CN113106115A

CN113106115A - Application of rice OsPDCD5 gene in reducing amylose content in rice

Info

Publication number: CN113106115A
Application number: CN202010996571.0A
Authority: CN
Inventors: 罗小金; 董世青; 辛晓云; 杨金水
Original assignee: Suzhou Jinxin Biotechnology Co ltd
Current assignee: Suzhou Jinxin Biotechnology Co ltd
Priority date: 2020-09-21
Filing date: 2020-09-21
Publication date: 2021-07-13
Anticipated expiration: 2040-09-21

Abstract

The application belongs to the technical field of gene editing breeding, and particularly discloses application of a rice OsPDCD5 gene in reduction of amylose content in rice, namely, firstly, a target fragment is selected from a CDS region of a rice OsPDCD5 gene, then a target sequence of the target fragment selected from the CDS region of the rice OsPDCD5 gene is inserted into a pBWA (V) H-cas9 plasmid to obtain a pBWA (V) H-cas9-OsPDCD5 recombinant plasmid, then the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is transformed into indica rice Changhui T025, the percentages of amylose of screened indica rice Changhui T025-4 and T025-7 mutant strains are respectively 18.47% and 18.04%, and are reduced by 15.7% -17.7% relative to the percentage of 21.91% of the amylose of wild indica rice Changhui T025.

Description

Application of rice OsPDCD5 gene in reducing amylose content in rice

Technical Field

The application relates to the technical field of gene editing breeding, in particular to application of a rice OsPDCD5 gene in reduction of amylose content in rice.

Background

Rice is one of the most important food crops in the world, and about 1/3 people in the world use rice as staple food. With the economic development and the improvement of the living standard of people and the change of the consumption market, the rice quality is increasingly concerned and valued by people, and the improvement of the rice quality becomes an important task in front of people. The amylose content determines the quality of the rice in cooking and taste to a great extent. Genome site-directed editing is a gene targeting technology artificially modifying a genome specific site in an organism, and the genetic information change caused by the gene targeting technology can be stably transmitted among generations. CRISPR/Cas is the latest gene editing technology, can cut DNA at fixed points, and trigger the repair of non-homologous ends in cells or homologous recombination repair and other ways to repair the broken DNA, and can cause genome base to generate mutation such as deletion, insertion or replacement in the repair process. At present, a plurality of characters of rice are reformed by using a CRISPR/Cas9 system at home and abroad, and the characters comprise: tillering angle, early leaf senescence, cold resistance, rice quality and the like.

Related documents report that OsPDCD5 overexpression can induce rice transgenic plants to show programmed death characteristics, such as genome DNA fragmentation, total protein reduction, plant premature death and the like, namely OsPDCD5 participates in the regulation and control of the growth and development process of rice.

The application selects a target fragment in the CDS region of the OsPDCD5 gene, constructs the target fragment into a knockout vector, and then transfers the target fragment into indica rice variety T025 so as to obtain a knockout strain with improved important economic traits.

Disclosure of Invention

In order to reduce the content of amylose in rice, the application provides application of a rice OsPDCD5 gene in reducing the content of amylose in rice.

The application of the rice OsPDCD5 gene in reducing the amylose content in rice adopts the following technical scheme:

an application of rice OsPDCD5 gene in reducing amylose content in rice is disclosed, firstly selecting a target fragment in a rice OsPDCD5 gene CDS region, then using pBWA (V) H-cas9 plasmid as an expression vector, inserting 20 nucleotides in 66 nucleotides of second exon as target sequences in the target fragment selected in the rice OsPDCD5 gene CDS region into pBWA (V) H-cas9 plasmid to obtain pBWA (V) H-cas9-OsPDCD5 recombinant plasmid, then using pBWA (V) H-cas9-OsPDCD5 recombinant plasmid to transform into indica rice Chang T025, using indica rice variety T025 as an example to explain in the application, but not limiting the application in other rice varieties to obtain mutants with low amylose content, the method specifically comprises the following steps:

(1) selection of target sequences

The rice OsPDCD5 gene structure is shown in figure 1, and mainly comprises UTR (non-coding region) at the 5 'end and the 3' end, 6 exons, 5 introns, the first exon only has 3 basic groups of ATG, the sizes of the second to the sixth exons are 66, 50, 65, 72 and 39 basic groups respectively, and the scale size of the upper right corner is 100 bp;

the rice OsPDCD5 gene (GenBank: AY327105), the full length of the sequence of the landing gene is 4421bp, the cDNA sequence is shown as SEQ ID NO: 1, SEQ ID NO: the underlined highlighted part in 1 is 387bp of the coding region length, 154bp of the 5 'end non-coding region length and 389bp of the 3' end non-coding region length; the target sequence selected from the coding region is 20 nucleotides in 66 nucleotides of the second exon, and the sequence is shown as SEQ ID NO: 2 is shown in the specification; encodes 129 amino acids, and has a sequence shown in SEQ ID NO: 3 is shown in the specification;

(2) construction of expression vector containing target sequence in OsPDCD5 gene

The method comprises the steps of adopting pBWA (V) H-cas9 as a vector, and utilizing a target sequence of a rice OsPDCD5 gene coding region as shown in SEQ.ID NO2 as a target site to construct pBWA (V) H-cas9-OsPDCD5 plasmid for targeting a rice OsPDCD5 gene, so as to finally obtain pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

(3) pBWA (V) transformation of H-cas9-OsPDCD5 recombinant plasmid

The pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is transformed into Agrobacterium EHA105 (purchased from Shanghai Wei Tokyo limited Biotech company, Agrobacterium tumefaciens) by a specific operation method

Adding 10 mu L of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells, sequentially placing the cells on ice for 30min, immersing the cells in liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to finish the transformation so as to obtain the agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

adding 110 mu L of the obtained agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 500 mu L of LB liquid culture medium (unprocessed Sangon Biotech, B540111) without antibiotics according to the proportion of 22 percent by volume, controlling the temperature at 28 ℃ and the rotating speed at 150rpm for fermentation for 3-4H to obtain fermentation liquor;

thirdly, centrifuging the fermentation liquor obtained by the second step for 10min at the rotation speed of 4000rpm to collect thalli, uniformly mixing the thalli collected by centrifugation with supernatant obtained by centrifuging the fermentation liquor with the volume of 10-11%, and then coating the mixture on an LB plate culture medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin (the preparation method of the LB plate culture medium is that 1000ml of LB liquid culture medium +15g of agar powder (Genebase Gene Tech, A-2180) + three antibiotics) is cultured for 36-72h at the temperature of 28 ℃ to form bacterial plaques on the LB plate culture medium;

picking bacterial plaques by using toothpicks, carrying out bacterial plaque PCR identification in an LB liquid culture medium, wherein the bacterial plaques which are successfully identified by the PCR identification are transformants, and the transformants are agrobacterium tumefaciens EHA105 containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmids and are named as EHA105/cas9-OsPDCD 5;

selecting 1 bacterial plaque with positive bands and successfully identified by PCR, carrying out 1.5ml of EP pipe-connected bacteria, and culturing in a shaking table at 28 ℃, thus obtaining agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmids;

the above 1.5ml EP tube contains 1ml LB liquid medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin;

(4) t025 mature seed callus induction and culture

Taking T025 mature seeds, removing shells, firstly soaking and washing for 10min by using 70% ethanol under aseptic conditions, then washing for 5 times by using sterile water, then soaking in 0.1% by volume of mercuric chloride aqueous solution for 20min, and then washing for 3 times by using sterile water to obtain aseptic T025 mature seeds;

inoculating the obtained sterile T025 mature seeds into an induction culture medium, inducing callus for 15-20 days under the dark condition at the temperature of 26-28 ℃, then transferring into a new induction culture medium or a subculture medium, and continuously inducing callus for 7-10 days to obtain callus;

(5) and infection with Agrobacterium

Inoculating 500ul of agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 50ml of LB liquid culture medium containing 50ug/ml rifampicin and 50ug/ml kanamycin, culturing for about 16H in a shaking table at the controlled temperature of 28 ℃, measuring OD600 every 5min until the concentration OD600 of the agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is approximately equal to 0.8, and collecting bacterial solution;

② suspend

Centrifugally enriching the obtained agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 being approximately equal to 0.8 in a 50ml centrifuge tube for 1 time, suspending the bacterial solution into 50ml of infection solution, and continuously culturing the bacterial solution with the temperature being controlled at 28 ℃ and the rotating speed being 200rpm until OD600 being approximately equal to 0.1;

③ infection

Airing the callus cultured in the step (4) on sterile filter paper, then transferring the callus to an agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid and having OD600 ≈ 0.1 at one time, uniformly mixing, then controlling the rotating speed to be 150rpm, mixing for 15-20min, and then pouring out the bacterial solution to obtain infected callus;

(iv) Co-culture

Placing the infected callus obtained in the step (c) on sterile filter paper until the bacteria liquid is sucked dry, and thenIs connected to N₆Culturing in D-AS culture medium at 22 deg.C in dark for 2-3 days, and culturing infected callus and N₆The contact part of the D-AS culture medium has a mycoderm to obtain a callus infected by the agrobacterium EHA 105;

in the co-culture process, the incubator is not required to be opened frequently so as to prevent the water film from being generated due to too large temperature change;

(6) screening for resistant callus

Adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing the flask with sterile water until the effluent is clear and transparent, pouring out the sterile water, adding the callus infected by the agrobacterium EHA 105/into N containing 500mg/L of termetin₆D, mixing in a liquid culture medium at 100rpm for 15-20min, and pouring off 500mg/L N containing timentin₆D liquid culture medium, washing with sterile water, adding N containing 500mg/L timentin₆D, liquid culture medium, 100rpm,15-20min, dumping N containing 500mg/L timentin₆D, liquid culture medium;

repeating the above steps for 2-3 times to obtain callus infected by agrobacterium EHA105 and weak against timentin;

secondly, pouring the callus infected by the agrobacterium EHA105 of the weak anti-timentin obtained in the step one onto sterile filter paper, and sucking for about 2 hours to obtain dry callus infected by the agrobacterium EHA105 of the weak anti-timentin;

③ transferring the dry callus infected by agrobacteria EHA105 and weak against timentin into N containing 250mg/L timentin₆D, in a liquid culture medium, no hygromycin B is added, and dark culture is carried out for 7-10 days at the temperature of 28 ℃ to obtain a callus crude product with strong timentin resistance and infected by the agrobacterium EHA 105;

(7) placing the crude callus infected by the agrobacterium EHA105 and having strong timentin resistance obtained in the step (6) on a selective culture medium plate containing 500mg/L timentin and 50mg/L hygromycin B for primary screening culture, and controlling the temperature to be 28 ℃ in the screening culture process for culture for 15-20 days;

repeating the screening process once to obtain a light yellow callus pure product which has strong resistance to timentin and hygromycin B and is infected by the agrobacterium tumefaciens EHA 105;

(8) differentiation of resistant callus

Transferring the obtained faint yellow callus pure product with strong timentin and hygromycin B resistance infected by agrobacterium EHA105 into an MS differentiation culture medium, culturing for 15-20 days under the illumination condition, then replacing the MS differentiation culture medium once, culturing for 15-20 days under the continuous illumination condition until 1-5cm green buds grow, stripping redundant calluses around, cutting off roots, leaving about 0.5cm long, and then transferring into a rooting culture medium for rooting culture to obtain seedlings;

the obtained seedling is about 10-15cm high, the root system is vigorous, and the obtained seedling with too small size is strengthened by root cutting, leaf cutting and re-cultivation;

adding 1cm of normal-temperature sterilized water into the obtained seedlings, performing transition culture for 2 days at the temperature of 25-30 ℃ and in an environment with the relative humidity of more than 50%, cleaning the culture medium attached to the roots, transplanting the culture medium into a container with sterilized soil, and transferring the culture medium to a greenhouse for 115-year and 125-day culture to obtain T0 generation transformed plants;

culturing T0 generation transformed plant at 28 deg.C in greenhouse to obtain T1 seed;

harvesting T1 seeds, raising seedlings, transplanting seedlings and harvesting seeds to obtain T2 generation seeds, namely the indica rice Changhui T025 mutant strain with low amylose content.

The application only takes indica rice Changhui T025 as an example for explanation, and the obtained 2 indica rice Changhui T025 mutant plants are indica rice Changhui T025-4 plants and indica rice Changhui T025-7 plants respectively, but the application of the defective OsPDCD5 gene in reducing the content of amylose in other rice varieties is not limited.

The application has the following beneficial effects:

the application of the rice OsPDCD5 gene in reducing the amylose content in rice is characterized in that a target sequence selected from a CDS region of an OsPDCD5 gene is constructed to a knockout carrier and is transferred into a wild type indica rice Changhui T025, the plant height, the main ear length and the average ear number of the obtained indica rice Changhui T025-4 and indica rice Changhui T025-7 mutant strains are obviously increased, and compared with the wild type Changhui T025, the tiller numbers of the indica rice Changhui T025-4 and the indica rice Changhui T025-7 mutant strains are respectively increased by 32.11 percent and 13.76 percent; the average grain number of grains per ear is respectively increased by 6.58 percent and 14.18 percent;

further, compared with wild type indica rice Changhui T025, thousand seed weight and single plant yield of the obtained indica rice Changhui T025-4 and indica rice Changhui T025-7 mutant strains are obviously improved, the thousand seed weight is respectively improved by 18.26 percent and 12.14 percent, and the single plant yield is respectively improved by 31.35 percent and 31.82 percent.

Furthermore, compared with wild type indica rice Changhui T025, the amylose content of the obtained mutants of indica rice Changhui T025-4 and indica rice Changhui T025-7 is obviously reduced, and the amylose content of the mutants of indica rice Changhui T025-4 and indica rice Changhui T025-7 is respectively reduced by 15.7-17.7%.

Drawings

FIG. 1 shows the structure of OsPDCD5 gene of rice;

FIG. 2 is a schematic structural diagram of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

FIG. 3a is the growth phenotype diagram of the strain of indica rice Changhui T025-4 and the wild type indica rice Changhui T025 in mature period;

FIG. 3b is the particle size distribution diagram of the mutant strain of indica rice Changhui T025-4 and the wild type indica rice Changhui T025;

FIG. 4a is the growth phenotype diagram of the strain of mutant indica rice Changhui T025-7 and the wild type indica rice Changhui T025 in mature period;

FIG. 4b is a diagram showing the particle size distribution of the mutant strain of indica rice Changhui T025-7 and the wild type indica rice Changhui T025;

FIG. 5 shows the amylose content of wild type mutant strains of indica rice Changhui T025, indica rice Changhui T025-4 and T025-7.

Detailed Description

The present application is further illustrated by the following specific examples in conjunction with the accompanying drawings, but is not limited thereto.

Determination of amylose content of OsPDCD5 mutant strain

a. 2-3 g of rice flour sample which is prepared by using a polished rice sample and passes through a sieve with the aperture of 0.25mm is placed in a 100mL volumetric flask. 1.0mL of 95% ethanol was added, the flask was shaken gently to wet and disperse the sample, 9.0mL of 1.00mol/L sodium hydroxide solution was added, the alkali solution was allowed to slowly flow down the neck wall, and the flask was rotated to wash the sample adhered to the wall of the flask with the alkali solution. Boiling the volumetric flask in boiling water bath for 10min, taking out, cooling to room temperature, and adding distilled water to constant volume. 5.0mL of the sample solution was aspirated, and the sample solution was added to a 100mL volumetric flask containing half of the distilled water, 1.0mL of 1.00mol/L acetic acid solution was added to the volumetric flask to acidify the sample, 1.50mL of iodine solution was added, and the mixture was sufficiently shaken. Adding distilled water to desired volume, and standing for 20 min. A blank solution was prepared by replacing the sample with 5mL of 0.09mol/L sodium hydroxide solution. And (3) adjusting the zero point of the blank solution at the wavelength of 620nm of the spectrophotometer and measuring the absorbance value of the colored sample solution.

b. Drawing a standard curve:

0.1000g of each of the standard samples having known amylose contents of high, medium and low contents stored under the same conditions for three or more days as the sample to be measured is weighed and measured simultaneously with the sample to be measured by the above-mentioned improved simplified method. Taking amylose of a standard sample as an ordinate, and taking a corresponding absorbance value as an abscissa, and drawing a standard curve or a regression equation listing the curve:

Y＝a+bx

in the formula: y-amylose content of the sample; a-standard curve intercept; b-the slope of the standard curve; absorbance value of x-sample.

c. Presentation of results

The amylose content of rice samples is expressed as a percentage of amylose on the dry weight of the sample and can be read directly from a amylose standard curve or determined from the regression equation of the standard curve using the absorbance values of the samples. The measurement is repeated once, and the relative difference of the results of the two measurements is less than 1%.

The composition of the various media used in the examples of the present application is shown in the following table:

(Note: autoclaving at 115 ℃ for 20min)

The experimental methods used in the examples of the present application are all conventional methods unless otherwise specified, and the materials, reagents, and the like used therein are commercially available without otherwise specified.

Example 1

The application of the rice OsPDCD5 gene in reducing the amylose content in rice specifically comprises the following steps:

(1) pBWA (V) construction of H-cas9-OsPDCD5 vector:

firstly, enzyme cutting sites Eco31I (BsaI) are designed in primers yjstgt (+): cagtGGTCTCaggcacccagagttggaagcta (the sequence is shown as SEQ ID NO: 4) and yjstgt (-): cagtGGTCTCaaaacgatagcttccaactctg (the sequence is shown as SEQ ID NO: 5), and then 20bp target sequences in the CDS region of the OsPDCD5 gene are amplified by using the primers yjstgt (+) and yjstgt (-), and the nucleotide sequences are as follows: acccagagttggaagctatc, obtaining a PCR product (the sequence of which is shown in SEQ ID NO: 5) containing the enzyme cutting site Eco31I (BsaI): cagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg, the PCR product was named OsPDCD 5;

secondly, tapping after agarose electrophoresis, recovering a PCR product OsPDCD5, and purifying the DNA fragment by using a kit (crude Sangon Biotech, B518131) to obtain a PCR purified product OsPDCD 5;

preparing an enzyme digestion connecting system, wherein the components and contents of the raw materials in the enzyme digestion connecting system with the total volume of 20 mu L are as follows:

subjecting 20ul enzyme-cleaved connected system prepared according to the composition and content to PCR instrument (Bio-Rad S0000Thermal Cycler) at 37 deg.C for 20min, 5 cycles; 37 ℃ for 10 min; 20 ℃ for 10 min; after the treatment at 37 ℃ for 20min, pBWA (V) H-cas9-OsPDCD5 ligation product is obtained;

fourthly, 5-10 mu L of pBWA (V) H-cas9-OsPDCD5 ligation product in the third step is sucked and added into escherichia coli DH5 alpha competent cells (purchased from Shanghai Weidi Biotechnology limited), the cells are incubated for 30min on ice, heat shock is carried out for 1min at 42 ℃, the cells are incubated for 2min on ice, 900 mu L of LB culture medium is added, and the cells are cultured for 1H at 37 ℃ to carry out activation and resuscitation of the escherichia coli DH5 alpha competent cells;

coating the recovered escherichia coli DH5 alpha competent cells on an LB solid plate containing daunomycin, and carrying out inverted culture for 12h in a 37 ℃ incubator to obtain escherichia coli DH5 alpha monoclonal for carrying out plaque PCR identification;

selecting 10 bacterial plaques to carry out bacterial plaque PCR identification (Lihua, Liuyanlin and the like, the application of the bacterial colony PCR technology in screening and identification of recombinant plasmids, the scientific and technical university journal of northwest agriculture and forestry (Nature science edition), volume 32 in 9 months in 2004 and pages 35-37) to determine whether the connection is successful;

identifying primer Pbw2 +: GGCGTCTTCTACTGGTGCTA (the sequence is shown as SEQ ID NO: 6), Pbw 2-: GTCTTTACGGCGAGTTCTGT (the sequence is shown as SEQ ID NO: 7), the length of the amplified fragment is 422bp (the sequence is shown as SEQ ID NO: 8), the amplified PCR stock solution is subjected to agarose gel electrophoresis, and whether a positive band (422bp size) exists is detected;

taking 3 corresponding bacterial plaques with positive bands detected by agarose electrophoresis, inoculating the bacterial plaques into a 1.5ml EP tube containing 700ul of LB culture solution (raw Sangon Biotech, B540111), carrying out shake culture at 37 ℃ for 3h, taking bacterial solution for sequencing, and obtaining a result, wherein the sequence is shown as SEQ ID NO: 8, judging consistency;

and (3) comparing the sequencing result with the sequence shown as SEQ ID NO: using the bacterial liquid with the consistent sequence result as bacterial liquid with the correct sequencing result, taking 500ul to perform bacterial conservation (500ul of 50% glycerol +500ul of LB bacterial liquid), taking 200ul of bacterial liquid to inoculate into 2ml of LB culture liquid, shaking a bed at 37 ℃ to perform amplification culture for 12H, and then using a plasmid extraction kit (original engineering Sangon Biotech, B518191) to extract plasmids to obtain pBWA (V) H-cas9-OsPDCD5 recombinant plasmids, wherein the structural schematic diagram of the recombinant plasmids is shown in figure 2 and contains 35S promoter, U6 promoter, target sequence of OsPDCD5 gene, cas9 protein, NOS terminator, screening hygromycin and the like;

(2) pBWA (V) transformation of H-cas9-OsPDCD5 recombinant plasmid

Adding 10 mu L of pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells, sequentially placing on ice for 30min, immersing in liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to obtain the agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

adding 110 mu L of the obtained agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmids into 500 mu L of LB liquid culture medium (raw Sangon Biotech, B540111) without antibiotics, controlling the temperature at 28 ℃ and the rotating speed at 160rpm for fermentation for 3-4H to obtain fermentation liquor;

③ centrifuging the obtained fermentation liquor at 4000rpm for 10min to collect thalli, centrifuging the thalli collected by centrifugation with 60ul to obtain supernatant, mixing uniformly, and then coating the mixture on an LB plate culture medium containing 20ug/ml rifampicin, 25ug/ml gentamicin and 30ug/ml kanamycin (the preparation method of the LB plate culture medium is that 1000ml LB liquid culture medium +15g agar powder (Genebase Gene Tech, A-2180) + three antibiotics) to culture for 36-72h at 28 ℃, and forming bacterial plaques on the LB plate culture medium;

10 bacterial plaques are picked and simultaneously subjected to 1.5ml of EP inoculation and PCR (polymerase chain reaction) to identify whether the connection is successful, and a primer Pbw2+ used is identified: GGCGTCTTCTACTGGTGCTA (the sequence is shown as SEQ ID NO: 6), Pbw 2-: GTCTTTACGGCGAGTTCTGT (the sequence is shown as SEQ ID NO: 7), the length of the amplified fragment is 422bp (the sequence is shown as SEQ ID NO: 8), the amplified PCR stock solution is subjected to agarose gel electrophoresis, and whether a positive band (422bp size) exists is detected;

(3) t025 mature seed callus induction and culture

Taking T025 mature seeds, removing shells, firstly soaking and washing for 10min by using 70% ethanol under aseptic conditions, then washing for 5 times by using sterile water, then soaking for 20min by using 0.1% mercury chloride aqueous solution in percentage by volume, and then washing for 3 times by using sterile water to obtain sterile T025 mature seeds;

inoculating the obtained sterile T025 mature seeds into an MS induction solid medium plate, inoculating 10 sterile T025 mature seeds on the MS induction solid medium plate with each diameter of 90mm, inoculating 10 plates, culturing for about 15 days at 28 ℃ in the dark until callus is available, peeling the induced callus for subculture, removing endosperm and embryo, transferring the callus into a new MS induction solid medium, and continuously culturing for 7-10 days to obtain callus;

if the wound is larger, the wound can be reduced by using tweezers in the step;

note: drying the MS induced solid culture medium for more than 1h on a sterile operating platform after the MS induced solid culture medium is poured into a flat plate, and simultaneously sucking the transferred callus on sterile filter paper to ensure that no water film exists between the callus and the MS induced solid culture medium during subculture;

(4) and infection with Agrobacterium

Inoculating 500ul of the agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid obtained in the step (2) into 50ml of LB liquid culture medium containing 50ug/ml rifampicin and 50ug/ml kanamycin, controlling the temperature to be 28 ℃ and culturing in a shaking table for about 16H, measuring OD600 every 5min until the concentration OD600 of the agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is about 0.8, and collecting the bacterial solution;

② suspend

Centrifuging and enriching the obtained agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid and having OD600 about 0.8 in a 50ml centrifuge tube for 1 time, suspending the bacterial solution into 50ml infection solution, continuously culturing the bacterial solution until OD600 about 0.1 at the temperature of 28 ℃ and the rotating speed of 200rpm to obtain the agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid and having OD600 about 0.1;

③ infection

Airing the callus cultured in the step (3) on sterile filter paper, then transferring the callus into an agrobacterium EHA105 bacterial solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid and having OD600 ≈ 0.1 at one time, uniformly mixing, then controlling the rotating speed to be 150rpm, mixing for 15-20min, and then pouring out the bacterial solution to obtain infected callus;

(iv) Co-culture

Placing the infected callus obtained in the step three on sterile filter paper until the bacterial liquid is sucked dry, and then connecting to N₆In a D-AS culture medium, controlling the temperature at 22 ℃, culturing in dark for 2-3 days, and culturing infected callus and N₆Contacting part of the D-AS culture medium with a bacterial membrane to obtain a callus infected by the agrobacterium EHA 105;

(5) screening for resistant callus

Adding the obtained callus infected by the agrobacterium EHA105 into a 100ml triangular flask, washing the callus with sterile water until effluent is clear and transparent, pouring out the sterile water, adding the callus infected by the agrobacterium EHA105 into N containing 500mg/L timentin₆Mixing in liquid culture medium D at 100rpm for 15-20min, and pouring out N containing timentin 500mg/L₆D, cleaning the liquid culture medium with sterile water;

repeating the above infection of callus with Agrobacterium EHA105 to N containing timentin 500mg/L₆Mixing in liquid culture medium D at 100rpm for 15-20min, and pouring out N containing timentin 500mg/L₆D, liquid culture medium, until the process of washing with sterile water is 2-3 times, obtaining the callus infected by the agrobacterium EHA105 and weak against timentin;

③ transferring the dry callus infected by agrobacteria EHA105 and weak against timentin into N containing 250mg/L timentin₆D, in a liquid culture medium, no hygromycin B is added, and dark culture is carried out for 7-10 days at the temperature of 28 ℃ to obtain a callus crude product which has strong resistance to the timentin and is infected by the agrobacterium EHA 105;

(6) placing the crude callus infected by the agrobacterium EHA105 and having strong resistance to timentin obtained in the step (5) on a selective culture medium plate containing 500mg/L timentin and 50mg/L hygromycin B for primary screening culture, and controlling the temperature to be 28 ℃ in the screening culture process for culture for 15-20 days;

repeating the screening culture process once to obtain a pure callus infected by the agrobacterium tumefaciens EHA105 and having strong resistance to timentin and hygromycin B;

(7) differentiation of resistant callus

Transferring the obtained pure callus infected by the agrobacterium EHA105 with strong timentin and hygromycin B resistance into an MS differentiation culture medium, culturing for 15-20 days under the illumination condition, then replacing the MS differentiation culture medium once, culturing for 15-20 days under the continuous illumination condition until 1-5cm green buds grow, stripping redundant calluses around, cutting off roots to leave about 0.5cm long, and then transferring into a rooting culture medium for rooting culture to obtain 10-15cm seedlings;

cutting roots and leaves of the obtained fine seedlings, and then transferring and cultivating the fine seedlings again to strengthen the seedlings;

adding the obtained 10-15cm seedlings into 1cm of normal-temperature sterilized water, performing transition culture for 2 days at the temperature of 25-30 ℃ and in an environment with the relative humidity of more than 50%, then cleaning the rooting culture medium attached to the roots, transplanting the rooting culture medium into a container with sterilized soil, and transferring the rooting culture medium into a greenhouse for culturing 115-year and 125-day harvest to obtain T0-generation transformed plants;

(8) screening and detecting of transformed plants

PCR amplification is adopted to detect candidate T0 generation transformed plants, and the used amplification primers are as follows: Hyg-CX-S: AGATGTTGGCGACCTCGTATT (the sequence is shown in SEQ ID NO: 9); Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT (the sequence is shown in SEQ ID NO: 10), detecting whether the T0 generation transformed plant contains hygromycin B screening marker, obtaining 21 transformed plants containing hygromycin B screening marker;

culturing the 21 transformation plants (namely T0 generation, numbered T0-1, T0-2 and … T0-21) containing the hygromycin B screening marker at 28 ℃ in a greenhouse until the transformation plants bear seeds, namely T1 generation, directly seeding the harvested T1 generation seeds (each numbered 20 seeds for seedling cultivation and 10 seedlings are randomly selected for seedling transplantation) in 2017 in a 6-month seedling field in a Taicang base seedling field of the university of double denier of Jiangsu province in China, transplanting the seedlings in 7 months, growing in the field, harvesting the individual plants in 10 mid-month of the same year to obtain T2 generation seeds, and simultaneously taking leaves corresponding to the individual plants;

② screening and detecting CDS region mutation plant of OsPDCD5

Extracting genomic DNA from leaves corresponding to the T2 seed individuals obtained in the step (1), and detecting the primer MPCD6-F by using OsPCDC 5: TGGAGGGAGTACATGTTTTAGGTG (the sequence of which is shown in SEQ ID NO: 11) and MPCD 6-R: ATAAACATGGTTGACAAATAGAGC (the sequence is shown in SEQ ID NO: 12), performing PCR, running the PCR product on agarose gel electrophoresis, and sequencing the 427bp band as shown in SEQ ID NO: 13) is shown in the figure;

the purpose of the PCR sequencing is to detect whether the 20bp target sequence of the OsPDCD5 of the single strain obtained in the step (1) is mutated; comparing the sequencing result with the standard SEQ ID NO: 2, after finding that 20bp target sequences of 9 plants OsPDCD5 in 21 plants obtained in the step (8) are changed, namely the 9 plants are plants with mutation of the target sequences of OsPDCD5 genes and are named as T025-1-T025-9, while only T025-4 and T025-7 are homozygous lines (DNA is double-chain, and only one DNA chain OsPDCD5 target sequence is possible to have mutation), and T025-4 and T025-7 are taken as research objects.

The sequencing results of the target sequences at 20bp of indica rice Changhui T025, indica rice Changhui T025-4 and indica rice Changhui T025-7 are as follows:

wherein the indica rice Changhui T025 is a wild type and is an original 20bp target sequence of OsPDCD5, and the sequence of the target sequence is shown as SEQ ID NO: 2, wherein the Changhui T025-4 and the T025-7 are mutant strains with mutant OsPDCD5 target sequences respectively;

compared with wild indica rice Changhui T025 strain, the indica rice Changhui T025-4 mutant strain is formed by inserting an A base into the 3 rd to 4 th base at the 3' end of a 20bp target sequence, and the sequence is shown as SEQ ID NO: 14 is shown in the figure;

compared with wild indica rice Changhui T025, the indica rice Changhui T025-7 mutant strain deletes four bases of GCTA at the 3' end of a 20bp target sequence, and the sequence is shown as SEQ ID NO: 15 is shown in the figure;

(9) OsPDCD5 transgenic T₃Survey and statistics of generation population yield and quality traits

Seeds of the mutant strain of the indica type rice Changhui T025-4 and T025-7 (generation T2) and wild type indica type rice Changhui T025 (used as a control) are sowed in 6 months in 2018, are directly sowed in the seedling fields of Taicang base of the university of Redding of Jiangsu province, the seedlings are transplanted in 7 months, 30 seedlings are transplanted in each regional field, the row spacing is 6 inches multiplied by 6 inches, 10 seedlings are planted in each row, the steps are repeated for 3 times (90 seedlings are planted in total), and the seedlings grow under the field condition.

And (4) counting 30 individual plants in each region in the maturation period to calculate the average value, and counting the yield characters. Then, the seeds of each of the plants in each repetition were mixed (namely, 30 seeds were collected together, and the seeds were designated as T3 generation), and 500g of each of the repetitions was taken to measure the amylose content of rice (3 repetitions in total). The above statistics are as follows:

statistical table of yield characters and quality characters of wild indica rice Changhui T025, indica rice Changhui T025-4 and T025-7 mutant strains

As can be seen from the above table, the plant height and main ear length of mutant strain of indica rice Changhui T025-4 and T025-7 are obviously increased compared with wild indica rice Changhui T025;

furthermore, the tiller number and the average grain number are obviously increased, and compared with the wild type indica rice Changhui T025, the tiller number of the mutants of the indica rice Changhui T025-4 and T025-7 is respectively increased by 32.11 percent and 13.76 percent;

furthermore, the average grain numbers of the mutant strains of the indica rice Changhui T025-4 and T025-7 are respectively increased by 6.58 percent and 14.18 percent compared with the wild indica rice Changhui T025;

further, compared with wild type indica rice Changhui T025, thousand grain weight and single plant yield of mutant strains of indica rice Changhui T025-4 and T025-7 are obviously improved, particularly thousand grain weight is respectively improved by 18.26 percent and 12.14 percent, and single plant yield is respectively increased by 31.35 percent and 31.82 percent.

Furthermore, compared with the wild type indica rice Changhui T025, the amylose content of the mutant strains of the indica rice Changhui T025-4 and T025-7 is obviously reduced, and the amylose content of the mutant strains of the indica rice Changhui T025-4 and T025-7 is respectively 18.47 percent and 18.04 percent, namely the amylose content of the wild type indica rice Changhui T025 is 21.94 percent, which is respectively reduced by 15.7 percent to 17.7 percent.

Photographing the growth phenotype of the obtained mutant strains of the indica type rice Changhui T025-4 and T025-7 and the wild type indica type rice Changhui T025 in the mature period, wherein the obtained phenotype graphs are shown as figures 3a and 4a, and the obtained mutant strains of the indica type rice Changhui T025-4 and T025-7 are obviously higher than the strain height of the wild type indica type rice Changhui T025, the main ears are longer and the tiller number is more; meanwhile, the grain diameters of the seeds of the mutant strains of the indica type rice Changhui T025-4 and Changhui T025-7 and the wild type indica type rice Changhui T025 are photographed, and the results are shown in fig. 3b and 4b, and it can be seen from fig. 3b and 4b that the length of the grain diameters of the seeds of the mutant strains of the indica type rice Changhui T025-4 and T025-7 is increased compared with the wild type indica type rice Changhui T025, thereby further proving that the thousand seed weight and the single plant yield of the mutant strains of the indica type rice Changhui T025-4 and T025-7 are obviously improved.

In conclusion, compared with wild type indica rice Changhui T025, the strain height, main spike length, tillering number, average spike grain number, thousand grain weight, obvious increase of single plant yield and obvious reduction of amylose content of the mutant strain of the indica rice Changhui T025-4 and T025-7 are analyzed because a target sequence is selected from the CDS region of the OsPDCD5 gene to construct a knockout vector and transfer the knockout vector into the wild type indica rice Changhui T025 to regulate and control the metabolism of the wild type indica rice Changhui T025.

The present embodiment is only for explaining the present application, and it is not limited to the present application, and those skilled in the art can make modifications of the present embodiment without inventive contribution as needed after reading the present specification, but all of them are protected by patent law within the scope of the claims of the present application.

Sequence listing

<110> Suzhou today's New Biotechnology Co., Ltd

Application of rice OsPDCD5 gene in reducing content of amylose in rice

<160> 16

<170> SIPOSequenceListing 1.0

<210> 1

<211> 930

<212> DNA

<213> Artificial sequence (")

<400> 1

ggagagaggc ccagatgagt tgcgttaaat ccacgggtga ggagagagaa aaaggaggtc 60

aagttctctc tctcttcctc tcgtcgccgg aggcgggagg ccatcgacgc tgaagtgaag 120

gggatcgcga tctccggcga gcgtgcgggg gaagatggct gacccagagt tggaagctat 180

caggcagagg agaatgcaag agctaatggc acagcatggt gcggcaaatc cgcaaaatgc 240

tgggcaacaa aaagctcaag aagatgcaaa gcaggaagct gaggaacggc ggcagatgat 300

gcttgctcag attttatctt ctgaagctag agaaaggctc tcccgcatag ctttggtcaa 360

acctgataaa gcaagagggg tggaggatgt tcttctgaga gctgctcagt ccggtggaat 420

atctgaaaag gtgtctgaag aaaggcttat ctcacttctg gagcaaatca atacccacac 480

tagcaaacag acgaaagtta cgattcagag gcgccggagc gtccttgacg atgatgacta 540

gctgcatgtg tgttgtgtgt acgatgagct ggtggaggag tctgctgtag cgcaaaacta 600

cttagaaatg atgattatca aacgctatat caacaaccat caaaacttga gcgactattt 660

gatggatatt tggccgtata tgaattaatt cgagtttggt ttggcttgtt ccattgatga 720

cattcaaact tttgactgct ccgaagggga attgccacac gtccgactgg tatgtacgac 780

ttagcatccg accagtactt acctgctcct tgctctggcc cacatggaga gcagctggct 840

cgttggagta aattgattag cgaacaatag ggtcggatgt atagcagtac tcgctccgaa 900

gtgtgtatcc atcatatcat gagtatctta 930

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 3

acccagagtt ggaagctatc 20

<210> 4

<211> 128

<212> PRT

<213> Artificial sequence (")

<400> 4

Met Ala Asp Pro Glu Leu Glu Ala Ile Arg Gln Arg Arg Met Gln Glu

1 5 10 15

Leu Met Ala Gln His Gly Ala Ala Asn Pro Gln Asn Ala Gly Gln Gln

20 25 30

Lys Ala Gln Glu Asp Ala Lys Gln Glu Ala Glu Glu Arg Arg Gln Met

35 40 45

Met Leu Ala Gln Ile Leu Ser Ser Glu Ala Arg Glu Arg Leu Ser Arg

50 55 60

Ile Ala Leu Val Lys Pro Asp Lys Ala Arg Gly Val Glu Asp Val Leu

65 70 75 80

Leu Arg Ala Ala Gln Ser Gly Gly Ile Ser Glu Lys Val Ser Glu Glu

85 90 95

Arg Leu Ile Ser Leu Leu Glu Gln Ile Asn Thr His Thr Ser Lys Gln

100 105 110

Thr Lys Val Thr Ile Gln Arg Arg Arg Ser Val Leu Asp Asp Asp Asp

115 120 125

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence (")

<400> 5

cagtggtctc aggcacccag agttggaagc ta 32

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence (")

<400> 6

cagtggtctc aaaacgatag cttccaactc tg 32

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 7

ggcgtcttct actggtgcta 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (")

<400> 7

gtctttacgg cgagttctgt 20

<210> 8

<211> 422

<212> DNA

<213> Artificial sequence (")

<400> 8

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgttgga 60

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 120

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 180

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 240

ttgtgcagat gatccgtggc acccagagtt ggaagctatc gttttagagc tagaaatagc 300

aagttaaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt 360

tttgtcgtag acatggagtc aaagattcaa atagaggacc taacagaact cgccgtaaag 420

ac 422

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (")

<400> 9

agatgttggc gacctcgtat t 21

<210> 10

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 10

aagatcgtta tgtttatcgg cact 24

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 11

tggagggagt acatgtttta ggtg 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 12

ataaacatgg ttgacaaata gagc 24

<210> 13

<211> 427

<212> DNA

<213> Artificial sequence (")

<400> 13

tggagggagt acatgtttta ggtgtcttgc taaatattaa atatagatac gaagattata 60

ttatgtgcac tccaaatatt cgtcttagac aacatttcag tttatgtaag aggaagcaat 120

agttcaatgc tatccataaa ggcattgttc taccatgtaa cttctcctga tggaactata 180

aactcttatt gctaggctga cccagagttg gaagctatca ggcagaggag aatgcaagag 240

ctaatggcac agcatggtgc ggtaagcctg tggttcatgg tgaaaagttg aagctgcaac 300

agcaatgtcc agttctcttg gctgactttg atgtactatt gtcctttagg caaatccgca 360

aaatgctggg caacaaaaag ctcaagaaga tgcaaagcag tatgctctat ttgtcaacca 420

tgtttat 427

<210> 14

<211> 21

<212> DNA

<213> Artificial sequence (")

<400> 14

acccagagtt ggaagctaat c 21

<210> 15

<211> 16

<212> DNA

<213> Artificial sequence (")

<400> 15

acccagagtt ggaatc 16

<210> 16

<211> 24

<212> DNA

<213> Artificial sequence (")

<400> 16

aagatcgtta tgtttatcgg cact 24

Claims

1. Rice (Oryza sativa L.) with improved resistance to stressOsPDCD5The application of the gene in reducing the content of amylose in rice is characterized in that the gene is applied to the riceOsPDCD5Selecting target fragment from CDS region of gene, adopting pBWA (V) H-cas9 plasmid as expression vector to make rice have high expression efficiencyOsPDCD5Target sequences of target fragments selected from a CDS region of the gene are inserted into pBWA (V) H-cas9 plasmid, then the obtained pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is transformed into indica rice Changhui T025, and PCR detection and first-generation sequencing screening are carried out to obtain indica rice Changhui T025-4 and T025-7 mutant strains with reduced amylose content.

2. The rice of claim 1OsPDCD5Application of gene in reducing amylose content in rice, characterized in that the rice is provided withOsPDCD5The target sequence of the selected target fragment in the CDS region of the gene is shown as SEQ ID NO: 2, respectively.

3. The rice of claim 1OsPDCD5The application of the gene in reducing the amylose content in rice is characterized in that the target sequence of the obtained indica rice Changhui T025-4 mutant strain with reduced amylose content is shown as SEQ ID NO: as shown at 14.

4. The rice of claim 1OsPDCD5The application of the gene in reducing the amylose content in rice is characterized in that the target sequence of the obtained indica rice Changhui T025-7 mutant strain with reduced amylose content is shown as SEQ ID NO: shown at 15.

5. The rice of claim 1OsPDCD5The application of the gene in reducing the amylose content in rice is characterized in that the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is transformed into indica rice Changhui T025, and the specific steps are as follows:

the mature seeds of the indica rice Changhui T025 are hulled and disinfected, then inoculated on an induction culture medium for induction callus, subcultured for about 15 to 20 days at the temperature of between 26 and 28 ℃ for one time to obtain the callus of the indica rice Changhui T025, and the purified pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is introduced into the callus cells of the indica rice Changhui T025 by adopting an agrobacterium mediation method, thus completing the transformation from the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid to the indica rice Changhui T025.

6. The rice of claim 5OsPDCD5The application of the gene in reducing the amylose content in rice is characterized in that the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is introduced into indica rice Changhui T025 callus cells by adopting an agrobacterium-mediated method, and the method specifically comprises the following steps:

(1) the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid transformation agrobacterium tumefaciens EHA105 specifically comprises the following steps:

adding pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into agrobacterium EHA105 competent cells according to the proportion of 10 percent of volume, sequentially placing the recombinant plasmid on ice for 30min, immersing the recombinant plasmid into liquid nitrogen for 5min, and carrying out water bath at 37 ℃ for 5min to obtain the agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

secondly, adding the obtained agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmids into an LB liquid culture medium without antibiotics, controlling the temperature to be 28 ℃ and the rotating speed to be 150-160rpm, and fermenting for 3-4 hours to obtain fermentation liquor according to the proportion of 22 percent by volume;

centrifuging the obtained fermentation liquid at 4000rpm for 10min to collect thallus, centrifuging the collected thallus by 11 vol% of the fermentation liquid to obtain supernatantHomogenizing, then spreading on LB plate culture medium containing rifampicin 20ug/ml, gentamicin 25ug/ml and kanamycin 30ug/ml, culturing at 28 deg.C for 36-72h, and forming bacterial plaque on LB plate culture medium;

the bacterial plaque successfully identified by PCR is the agrobacterium EHA105 containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

1 bacterial plaque which is successfully identified by PCR is picked, 1.5ml of EP pipe-connected bacteria are carried out and are placed in a shaking table at the temperature of 28 ℃ for cultivation, thus obtaining agrobacterium EHA105 seed solution containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

(2) t025 mature seed callus induction and culture

Husking and disinfecting mature seeds of the indica rice Changhui T025, inoculating the seeds on an induction culture medium to induce callus, and subculturing once after dark culture at 26-28 ℃ for about 15-20 days to obtain the indica rice Changhui T025 callus;

(3) and infection with Agrobacterium

Inoculating agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid into LB liquid culture medium containing 50ug/ml rifampicin and 50ug/ml kanamycin according to the inoculation amount of 10-11% of volume ratio, controlling the temperature to be 28 ℃ for culture until the concentration OD600 of the agrobacterium EHA105 liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is approximately equal to 0.8, and collecting the liquid culture liquid;

② suspend

Centrifugally enriching the obtained agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 being approximately equal to 0.8 in a 50ml centrifugal tube for 1 time, suspending the bacterial liquid into 50ml of infection liquid, and continuously culturing the bacterial liquid with the temperature being controlled at 28 ℃ and the rotating speed being 200rpm until OD600 being approximately equal to 0.1;

infection with viral infection

Airing the indica rice Changhui T025 callus cultured in the step (2) on sterile filter paper, then transferring the indica rice Changhui T025 callus to agrobacterium EHA105 bacterial liquid containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid with OD600 & lt 0.1 & gt at one time, uniformly mixing, then controlling the rotating speed to be 150rpm, mixing for 15-20min, and then pouring out the bacterial liquid to obtain infected callus;

(iv) Co-culture

Placing the infected callus obtained in the step three on sterile filter paper until the bacterial liquid is sucked dry, and then connecting to N₆Performing dark culture for 2-3 days in a D-AS culture medium at the temperature of 22 ℃ to obtain callus infected by the agrobacterium EHA 105;

(4) screening for resistant callus

Washing the callus infected by the agrobacterium EHA105 obtained in the step (3) by using sterile water until effluent is clear and transparent, and adding the clear and transparent effluent into N containing 500mg/L of timentin₆D, mixing in a liquid culture medium at 100rpm for 15-20min, and pouring off 500mg/L N containing timentin₆D liquid culture medium, washing with sterile water, adding N containing 500mg/L timentin₆D, liquid culture medium, 100rpm,15-20min, dumping N containing 500mg/L timentin₆D, liquid culture medium;

② pouring the weak anti-timentin callus infected by agrobacterium EHA105 obtained in the step (i) on sterile filter paper for drying, transferring the weak anti-timentin callus into N containing 250mg/L timentin₆D, in a liquid culture medium, no hygromycin B is added, and dark culture is carried out for 7-10 days at the temperature of 28 ℃ to obtain a callus crude product with strong timentin resistance and infected by the agrobacterium EHA 105;

(5) placing the healed tissue crude product with strong timentin resistance and infected by the agrobacterium EHA105 on a selective culture medium plate containing 500mg/L timentin and 50mg/L hygromycin B for primary screening culture, and controlling the temperature to be 28 ℃ in the screening culture process for culture for 15-20 days;

repeating the screening process once to obtain light yellow callus infected by agrobacterium EHA105 with strong resistance to timentin and hygromycin B.

7. The rice of claim 6OsPDCD5The application of the gene in reducing the content of amylose in rice is characterized in that the sequence of a primer Pbw2+ used for PCR identification in the step (1) is shown as SEQ ID NO: 6, the sequence of the primer Pbw 2-is shown as SEQ ID NO: 7, the positive strip sequence successfully identified by PCR is shown as SEQ ID NO: shown in fig. 8.

8. The rice of claim 6OsPDCD5The application of the gene in reducing the content of amylose in rice is characterized in that infection liquid used for suspension in the agrobacterium infection process in the step (3) is composed of 2.2 g of MS powder, 68.5g of glucose, 174mg of arginine, 876mg of glutamine, 30g of sucrose, 100 mu mol of AS and the balance of water in terms of per liter.

9. The rice of claim 6OsPDCD5The gene is used for reducing the amylose content in rice to obtain the agrobacterium EHA105 containing pBWA (V) H-cas9-OsPDCD5 recombinant plasmid.