CN106636298A - Method for rapid in-vivo verification of gene-targeting target efficiency - Google Patents
Method for rapid in-vivo verification of gene-targeting target efficiency Download PDFInfo
- Publication number
- CN106636298A CN106636298A CN201610596433.7A CN201610596433A CN106636298A CN 106636298 A CN106636298 A CN 106636298A CN 201610596433 A CN201610596433 A CN 201610596433A CN 106636298 A CN106636298 A CN 106636298A
- Authority
- CN
- China
- Prior art keywords
- target spot
- target
- rapid
- efficiency
- vivo
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/06—Quantitative determination
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for rapid in-vivo verification of gene-targeting target efficiency; the method is achieved on the basis of the principle that the occurrence of recombination repair of homologous fragments is excited when DNA in cells breaks, and the activity of a target is verified in a mode of recovering the activity of a reporter gene through recombination. The method can be used for rapidly evaluating the target efficiency just by constructing a target-interpolated vector once and then counting colored plaques. When the method is applied to a natural recombination system in escherichia coli, homologous fragment recombination occurs and two truncated chromogenic gene segments are combined, so that protein having a complete activity is formed, and the colored plaques are generated when a target, which has activity, is cut off, a recombination event is excited and chromogenic genes are repaired, otherwise it is judged to be an escherichia coli colony in normal color. With the application of the method, the verification of candidate target efficiency can be rapidly achieved in the escherichia coli, so that efficient targets can be screened out and experimental failure can be prevented.
Description
Technical field
The invention belongs to genome editing technique field, more particularly to a kind of rapid in vivo gene targeting is verified
The method of target spot efficiency.
Background technology
Genome editing technique is fast-developing in recent years, from initial direct homologous recombination technique, base finally
Random recovery technique in otch and the homologous recovery technique based on otch.Now, the generation for pinpointing otch is to carry out genome
The key of editor, compared with direct homologous recombination technique before, greatly improves the efficiency of genome editor.Generation is cut
The target spot that the position of mouth is namely edited, the selection of target spot determines genome, therefore pinpoints the efficiency for producing otch also with regard to straight
Connect the efficiency for determining genome editor.Monooctyl ester ribozyme is being based on, in the genome editor of talen, crispr/cas9 technology,
All there is target select permeability, select an efficient target spot just into the successful precondition of genome editor.
The content of the invention
The present invention proposes a kind of method that rapid in vivo verifies gene targeting target spot efficiency, and this method is simple, quick, only
The carrier for once inserting target spot need to be built, then the Fast Evaluation target spot efficiency by way of coloured bacterial plaque is counted.
A kind of method that rapid in vivo verifies gene targeting target spot efficiency, it is same based on exciting after intracellular DNA break
There is recombinantal repair to realize in source fragment, the work of target spot is verified by way of the activation recovering that restructuring causes reporter gene
Property.
Preferably, it is embodied in：Structure inserts the carrier of target spot, and target spot occurs homologous fragment restructuring after disconnecting, will
The fast eolor base of two incompleteness reassembles into the albumen with full activity because of section, if target spot is active will be cut off, thing of recombinating
Part will be activated, fast eolor base because being repaired, so as to produce coloured bacterial plaque；Otherwise, recombination event is not activated, fast eolor base because not by
Repair, then the Fast Evaluation target spot efficiency by way of fast eolor base is counted because of the color spot for producing.
Preferably, target spot can be any kind of target spot for genomic DNA editor.
Preferably, reporter gene is that various fluorescins or catalysis produce one of reporter gene of enzyme of color reaction.
Preferably, checking is carried out in the cell, and these cells can be zooblast, in plant cell or bacterium
One kind.
What the present invention was produced has the beneficial effect that：This method builds the carrier for once inserting target spot, then by there is color
The mode Fast Evaluation target spot efficiency that counts of bacterial plaque, this method sent out using natural recombination system in Escherichia coli, homologous fragment
Raw restructuring, by the fast eolor base of two incompleteness because section reassembles into the albumen with full activity.If target spot is active will be cut
Disconnected, recombination event will be activated, and fast eolor base, because being repaired, is the Escherichia coli of normal color otherwise so as to produce coloured bacterial plaque
Bacterium colony.
Description of the drawings
In order to be illustrated more clearly that the embodiment of the present invention or technical scheme of the prior art, below will be to embodiment or existing
The accompanying drawing to be used needed for having technology description is briefly described, it should be apparent that, drawings in the following description are only this
Some embodiments of invention, for those of ordinary skill in the art, on the premise of not paying creative work, can be with
Other accompanying drawings are obtained according to these accompanying drawings.
Fig. 1 is that carrier pBWD (LA) BIC-tgtrpt builds structure chart.
Fig. 2 is that carrier PBWA (V) H-CAS9i builds structure chart.
Specific embodiment
Embodiment one：Target spot efficiency of the checking based on cas9/gRNA nucleases
1st, target is building up in target validation carrier (carrier 1).
Synthesizing following primer is used to for a pair synthesize target sequence (target：atttctttgaagcccaactt agg
23bp)。
Ptgt+:cagtGGTCTCaacatatttctttgaagcccaacttagg
Ptgt-:cagtGGTCTCa Gctg cctaagttgggcttcaaagaaa
===========PCR system=========
Do the PCR reactions of 1 50ul system:
===========The PCR system＆cycles===========
Total:50ul
Sum:1
H2O:34ul
buffer:5ul
Mg2+:4ul
dNTP:2ul
Ptgt+:2ul
Ptgt-:2ul
taq:2 2U
-----------pcr cycle-------------
94℃for 5min
+++++++++++30cycles
94℃for 30sec
50℃for 45sec
72℃for 1sec
+++++++++++++
72℃for 10min
16℃for 30min
Pcr products and carrier are attached.
===========The Digesting-link Protocal==========
=
H2O:88ul
Buffer:22ul
BsaI/Eco31I:11ul
T4_ligase:11ul
pBWD(LA)BIC-tgtrpt:44ul
target:44ul
--------The Digest-Link(DL)procedure--------
37℃for 20min
++++++++5cycles
37℃for 10min
20℃for 10min
++++++++
37℃for 20min
80℃for 5min
By connection product transformed competence colibacillus
=========conversion==========
By 5-10ul connection products conversion E. coli competent (E. coli competent transformation standard method)
Conversion applies (chloramphenicol) resistance plate, notes needing resistances different from v2 carriers to use dual anti-sieve in cotransformation
Choosing., 37 DEG C are cultivated 12 hours, carry out the identification of bacterial plaque pcr.
=============bacterial plaque PCR identification========
10 bacterial plaques of picking carry out 1.5mlEP pipes and connect bacterium and PCR identifications, primer simultaneously：pBWD(LA)B1C-tgtrpt；
Identification primer Pmkt+：atgagtgtgagcaagggcgagga,Ptgt-.
==========PCR system==========[2015/11/28]
Do the PCR reactions of 10 25ul systems:
===========The PCR system＆cycles===========
Total:25ul
Sum:10
H2O:16.5165ul
buffer:2.5 25ul
Mg2+:2 20ul
dNTP:1 10ul
pmkt+:1 10ul
Ptgt-:1 10ul
taq:1 10U
Template:1ul
-----------pcr cycle-------------
94℃for 5min
+++++++++++30cycles
94℃for 30sec
50℃for 45sec
72℃for 1sec
+++++++++++++
72℃for 10min
16℃for 30min
Correct clone is obtained, pBWD (LA) B1C-tgt for building further is obtained by sequence verification and is identified carrier
(V1)。
2nd, the sequence construct for producing gRNA is constructed (V2) in carrier 2.
Synthesize following 1 pair of primer
PgRNA+:cagtGGTCTCaggcatttctttgaagcccaactt
PgRNA-:cagtGGTCTCaaaacaagttgggcttcaaagaaa
For synthesizing gRNA：atttctttgaa gcccaactt
+=+=+=+=+=+
===========PCR system=========
Do the PCR reactions of 1 50ul system:
===========The PCR system＆cycles===========
Total:50ul
Sum:1
H2O:34ul
buffer:5ul
Mg2+:4ul
dNTP:2ul
PgRNA+:2ul
PgRNA-:2ul
taq:22U
-----------pcr cycle-------------
94℃for 5min
+++++++++++30cycles
94℃for 30sec
50℃for 45sec
72℃for 1sec
+++++++++++++
72℃for 10min
16℃for 30min
Pcr products and carrier are attached.
===========The Digesting-link Protocal==========
=
H2O:8 8ul
Buffer:2 2ul
BsaI/Eco31I:1 1ul
T4_ligase:1 1ul
pBWA(V)H-cas9i:4 4ul
gRNA:4 4ul
--------The Digest-Link(DL)procedure--------
37℃for 20min
++++++++5cycles
37℃for 10min
20℃for 10min
++++++++
37℃for 20min
80℃for 5min
By connection product transformed competence colibacillus
=========conversion==========
By 5-10ul connection products conversion E. coli competent (see E. coli competent transformation standard method)
Conversion applies (card receive mycin) resistance plate, and 37 DEG C are cultivated 12 hours, carry out the identification of bacterial plaque pcr.
=============bacterial plaque PCR identification========
10 bacterial plaques of picking carry out 1.5mlEP pipes and connect bacterium and PCR identifications, primer simultaneously：PBWA (V) H-cas9i identifications are drawn
Thing PgRNA+, Pbw2- (target sequence Pbw2- on carrier framework:gcgattaagttgggtaacgccaggg).
==========PCR system==========
Do the PCR reactions of 10 25ul systems:
===========The PCR system＆cycles===========
Total:25ul
Sum:10
H2O:16.5 165ul
buffer:2.5 25ul
Mg2+:2 20ul
dNTP:1 10ul
pgRNA+:1 10ul
Pbw2-:1 10ul
taq:1 10U
Template:1ul
-----------pcr cycle-------------
94℃for 5min
+++++++++++30cycles
94℃for 30sec
50℃for 45sec
72℃for 1sec
+++++++++++++
72℃for 10min
16℃for 30min
Correct clone is obtained, further Cas9/gRNA expression vectors (V2) is obtained by sequence verification.
3rd, cotransformation
1. about 5 points of 2 μ l DNA (each 1ul of V1, V2 carrier) incubated on ice is added in defrosting thermal shock competent cell on ice
Clock.
2. in the warm water of transfer DNA/cell mixture to 42 DEG C, 90sec is kept.
3. it is put at once and lower the temperature on ice 5min or so.
4. add the LB of 300ulz or so, at 37 DEG C cultured cells 30 minutes to 45min restoring (if doing plasmid conversion
This step can be omitted).
5. shift cell to chloramphenicol ＆ cards and receive culture on the dual anti-culture medium of mycin.
Tetra- Walk：Statistics erythema quantity
12-24 as a child observes the erythroleukoplakia ratio of statistics bacterial plaque, assesses target spot efficiency.
The red white bacterial plaque that cotransformation grows, erythema is represented in target spot detection carrier, and target spot is cut and red fluorescent protein
(mkate) recombinantal repair.
Different target spot Efficiency Statistics such as following tables：
Embodiment two：Checking is based on colibacillary target spot efficiency
1st, the nickase for design, building target validation carrier and act on target spot produces carrier
As shown in figure 1, carrier pBWD (LA) BIC-tgtrpt skeletons part is pBR322 carriers, it is specifically designed and structure portion
The part being divided into from Plac to T7term.Plac is lac promoters, and repU is the upstream sequence of reporter gene (reporter),
RepD is the downstream sequence of reporter gene (reporter), and the latter half of repU and the top half of repD are homologous sequences
, there is homologous recombination in row, the complete sequence of reporter gene is restored so as to active after disconnecting so as to target spot.CcdB is one
As colibacillary gene till death but can survive in bacterial strain DB3.1 because playing negative screening effect, from link
Carrier will make the general Escherichia coli (DH5a, top10 etc.) being converted to survive, so as to improve the efficiency of target clone,
T7term is T7 terminator sequences.During structure by target sequence by way of digestion link insertion vector, and by CcdB (ccdb
For common colibacillary albumen till death, need to can survive in Escherichia coli DB3.1, be commonly used to disappear in molecule clone technology
Except false positive.) replace.
2nd, build to produce and act on the albumen of target spot or the generation carrier of its compound
A, if talen or monooctyl ester ribozyme technology, need structure is expression monooctyl ester albumen and talen restriction endonucleases
Carrier such as Fig. 2, as expressional function are in albumen the latter's albumen composition of target, construction method and conventional expression vector establishment
Similar, here does not do more statements.
B, if the technology based on CAS9, needs the carrier of construction expression cas9 albumen and gRNA, and carrier structure is as schemed
2.Build every time and only need to for the 19bp sequences clone for producing gRNA to replace ccdb sequences into carrier.
3rd, candidate targets are cloned into target validation carrier
The target validation carrier that step 1 is designed will be cloned into by the good candidate targets of bioinformatic analysis, be replaced
Ccdb sequences, obtain the carrier containing target spot still to be tested.
4th, target validation carrier and albumen are produced into carrier corotation checking cell
By the carrier containing target spot still to be tested and step 2 that three steps are obtained obtain can expressional function in the egg of the target spot
White carrier, together cotransformation enter Escherichia coli.Coating plate, after incubated overnight, you can with count amount of bacterial plaque with
And coloured bacterial plaque ratio, and then analyze the efficiency of target spot
5th, ratio assessment target spot efficiency is counted
The brightness case of the ratio and color that count coloured bacterial plaque assesses the efficiency of target, the more much brighter representatives of red bacterial plaque
Target spot efficiency is higher, if it is inactive to represent target spot without coloured bacterial plaque, can not use as follow-up transgenosis.
PBWD (LA) BIC-tgtrpt sequences:
PBWA (V) H-CAS9i sequences
Claims (5)
1. a kind of method that rapid in vivo verifies gene targeting target spot efficiency, it is characterised in that after intracellular DNA break
Can excite homologous fragment that recombinantal repair occurs to realize, by way of the activation recovering that restructuring causes reporter gene target is verified
The activity of point.
2. the method that a kind of rapid in vivo as claimed in claim 1 verifies gene targeting target spot efficiency, it is characterised in that concrete
Show as：Structure inserts the carrier of target spot, and target spot occurs homologous fragment restructuring after disconnecting, by the fast eolor base of two incompleteness because of section
The albumen with full activity is reassembled into, if target spot is active will be cut off, recombination event will be activated, and fast eolor base is because of quilt
Repair, so as to produce coloured bacterial plaque；Otherwise, recombination event is not activated, fast eolor base because being not repaired, then by fast eolor base because
The mode Fast Evaluation target spot efficiency that the color spot of generation is counted.
3. the method that a kind of rapid in vivo as claimed in claim 1 verifies gene targeting target spot efficiency, it is characterised in that target spot
It can be any kind of target spot for genomic DNA editor.
4. the method that a kind of rapid in vivo as claimed in claim 1 verifies gene targeting target spot efficiency, it is characterised in that report
Gene is that various fluorescins or catalysis produce one of reporter gene of enzyme of color reaction.
5. the method that a kind of rapid in vivo as claimed in claim 1 verifies gene targeting target spot efficiency, it is characterised in that checking
Carry out in the cell, these cells can be zooblast, the one kind in plant cell or bacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610596433.7A CN106636298A (en) | 2016-07-26 | 2016-07-26 | Method for rapid in-vivo verification of gene-targeting target efficiency |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610596433.7A CN106636298A (en) | 2016-07-26 | 2016-07-26 | Method for rapid in-vivo verification of gene-targeting target efficiency |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106636298A true CN106636298A (en) | 2017-05-10 |
Family
ID=58852632
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610596433.7A Pending CN106636298A (en) | 2016-07-26 | 2016-07-26 | Method for rapid in-vivo verification of gene-targeting target efficiency |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636298A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113106115A (en) * | 2020-09-21 | 2021-07-13 | 苏州今新生物科技有限公司 | Application of rice OsPDCD5 gene in reducing amylose content in rice |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805118A (en) * | 2015-04-22 | 2015-07-29 | 扬州大学 | Method for targeted knockout of specific gene of Suqin yellow chicken embryonic stem cell |
-
2016
- 2016-07-26 CN CN201610596433.7A patent/CN106636298A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805118A (en) * | 2015-04-22 | 2015-07-29 | 扬州大学 | Method for targeted knockout of specific gene of Suqin yellow chicken embryonic stem cell |
Non-Patent Citations (3)
| Title |
|---|
| NANNAN CHANG等: "《Genome editing with RNA-guided Cas9 nuclease in Zebrafish embryos》", 《CELL RESEARCH》 * |
| RICHA GUPTA等: "Mycobacteria exploit three genetically distinct DNA double-strand break repair pathways", 《MOLECULAR MICROBIOLOGY》 * |
| YI YANG等: "Highly Efficient and Rapid Detection of the Cleavage Activity of Cas9/gRNA via a Fluorescent Reporter", 《APPL BIOCHEM BIOTECHNOL》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113106115A (en) * | 2020-09-21 | 2021-07-13 | 苏州今新生物科技有限公司 | Application of rice OsPDCD5 gene in reducing amylose content in rice |
| CN113106115B (en) * | 2020-09-21 | 2024-05-10 | 苏州今新生物科技有限公司 | Application of rice OsPDCD5 gene in reducing amylose content in rice |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230257757A1 (en) | System and Method of Modular Cloning | |
| CN105112435B (en) | The building and application of plant polygenes knockout carrier | |
| US10612043B2 (en) | Methods of in vivo engineering of large sequences using multiple CRISPR/cas selections of recombineering events | |
| CN102124112B (en) | Homologous recombination-based DNA cloning methods and compositions | |
| CN109706109A (en) | It is a kind of based on the internal plasmid editing system of CRISPR/Cas and lambda Red recombination system and its application | |
| CN103882530B (en) | With stochastic sequence marker plasmid, DNA fragmentation is carried out to the method for high-throughput two ends order-checking | |
| CN106636298A (en) | Method for rapid in-vivo verification of gene-targeting target efficiency | |
| CN106282157A (en) | A kind of DNA assemble method mediated by short nucleotide and application thereof | |
| CN108424907B (en) | High-throughput DNA multi-site accurate base mutation method | |
| CN104212827B (en) | It is independent of the rapid molecular cloning process of bioengineered enzyme | |
| KR20210110790A (en) | Synthesis method of single-stranded DNA | |
| CN102220363A (en) | Method for constructing T vector | |
| CN102787114B (en) | Efficient directional seamless DNA (deoxyribonucleic acid) segment connecting method | |
| CN106103712A (en) | A kind of efficient gene cloning method and application thereof | |
| CN112501199B (en) | Melon aphid yellowed virus infectious clone recombinant vector | |
| CN105802954A (en) | Method for rapidly and seamlessly assembling DNA in vitro on basis of heat-proof DNA polymerase and ligase | |
| CN104357438B (en) | DNA assembling and cloning method | |
| CN105950613A (en) | Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro | |
| CN109266725A (en) | A kind of gene clone method using RNA site specific nucleic acid enzyme | |
| CN111979261A (en) | Multi-gene editing carrier and method for creating tomato fruit color material | |
| CN106318961A (en) | Construction method and application of multi-DNA-segment vector | |
| CN115976058B (en) | Toxin gene and application thereof in construction of recombinant and/or gene-edited engineering bacteria | |
| CN116064626A (en) | Efficient polygene assembly carrier system capable of assembling oversized fragments, construction method thereof and polygene assembly method | |
| CN117677694A (en) | In vivo DNA assembly and analysis | |
| WO2022187697A1 (en) | In vivo dna assembly and analysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170510 |
|
| RJ01 | Rejection of invention patent application after publication |