with that of the wild-type indica rice Changhui T025;

Further, the increase of the tiller number and the average spike grain number is obvious, and compared with the wild type indica rice Changhui T025, the tiller numbers of the indica rice Changhui T025-4 and T025-7 mutant strains are increased by 32.11 percent and 13.76 percent respectively;

it can be further seen that the average spike number of the mutant strains of indica rice Changhui T025-4 and T025-7 is increased by 6.58% and 14.18% respectively, relative to the wild type indica rice Changhui T025;

Further, compared with wild type Chang Hui T025, the thousand seed weight of the mutant strain of the indica Chang Hui T025-4 and T025-7 is obviously improved, and especially, the thousand seed weight is respectively improved by 18.26 percent and 12.14 percent, and the individual plant yield is respectively increased by 31.35 percent and 31.82 percent.

Further, the direct chain starch content of the mutant strains of Chang-Hui T025-4 and T025-7 was significantly reduced relative to that of the wild-type indica-Chang-Hui T025, and the amylose content of the mutant strains of Chang-Hui T025-4 and T025-7 was 18.47% and 18.04%, respectively, i.e., it was reduced by 15.7% to 17.7%, respectively, relative to that of the wild-type indica-Chang-Hui T025.

Taking a photograph of the growth phenotype of the obtained indica rice Changhui T025-4 and T025-7 mutant strains and wild-type indica rice Changhui T025 plant in the mature period, and obtaining phenotype charts as shown in figures 3a and 4a, wherein the indica rice Changhui T025-4 and T025-7 mutant strains are obviously higher than the wild-type indica rice Changhui T025 plant, the main spikes are longer and the tillering number is more as shown in figures 3a and 4 a; and the grain sizes of the seeds of the mutant strains of the Changhui T025-4 and Changhui T025-7 and the grain sizes of the seed of the wild type Changhui T025 are photographed, and the results are shown in figures 3b and 4b, and compared with the wild type Changhui T025, the grain sizes of the seed of the mutant strains of the Changhui T025-4 and the Changhui T025-7 are enlarged, so that the obvious improvement of thousand grain weights and single plant yields of the mutant strains of the Changhui T025-4 and the Changhui T025-7 is further proved.

In summary, the plant height, main spike length, tillering number, average spike number, thousand grain weight, and apparent increase in individual plant yield and decrease in amylose content of the mutant strains of indica rice chang T025-4 and T025-7 relative to wild-type indica rice chang T025 were analyzed as a result of metabolic regulation of the wild-type indica rice chang T025 after the target sequence selected from the CDS region of the OsPDCD5 gene was constructed into the knockout vector.

The present embodiment is only for explanation of the present application and is not to be construed as limiting the present application, and modifications to the present embodiment, which may not creatively contribute to the present application as required by those skilled in the art after reading the present specification, are all protected by patent laws within the scope of claims of the present application.

Sequence listing

<110> New technology Co., ltd. In Suzhou

Application of <120> rice OsPDCD5 gene in reducing amylose content in rice

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 930

<212> DNA

<213> Artificial sequence (")

<400> 1

ggagagaggc ccagatgagt tgcgttaaat ccacgggtga ggagagagaa aaaggaggtc 60

aagttctctc tctcttcctc tcgtcgccgg aggcgggagg ccatcgacgc tgaagtgaag 120

gggatcgcga tctccggcga gcgtgcgggg gaagatggct gacccagagt tggaagctat 180

caggcagagg agaatgcaag agctaatggc acagcatggt gcggcaaatc cgcaaaatgc 240

tgggcaacaa aaagctcaag aagatgcaaa gcaggaagct gaggaacggc ggcagatgat 300

gcttgctcag attttatctt ctgaagctag agaaaggctc tcccgcatag ctttggtcaa 360

acctgataaa gcaagagggg tggaggatgt tcttctgaga gctgctcagt ccggtggaat 420

atctgaaaag gtgtctgaag aaaggcttat ctcacttctg gagcaaatca atacccacac 480

tagcaaacag acgaaagtta cgattcagag gcgccggagc gtccttgacg atgatgacta 540

gctgcatgtg tgttgtgtgt acgatgagct ggtggaggag tctgctgtag cgcaaaacta 600

cttagaaatg atgattatca aacgctatat caacaaccat caaaacttga gcgactattt 660

gatggatatt tggccgtata tgaattaatt cgagtttggt ttggcttgtt ccattgatga 720

cattcaaact tttgactgct ccgaagggga attgccacac gtccgactgg tatgtacgac 780

ttagcatccg accagtactt acctgctcct tgctctggcc cacatggaga gcagctggct 840

cgttggagta aattgattag cgaacaatag ggtcggatgt atagcagtac tcgctccgaa 900

gtgtgtatcc atcatatcat gagtatctta 930

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 3

acccagagtt ggaagctatc 20

<210> 4

<211> 128

<212> PRT

<213> Artificial sequence (")

<400> 4

Met Ala Asp Pro Glu Leu Glu Ala Ile Arg Gln Arg Arg Met Gln Glu

1 5 10 15

Leu Met Ala Gln His Gly Ala Ala Asn Pro Gln Asn Ala Gly Gln Gln

20 25 30

Lys Ala Gln Glu Asp Ala Lys Gln Glu Ala Glu Glu Arg Arg Gln Met

35 40 45

Met Leu Ala Gln Ile Leu Ser Ser Glu Ala Arg Glu Arg Leu Ser Arg

50 55 60

Ile Ala Leu Val Lys Pro Asp Lys Ala Arg Gly Val Glu Asp Val Leu

65 70 75 80

Leu Arg Ala Ala Gln Ser Gly Gly Ile Ser Glu Lys Val Ser Glu Glu

85 90 95

Arg Leu Ile Ser Leu Leu Glu Gln Ile Asn Thr His Thr Ser Lys Gln

100 105 110

Thr Lys Val Thr Ile Gln Arg Arg Arg Ser Val Leu Asp Asp Asp Asp

115 120 125

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence (")

<400> 5

cagtggtctc aggcacccag agttggaagc ta 32

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence (")

<400> 6

cagtggtctc aaaacgatag cttccaactc tg 32

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 7

ggcgtcttct actggtgcta 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 7

gtctttacgg cgagttctgt 20

<210> 8

<211> 422

<212> DNA

<213> Artificial sequence (")

<400> 8

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 60

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 120

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 180

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 240

ttgtgcagat gatccgtggc acccagagtt ggaagctatc gttttagagc tagaaatagc 300

aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 360

tttgtcgtag acatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag 420

ac 422

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (")

<400> 9

agatgttggc gacctcgtat t 21

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 10

aagatcgtta tgtttatcgg cact 24

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 11

tggagggagt acatgtttta ggtg 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 12

ataaacatgg ttgacaaata gagc 24

<210> 13

<211> 427

<212> DNA

<213> Artificial sequence (")

<400> 13

tggagggagt acatgtttta ggtgtcttgc taaatattaa atatagatac gaagattata 60

ttatgtgcac tccaaatatt cgtcttagac aacatttcag tttatgtaag aggaagcaat 120

agttcaatgc tatccataaa ggcattgttc taccatgtaa cttctcctga tggaactata 180

aactcttatt gctaggctga cccagagttg gaagctatca ggcagaggag aatgcaagag 240

ctaatggcac agcatggtgc ggtaagcctg tggttcatgg tgaaaagttg aagctgcaac 300

agcaatgtcc agttctcttg gctgactttg atgtactatt gtcctttagg caaatccgca 360

aaatgctggg caacaaaaag ctcaagaaga tgcaaagcag tatgctctat ttgtcaacca 420

tgtttat 427

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (")

<400> 14

acccagagtt ggaagctaat c 21

<210> 15

<211> 16

<212> DNA

<213> Artificial sequence (")

<400> 15

acccagagtt ggaatc 16

<210> 16

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 16

aagatcgtta tgtttatcgg cact 24

Claims

1. The application of the rice OsPDCD5 gene in reducing the amylose content in rice is characterized in that a target fragment is selected in a CDS region of the rice OsPDCD5 gene, pBWA (V) H-cas9 plasmid is adopted as an expression vector, a target sequence of the target fragment selected in the CDS region of the rice OsPDCD5 gene is inserted into the pBWA (V) H-cas9 plasmid, then the obtained recombinant plasmid pBWA (V) H-cas9-OsPDCD5 is transformed into indica rice Changhui T025, and the indica rice Changhui T025-4 and T025-7 mutant strains with reduced amylose content are obtained through PCR detection and first-generation sequencing screening;

The target sequence of the obtained indica rice Changhui T025-4 mutant with reduced amylose content is shown as SEQ ID NO: 14;

the target sequence of the obtained indica rice Changhui T025-7 mutant strain with reduced amylose content is shown as SEQ ID NO: 15.

2. The application of the rice OsPDCD5 gene in reducing the amylose content of rice as claimed in claim 1, wherein the target sequence of the target fragment selected from CDS region of the rice OsPDCD5 gene is shown in SEQ ID NO: 2.

3. The use of the rice OsPDCD5 gene according to claim 1 for reducing the amylose content in rice, wherein the recombinant plasmid pBWA (V) H-cas9-OsPDCD5 is transformed into indica rice Changhui T025, comprising the following steps:

The mature seeds of the indica rice Changhui T025 are dehulled and disinfected, inoculated on an induction culture medium for induction callus, dark-cultured for 15-20 days at 26-28 ℃ and then subjected to secondary generation to obtain indica rice Changhui T025 callus, and the purified recombinant plasmid pBWA (V) H-cas9-OsPDCD5 is introduced into indica rice Changhui T025 callus cells by adopting an agrobacterium-mediated method, so that the transformation from the recombinant plasmid pBWA (V) H-cas9-OsPDCD5 to the indica rice Changhui T025 is completed.

4. The use of the rice OsPDCD5 gene according to claim 3 for reducing the amylose content in rice, wherein the recombinant plasmid pBWA (V) H-cas9-OsPDCD5 is introduced into indica rice Changhui T025 callus cells by using an agrobacterium-mediated method, and the method comprises the following steps:

(1) The recombinant plasmid pBWA (V) H-cas9-OsPDCD5 converts agrobacterium EHA105, and specifically comprises the following steps:

① Adding the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into the agrobacteria EHA105 competent cells according to the proportion of 10 percent by volume, sequentially placing for 30min on ice, immersing in liquid nitrogen for 5min in a water bath at 37 ℃ for 5min to obtain the agrobacteria EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

② Adding the obtained agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into an LB liquid culture medium without antibiotics according to the volume percentage of 22%, controlling the temperature to be 28 ℃ and the rotating speed to be 150-160rpm for fermentation for 3-4 hours, so as to obtain fermentation liquor;

③ Centrifuging the obtained fermentation liquor at a control rotation speed of 4000 rpm for 10min to collect thalli, uniformly mixing the thalli collected by centrifugation with supernatant obtained by centrifuging the thalli accounting for 11% of the volume of the fermentation liquor, then coating the mixture on an LB plate medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin, and culturing at 28 ℃ for 36-72h to form bacterial plaques on the LB plate medium;

The bacterial plaque successfully identified by PCR is agrobacterium EHA105 containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

1 bacterial plaque which is successfully identified by PCR is picked up, 1.5ml of EP tube is inoculated and placed in a shaking table at 28 ℃ for culture, thus obtaining agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

(2) Induction and culture of T025 mature seed callus

The mature seeds of the indica rice Changhui T025 are dehulled and disinfected, then inoculated on an induction culture medium for induction callus, and subjected to dark culture at 26-28 ℃ for 15-20 days for one time to obtain the indica rice Changhui T025 callus;

(3) Infection with Agrobacterium

① Inoculating agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into LB liquid culture medium containing 50ug/ml rifampicin and 50ug/ml kanamycin according to the inoculum size of 10-11% by volume, controlling the temperature to 28 ℃ for culture until the concentration OD600 apprxeq 0.8 of the agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is obtained, and collecting the seed liquid;

② Suspending

The obtained agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.8 is centrifugated and enriched for 1 time in a 50ml centrifuge tube, suspended in 50ml of dyeing liquid, and continuously cultured until OD600 apprxeq 0.1 at the temperature of 28 ℃ and the rotating speed of 200 rpm;

③ Infection with

Airing the indica rice Changhui T025 callus cultured in the step (2) on sterile filter paper, transferring the aseptic filter paper to an agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 apprxeq 0.1 at one time, uniformly mixing, controlling the rotating speed to be 150rpm, mixing 15-20 min, and pouring out bacterial liquid to obtain infected callus;

④ Co-cultivation

Placing the infected callus obtained in the step ③ on sterile filter paper to be dried by suction, then inoculating the infected callus into an N ₆ D-AS medium, and performing dark culture at the temperature of 22 ℃ for 2-3 days to obtain the callus infected by the agrobacterium EHA 105;

(4) Screening of resistant callus

① Washing the callus infected by the agrobacterium tumefaciens EHA105 obtained in the step (3) with sterile water until effluent liquid is clear and transparent, adding the washed callus into an N ₆ D liquid culture medium containing the timentin 500 mg/L, mixing 15-20min by controlling the rotating speed to be 100rpm, pouring the N ₆ D liquid culture medium containing the timentin 500 mg/L, washing with sterile water, adding an N ₆ D liquid culture medium containing the timentin 500 mg/L, 100rpm,15-20min, and pouring the N ₆ D liquid culture medium containing the timentin 500 mg/L;

Repeatedly adding the callus infected by the agrobacterium EHA105 into an N6D liquid culture medium containing the timentin 500 mg/L, controlling the rotation speed to be 100 rpm, mixing 15-20 min, and then pouring out the N6D liquid culture medium containing the timentin 500 mg/L until the process of cleaning with sterile water is carried out for 2-3 times, so as to obtain the callus infected by the agrobacterium EHA105 with weak timentin;

② Pouring the weak anti-timentin callus obtained in ① and infected by agrobacterium EHA105 on sterile filter paper for drying, transferring into an N ₆ D liquid culture medium containing timentin 250 mg/L, and performing dark culture for 7-10D at 28 ℃ without adding hygromycin B to obtain a crude product of the strong timentin-resistant callus infected by agrobacterium EHA 105;

(5) Placing the crude product of the calli with strong timentin resistance, which is obtained in the step (4) and is infected by agrobacterium tumefaciens EHA105, on a selective culture medium flat plate containing timentin 500mg/L and hygromycin B50 mg/L for first screening culture, and controlling the temperature to be 28 ℃ in the screening culture process for 15-20 d;

The above screening procedure was repeated once to obtain pale yellow calli infected with agrobacteria EHA105 with strong resistance to both timentin and hygromycin B.

5. The use of the rice OsPDCD5 gene according to claim 4 for reducing amylose content in rice, wherein the primer Pbw2+ used for PCR identification in the step (1) has a sequence as shown in SEQ ID NO:6, the sequence of the primer Pbw 2-is shown as SEQ ID NO:7, the positive band sequence successfully identified by PCR is shown as SEQ ID NO: shown at 8.

6. The use of OsPDCD5 gene from rice AS claimed in claim 4 for reducing the amylose content of rice, wherein the infecting solution used for suspending in the agrobacteria infecting process in step (3) consists of 2.2 g MS powder, 68.5g glucose, 174mg arginine, 876mg glutamine, 30g sucrose, 100. Mu. Mol AS and the balance of water per liter.