CN106939316A - The method for knocking out rice Os PDCD5 gene Second Exons is pinpointed using CRISPR/Cas9 systems - Google Patents

Abstract

The invention discloses the method that a kind of utilization CRISPR/Cas9 systems fixed point knocks out rice Os PDCD5 gene Second Exons：Target fragments are chosen in rice Os PDCD5 gene Second Exons region and build plant CRISPR/Cas9 recombinant vectors, method is infected by Agrobacterium to imported into rice callus and regenerate seedling, under guide RNA and Cas9 nuclease collective effect, the double-strand of OsPDCD5 gene Second Exons is sheared, pass through cell itself DNA repair functions again, the final radom insertion or missing at random realized in target gene fragment, the method that sequencing is expanded by PCR, the present invention obtains 9 plants of purpose fragments and the strain of point mutation occurs altogether, by phenotypic evaluation, realize the purpose of increase Plant Height of Rice and yield.The present invention provides a kind of efficient breeding mode to cultivate high yield and high quality rice varieties.

Description

Rice Os PDCD5 gene Second Exons are knocked out using CRISPR/Cas9 systems fixed point Method

Technical field

Rice Os PDCD5 gene Second Exon target sequences are knocked out the present invention relates to one kind fixed point, and then are improved The method of the paddy rice mutating strain series of plant type of rice and fringe type, belongs to field of plant genetic.

Background technology

Paddy rice is one of cereal crops important in the world, and there is about 2/3 population in the whole world using paddy rice as staple food.In arable land In the case that area is gradually decreased, in order to meet demand of the growing population to grain, improving paddy rice specific yield has Significance.Traditional crossbreeding serves key effect for the constantly improve of China's rice yield, but there is the production of hybrid seeds Inefficient, labor intensity is big, breeding is the problems such as time-consuming and seed production is unstable, and current plant genetic engineering Technology then solves these problems.For example, utilizing works nuclease carries out the Zinc finger nuclease (ZFN) of gene editing, transcription swashs Factor sample effector nuclease (TALEN) living and bacterium acquired immune system (CRISPR/Cas9), these technologies are all logical Nucleic acid enzyme induction specific target site double-strand break is crossed, then is carried out by homologous same group (HR) or non-homologous end joining (NHEJ) DNA is repaired, and this inaccurate repair mode can produce site-directed point mutation, and then obtain the plant of mutator.

For state-of-the-art technology CRISPR, ZFN and TALEN have certain limitation, are embodied in ZFN utilizations Different zinc fingers identification specific DNA sequences, its recognizable sequence is limited, it is impossible to reach the purpose for editing any target DNA； And TALEN recognizes specific DNA sequence by means of TAL effectors, although can recognize and with reference to all aim sequences, still Need to repeat construction of fusion protein, building process is cumbersome and cost is too high, and the same with ZFN, be all to use FokI nucleases, Nuclease can just be had by needing dimer, it is therefore desirable to built two fusion vectors and recognized two adjacent nucleotides sequences Row, increase the limitation of target Piece Selection.And CRISPR/Cas9 systems are be widely present in prokaryotes a set of is directed to The adaptive immune system of foreign gene, is one section and is made up of short highly conserved 21~48bp repetitive sequences, and by 26- 72bp intervening sequences are separated, and they can transcribe to form CRISPR RNA (crRNAs), with another trans-acting type CrRNA (trans-activating crRNA, tracrRNA) portion paired formation binary complex, the binary complex is acted as jointly The DNA sequence dna matched with guiding Cas Protein cleavages with crRNA, so as to form double-strand break.Relative to first two editing technique Speech, CRISPR has applicability wide, and Mutiple Targets operation can be carried out simultaneously, and without repeating construction of fusion protein, experimental period It is short, the advantage of low cost.Up to the present, CRISPR/Cas9 systems realize the editor to genome in a variety of animals and plants, Paddy rice has also carried out part correlative study as a kind of important cereal crops and unifacial leaf model plant.

Apoptosis (PCD) is a kind of dead form of active of autogenous control, is multicellular organism normal life A part for activity is in plant development process and environment-stress in the case of the important procedure that itself starts.OsPDCD5 genes are An apoptosis gene in paddy rice.Expressions of the OsPDCD5 in mature tissue apparently higher than tender tissue, And OsPDCD5 overexpression can cause the death of transgenic regenerated plant.The present invention is directed to by CRISPR/Cas9 systems OsPDCD5 genes Second Exon carries out rite-directed mutagenesis, the rice strain of the OsPDCD5 afunction of acquisition, and these strains System is for wild type control, and with plant height increase, the increased phenotype of grain number per spike has reached improvement plant type of rice and then carried The purpose of high rice yield.

The content of the invention

For above-mentioned prior art, the present invention is proposed using CRISPR/Cas9 systems to rice Os PDCD5 genes second Extron carries out rite-directed mutagenesis, so as to improve a kind of method of the fringe grain type of plant type of rice.

The present invention is achieved by the following technical solutions：

A kind of method that utilization CRISPR/Cas9 systems fixed point knocks out rice Os PDCD5 gene Second Exons, including with Lower step：According to CRISPR system targets site structure features, the 23bp sequences in OsPDCD5 gene Second Exons are chosen (as shown in SEQ ID NO.2), will by the way of digestion is connected using primer amplified purpose fragment as target sequence Purpose fragment is connected on pBWA (V) H-cas9 carriers, obtain fusion vector (the guide rna expression frame containing target sequence and Cas9 enzyme nucleic acid expressions frame), the fusion vector is named as pBWA (V) H-cas9-PDCD5.2；Use agriculture bacillus mediated mode The fusion vector is transformed into paddy rice (the bright 1B of such as rice variety), PCR identifies positive plant in transgenosis T1 offsprings, and The strain of mutational site homozygosis is found in T2 and T3 generations.

Further, the nucleotide sequence of the specific primer is as follows：

yjstgt(+)：cagtGGTCTCaggcacccagagttggaagcta；

yjstgt(-)：cagtGGTCTCaaaacgatagcttccaactctg；As shown in SEQ ID NO.5,6.

Further, the method for the strain of searching mutational site homozygosis is in T2 generations：Use primer MPCD6-F： TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R：ATAAACATGGTTGACAAATAGAGC is (such as SEQ ID NO.7,8 institutes Show), the sequence of OsPDCD5 gene Second Exons in plant is detected, judges that OsPDCD5 genes second are outer aobvious according to testing result Whether son is by successful knockout (deletion mutation of OsPDCD5 protein functions)；Select the plant of OsPDCD5 protein function deletion mutations (these plant have obtained different degrees of improvement in terms of plant plant height and yield traits).

The method that the utilization CRISPR/Cas9 systems fixed point of the present invention knocks out rice Os PDCD5 gene Second Exons, Rice Os PDCD5 gene Second Exons region chooses target fragments and builds plant CRISPR/Cas9 recombinant vectors, passes through agriculture Bacillus infects method and imported into rice callus and regenerate seedling, under guide RNA and Cas9 nuclease collective effect, OsPDCD5 The double-strand of gene Second Exon is sheared, then by cell itself DNA repair functions, is finally realized in target gene fragment Radom insertion or missing at random, the method that sequencing is expanded by PCR, the present invention obtain 9 plants of purpose fragments and point mutation occur altogether Strain, by phenotypic evaluation, realizes the purpose of increase Plant Height of Rice and yield.The present invention is cultivation high yield and high quality rice varieties There is provided a kind of efficient breeding mode, good germ plasm resource is provided for rice breeding production.

Brief description of the drawings

Fig. 1：Rice Os PDCD5 gene structures figure and Second Exon sequence.

Fig. 2：Recombinate fusion vector pBWA (V) H-cas9-PDCD5.2 Vector map.

Fig. 3：The OsPDCD5 gene Second Exon coding mutation schematic diagrames of 9 mutating strain series and bright 1B.

Fig. 4：The OsPDCD5 gene Second Exon sequence results of mutating strain series and bright 1B.

Fig. 5：The OsPDCD5 gene Second Exon amino acid mutation schematic diagrames of 9 mutating strain series and bright 1B.

Fig. 6：Mutating strain series BPCD10 is with maturity period boot leaf leaf length, the blade width ratio pair for compareing the bright 1B of strain.

Fig. 7：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period plant height.

Fig. 8：Mutating strain series BPCD10 is compared with the bright 1B of control strain five panel lengths of maturity period stem.

Fig. 9：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period stem second section stage casing diameter length.

Figure 10：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period part yield traits.

Figure 11：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period number of productive ear.

Figure 12：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period number of grain per ear, bear fruit grains, empty grain number.

Figure 13：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period setting percentage.

Figure 14：Mutating strain series BPCD10 is compared with the bright 1B of control strain maturity period single plant yield.

Figure 15：Mutating strain series BPCD10 grows seedling control in 14 days with the bright 1B of control strain.

Figure 16：Mutating strain series BPCD10 is with the bright 1B heading stages plant type control of control strain.

Figure 17：Mutating strain series BPCD10 is with the bright 1B maturity periods plant type control of control strain.

Figure 18：Mutating strain series BPCD10 is with the respectively long control successively of the bright 1B stems of control strain.

Figure 19：Mutating strain series BPCD10 is with the bright 1B stems fringe fringe type control of control strain.

Figure 20：Mutating strain series BPCD10 is with the bright 1B type control of control strain.

Embodiment

With reference to embodiment, the present invention is further illustrated.

Involved instrument, reagent, material etc. in following embodiments, unless otherwise noted, are existing in the prior art Conventional instrument, reagent, material etc., can be obtained by regular commercial sources.Involved experimental method in following embodiments, inspection Survey method etc., unless otherwise noted, is existing normal experiment method in the prior art, detection method etc..

The knockout of the rice Os PDCD5 gene Second Exons of embodiment 1 and application

The structure of 1.pBWA (V) H-cas9-PDCD5.2 carriers

(1) chain in CRISPR/Cas9 system requirements double-strand target sequences has following structure：5’-N_x- NGG-3 ', N represent any one in A, G, C, tetra- kinds of bases of T, and OsPDCD5 gene Second Exons are chosen in 14≤X≤30 (as shown in SEQ ID NO.1, the amino acid sequence of the albumen coded by it is as shown in SEQ ID NO.3 for nucleotide sequence；As schemed Shown in 1) in meet the 23bp sequences (as shown in SEQ ID NO.2) of requirements above as target sequence；

Use primer yjstgt (+):CagtGGTCTCaggcacccagagttggaagcta and yjstgt (-): 20bp target sequence (core in cagtGGTCTCaaaacgatagcttccaactctg amplification OsPDCD5 gene Second Exons Nucleotide sequence is：Acccagagttggaagctatc, as shown in SEQ ID NO.9), amplification PCR primer is： CagtGGTCTCaggcacccagagttggaagctatcgttttGAGACCagtg, as shown in SEQ ID NO.10.

(2) PCR primer is reclaimed in rubber tapping, and uses the kits DNA fragmentation.

(3) digestion linked system is prepared：Component used by system and consumption are as shown in table 1.

Table 1

Component	Volumes
		pBWA(V)H-cas9i	4μL
PCR	4μL
		BsaI/Eco31I	1μL
T4_ligase:1	1μL
		Buffer	2μL
H2O	8μL
		Total	20μL

37 DEG C of for 20min, 5cycles；37℃for 10min；20℃for 10min；37℃for 20min；80℃ For 5min, obtain connection product.

(4) 5~10 μ L connection products are transformed into E. coli competent, conversion applies (card receive mycin) resistance plate, 37 DEG C culture 12 hours, carry out bacterial plaque PCR identifications.

(5) 10 bacterial plaques of picking carry out 1.5mlEP pipes and connect bacterium and PCR identifications, pBWA (V) H-cas9i identification primers simultaneously Pbw2+：GGCGTCTTCTACTGGTGCTA, Pbw2-：GTCTTTACGGCGAGTTCTGT (as shown in SEQ ID NO.11,12 institutes Show), expanding fragment length is 422bp.Take the corresponding bacterium solution of 3 positive bands, sample presentation sequencing, by the correct bacterium solution of sequencing result Carry out protecting bacterium processing.

The genetic transformation of 2.pBWA (V) H-cas9-PDCD5.2 carriers

(1) by pBWA (V) H-cas9-PDCD5.2 carrier Transformed E HA105 Agrobacteriums (Agrobacterium Tumefaciens) (Wu ZM et .2007), obtains transformant.Transformant is extracted into the sequencing of plasmid sample presentation, as a result shows plasmid For pBWA (V) H-cas9-PDCD5.2, therefore the transformant containing pBWA (V) H-cas9-PDCD5.2 is named as EHA105/ cas9-PDCD5.2。

The sequence of pBWA (V) H-cas9-PDCD5.2 is as shown in SEQ ID NO.4, and structure is as shown in Fig. 2 carrier knot Structure is as follows with annotating：

Seg1:LB LB element sequences complementation 141bp -166bp 26bp；

Seg2:Tnos nos terminal 435bp—219bp 217bp；

Seg3:HYG hygromycin genes UP 1485bp -463bp 1023bp；

Seg4:35s*2 double 35s 2291bp—1521bp 771bp；

Seg5:PosU3 paddy rice U6 promoters 2349bp -2729bp 381bp；

Seg6:Yjstgt Genomic targets, second extron, acccagagttggaagctatc 2730bp- 2748bp；

Seg7:RNAi RNAi skeletons [part] 2749bp -2831bp 83bp；

Seg8:2840bp -3379bp 540bp are described in detail in P35S；

Seg9:NLS1 N-terminals nls 3380bp -3412bp 33bp；

Seg10:cas9 crisp cas9 orf 3413bp—7516bp 4104bp；

Seg11:NLS2 C-terminals signal peptide 7517bp -7567bp 51bp；

Seg12:Tnos nos A3 terminal 7572bp—7888bp 317bp；

Seg13:[part] 7889bp -7896bp 8bp are described in detail in LACmcs；

Seg14:TR T_Bord(right) 8330bp—8355bp 26bp；

Seg15:sta pVS1 sta 8511bp—9511bp 1001bp；

Seg16:rep pVS1 rep 10122bp—11122bp 1001bp；

Seg17:bom pBR322bom 11550bp—11290bp 261bp；

Seg18:ori pBR322ori 11970bp—11690bp 281bp；

Seg19:kanamycin kanamycin 13054bp—12260bp 795bp。

(2) induction and culture of bright 1B mature seeds callus

This experiment is as shown in table 2 with culture medium.

Table 2

(note:1. more than the culture medium+2.5g/L of sucrose containing 30g/L agar)

Take bright 1B mature seeds to shell, aseptically, first embathe 10min with 70% ethanol, be transferred to the leaching of 0.1% mercuric chloride 20min is steeped, sterile water wash 3 times is inoculated in inducing culture.Cultivated under 26 DEG C of dark conditions, callus group is chosen after 20 days Knit squamous subculture.

(3) Agrobacterium is infected

28 DEG C are cultivated EHA105/cas9-PDCD5.2 Agrobacteriums 16 hours, collect bacterium solution, and be diluted to containing 100 μm of ol/ To concentration it is OD600 ≈ 0.5 in L YEP fluid nutrient mediums, soak time is divided into tri- groups of 10min, 20min, 30min, to wish It can compare and draw optimal soak time, be shaken up frequently during immersion.After the completion of immersion, callus block is taken out, sterilizing is layered on Blot after unnecessary bacterium solution, be transferred on co-cultivation culture medium, media surface spreads one layer of aseptic filter paper, and callus is in filter paper on filter paper It is upper to be not directly contacted with culture medium.26 DEG C, co-culture 6 days.

(4) screening of callus is converted

After the completion of co-cultivation, take out callus block, with sterile water wash 3~5 times, then with containing rifampin (50mg/L) and card that The sterile water wash of mycin (50mg/L) resistance 2-3 times, aseptic filter paper is blotted after net excessive moisture, and callus is transferred into primary sieve (conversion callus carries out primary, secondary two-wheeled screening, about 3 weeks) is selected in culture medium (the MS culture mediums of addition 30ppm hygromycin), so The cell line of screening is transferred into differential medium induction afterwards to sprout and take root.

3. transformed plant is screened and detection

After the completion of above-mentioned screening, the cell line of screening is transferred to regeneration plant in differential medium, in 26 DEG C, 16h light According to/daily under conditions of, continue cultivate 30 days.To green after seedling is differentiated, seedling is transferred in root media and cultivated, when small When plant grows to that about 10cm is high, it is removed from root media, remaining medium is cleaned, hardening for a period of time after, transplant To greenhouse, using the transformed plant of PCR augmentation detection candidates, used amplimer is：Hyg-CX-S： AGATGTTGGCGACCTCGTATT；Hyg-CX-A：AAGATCGTTATGTTTATCGGCACT is (as shown in SEQ ID NO.13,14 It is shown), whether detection T0 contains hygromycin selectable marker in transformed plant, and 21 plants of positive T0 generation plants are obtained in the summer in 2014 Strain.Winter in 2014, in Hainan Island adding generation, obtain transgenosis T1 generations, and according to sampling order by positive transgenic strain according to It is secondary to be named as BPCDx, take blade to extract genomic DNA, and use primer MPCD6-F：TGGAGGGAGTACATGTTTTAGGTG And MPCD6-R：ATAAACATGGTTGACAAATAGAGC, the sequence of sequencing wherein OsPDCD5 genes Second Exon, sequencing knot Fruit finds to have 9 plants containing insertion or deletion mutation, its nucleotide sequence as shown in figure 3, sequencing result is as shown in figure 4, coding Amino acid sequence is as shown in Figure 5.As a result prove that CRISPR/Cas9 systems of the present invention knock out bright 1B success rates up to 43%.

4. investigation and statistics of the transgenosis T2 for population yield character

In pBWA (V) H-cas9-PDCD5.2 transgenosis T2 generations, were sowed in spring kind in 2015, four leaf stage is by 3 transgenosis T2 generations Strain is planted in Fudan University experimental plot, and each strain respectively plants 20 plants, and distance between rows and hills is 6 cun × 6 cun, in triplicate, is set simultaneously The bright 1B parent controls of vertical long-grained nonglutinous rice.The good mutating strain series BPDCD5 of phenotype is chosen in the maturity period with compareing the bright 1B of strain, is counted respectively The characters with plant of each 20 individual plants of strain is such as：Boot leaf leaf length, leaf width, plant height, internode height and second section stage casing diameter are long, and Spike length, number of productive ear, number of grain per ear, bear fruit grains, real grain weight, empty grain number, Weight Per Ear, mass of 1000 kernel, setting percentage calculates average Value, statistics is as shown in table 3, table 4, and comparing result is as shown in Fig. 6~Figure 20.

Table 3：Maturity period bright 1B and mutant strain BPCD10 the characters with plant table of comparisons

Table 4：Maturity period bright 1B and mutant strain BPCD10 the yield traits table of comparisons

According to above species test numerical value, it is recognised that for the bright 1B of wild type, mutation transformant BPCD10 plant height Conspicuousness increase；Single plant yield is calculated according to the paddy rice number of productive ear and Weight Per Ear that measure simultaneously, bright 1B and mutation turn Changing strain BPCD10 single plant yield is respectively：31.91 grams and 49.50 grams, OsPDCD5 work(is obtained by CRISPR/Cas9 systems The transformant single plant yield that can be lacked increases to about 50% or so, considerably improves rice plant yield.Species test result is proved The present invention knocks out rice Os PDCD5 genes Second Exon by using CRISPR/Cas9 systems fixed point and obtains function mutation strain, The plant height and yield of rice plant can be increased, good germ plasm resource is provided for rice breeding production.

Although the above-mentioned embodiment in conjunction with the embodiments to the present invention is described, not to present invention protection The limitation of scope, one of ordinary skill in the art should be understood that on the basis of technical scheme, those skilled in the art Various modifications or deform still within protection scope of the present invention that creative work can make need not be paid.

SEQUENCE LISTING

<110>Fudan University

<120>The method for knocking out rice Os PDCD5 gene Second Exons is pinpointed using CRISPR/Cas9 systems

<130>

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 66

<212> DNA

<213>Paddy rice

<400> 1

gctgacccag agttggaagc tatcaggcag aggagaatgc aagagctaat ggcacagcat 60

ggtgcg 66

<210> 2

<211> 23

<212> DNA

<213>Paddy rice

<400> 2

acccagagtt ggaagctatc agg 23

<210> 3

<211> 22

<212> PRT

<213>Paddy rice

<400> 3

Ala Asp Pro Glu Leu Glu Ala Ile Arg Gln Arg Arg Met Gln Glu Leu

1 5 10 15

Met Ala Gln His Gly Ala

20

<210> 4

<211> 13402

<212> DNA

<213>Artificial sequence

<400> 4

tagaatagca tcggtaacat gagcaaagtc tgccgcctta caacggctct cccgctgacg 60

ccgtcccgga ctgatgggct gcctgtatcg agtggtgatt ttgtgccgag ctgccggtcg 120

gggagctgtt ggctggctgg tggcaggata tattgtggtg taaacaaatt gacgcttaga 180

caacttaata acacattgcg gacgttttta atgttagact gaattaacgc cgaattaatt 240

cgggggatct ggattttagt actggatttt ggttttagga attagaaatt ttattgatag 300

aagtatttta caaatacaaa tacatactaa gggtttctta tatgctcaac acatgagcga 360

aaccctatag gaaccctaat tcccttatct gggaactact cacacattat tatggagaaa 420

ctcgagcttg tcgatcgaca gatccggtcg gcatctactc tatttctttg ccctcggacg 480

agtgctgggg cgtcggtttc cactatcggc gagtacttct acacagccat cggtccagac 540

ggccgcgctt ctgcgggcga tttgtgtacg cccgacagtc ccggctccgg atcggacgat 600

tgcgtcgcat cgaccctgcg cccaagctgc atcatcgaaa ttgccgtcaa ccaagctctg 660

atagagttgg tcaagaccaa tgcggagcat atacgcccgg agtcgtggcg atcctgcaag 720

ctccggatgc ctccgctcga agtagcgcgt ctgctgctcc atacaagcca accacggcct 780

ccagaagaag atgttggcga cctcgtattg ggaatccccg aacatcgcct cgctccagtc 840

aatgaccgct gttatgcggc cattgtccgt caggacattg ttggagccga aatccgcgtg 900

cacgaggtgc cggacttcgg ggcagtcctc ggcccaaagc atcagctcat cgagagcctg 960

cgcgacggac gcactgacgg tgtcgtccat cacagtttgc cagtgataca catggggatc 1020

agcaatcgcg catatgaaat cacgccatgt agtgtattga ccgattcctt gcggtccgaa 1080

tgggccgaac ccgctcgtct ggctaagatc ggccgcagcg atcgcatcca tagcctccgc 1140

gaccggttgt agaacagcgg gcagttcggt ttcaggcagg tcttgcaacg tgacaccctg 1200

tgcacggcgg gagatgcaat aggtcaggct ctcgctaaac tccccaatgt caagcacttc 1260

cggaatcggg agcgcggccg atgcaaagtg ccgataaaca taacgatctt tgtagaaacc 1320

atcggcgcag ctatttaccc gcaggacata tccacgccct cctacatcga agctgaaagc 1380

acgagattct tcgccctccg agagctgcat caggtcggag acactgtcga acttttcgat 1440

cagaaacttc tcgacagacg tcgcggtgag ttcaggcttt ttcatatctc attgcccccc 1500

cggatctgcg aaagctcgag agagatagat ttgtagagag agactggtga tttcagcgtg 1560

tcctctccaa atgaaatgaa cttccttata tagaggaagg tcttgcgaag gatagtggga 1620

ttgtgcgtca tcccttacgt cagtggagat atcacatcaa tccacttgct ttgaagacgt 1680

ggttggaacg tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc 1740

actgtcggca gaggcatctt gaacgatagc ctttccttta tcgcaatgat ggcatttgta 1800

ggtgccacct tccttttcta ctgtcctttt gatgaagtga cagatagctg ggcaatggaa 1860

tccgaggagg tttcccgata ttaccctttg ttgaaaagtc tcaatagccc tttggtcttc 1920

tgagactgta tctttgatat tcttggagta gacgagagtg tcgtgctcca ccatgttatc 1980

acatcaatcc acttgctttg aagacgtggt tggaacgtct tctttttcca cgatgctcct 2040

cgtgggtggg ggtccatctt tgggaccact gtcggcagag gcatcttgaa cgatagcctt 2100

tcctttatcg caatgatggc atttgtaggt gccaccttcc ttttctactg tccttttgat 2160

gaagtgacag atagctgggc aatggaatcc gaggaggttt cccgatatta ccctttgttg 2220

aaaagtctca atagcccttt ggtcttctga gactgtatct ttgatattct tggagtagac 2280

gagagtgtcg tgctccacca tgttggcaag ctgctctagc caatacgcaa accgcctgca 2340

ggtctagaaa ggaatcttta aacatacgaa cagatcactt aaagttcttc tgaagcaact 2400

taaagttatc aggcatgcat ggatcttgga ggaatcagat gtgcagtcag ggaccatagc 2460

acaagacagg cgtcttctac tggtgctacc agcaaatgct ggaagccggg aacactgggt 2520

acgttggaaa ccacgtgatg tgaagaagta agataaactg taggagaaaa gcatttcgta 2580

gtgggccatg aagcctttca ggacatgtat tgcagtatgg gccggcccat tacgcaattg 2640

gacgacaaca aagactagta ttagtaccac ctcggctatc cacatagatc aaagctgatt 2700

taaaagagtt gtgcagatga tccgtggcac ccagagttgg aagctatcgt tttagagcta 2760

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 2820

gtgctttttt tgtcgtagac atggagtcaa agattcaaat agaggaccta acagaactcg 2880

ccgtaaagac tggcgaacag ttcatacaga gtctcttacg actcaatgac aagaagaaaa 2940

tcttcgtcaa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 3000

tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 3060

tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 3120

gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg 3180

acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 3240

caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 3300

cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 3360

agagaacacg ggggacaaca tgagggctga ccccaagaag aagaggaagg tggacaagaa 3420

gtactccatt gggctcgata tcggcacaaa cagcgtcggc tgggccgtca ttacggacga 3480

gtacaaggtg ccgagcaaaa aattcaaagt tctgggcaat accgatcgcc acagcataaa 3540

gaagaacctc attggcgccc tcctgttcga ctccggggaa acggccgaag ccacgcggct 3600

caaaagaaca gcacggcgca gatatacccg cagaaagaat cggatctgct acctccagga 3660

gatctttagt aatgagatgg ctaaggtgga tgactctttc ttccataggc tggaggagtc 3720

ctttttggtg gaggaggata aaaagcacga gcgccaccca atctttggca atatcgtgga 3780

cgaggtggcg taccatgaaa agtacccaac catatatcat ctgaggaaga agctggtaga 3840

cagtactgat aaggctgact tgcggttgat ctatctcgcg ctggcgcaca tgatcaaatt 3900

tcggggacac ttcctcatcg agggggacct gaacccagac aacagcgatg tggacaaact 3960

ctttatccaa ctggttcaga cttacaatca gcttttcgaa gagaacccga tcaacgcatc 4020

cggagttgac gccaaagcaa tcctgagcgc taggctgtcc aaatcccggc ggctcgaaaa 4080

cctcatcgca cagctccctg gggagaagaa gaacggcctg tttggtaatc ttatcgccct 4140

gtcactcggg ctgaccccca actttaaatc taacttcgac ctggccgaag atgccaagct 4200

gcaactgagc aaagacacct acgatgatga tctcgacaat ctgctggccc agatcggcga 4260

ccagtacgca gacctttttt tggcggcaaa gaacctgtca gacgccattc tgctgagtga 4320

tattctgcga gtgaacacgg agatcaccaa agctccgctg agcgctagta tgatcaagcg 4380

ctatgatgag caccaccaag acttgacttt gctgaaggcc cttgtcagac agcaactgcc 4440

tgagaagtac aaggaaattt tcttcgatca gtctaaaaat ggctacgccg gatacattga 4500

cggcggagca agccaggagg aattttacaa atttattaag cccatcttgg aaaaaatgga 4560

cggcaccgag gagctgctgg taaagctgaa cagagaagat ctgttgcgca aacagcgcac 4620

tttcgacaat ggaagcatcc cccaccagat tcacctgggc gaactgcacg ctatcctcag 4680

gcggcaagag gatttctacc cctttttgaa agataacagg gaaaagattg agaaaatcct 4740

cacatttcgg ataccctact atgtaggccc cctcgcacgc ggaaattcca gattcgcgtg 4800

gatgactcgc aaatcagaag aaaccatcac tccctggaac ttcgaggaag tcgtggataa 4860

gggggcctct gcccagtcct tcatcgaaag gatgactaac tttgataaaa atctgcctaa 4920

cgaaaaggtg cttcctaaac actctctgct gtacgagtac ttcacagttt ataacgaact 4980

caccaaggtc aaatacgtca cagaagggat gagaaagcca gcattcctgt ctggagagca 5040

gaagaaagct atcgtggacc tcctcttcaa gacgaaccgg aaagttaccg tgaaacagct 5100

caaagaggac tatttcaaaa agattgaatg tttcgactct gttgaaatca gcggagtgga 5160

ggatcgcttc aacgcatccc tgggaacgta tcacgatctc ctgaaaatca ttaaagacaa 5220

ggacttcctg gacaatgagg agaacgagga cattcttgag gacattgtcc tcacccttac 5280

gttgtttgaa gatagggaga tgattgaaga acgcttgaaa acttacgctc atctcttcga 5340

cgacaaagtc atgaaacagc tcaagaggcg ccgatataca ggatgggggc ggctgtcaag 5400

aaaactgatc aatgggattc gagacaagca gagtggaaag acaatcctgg attttcttaa 5460

gtccgatgga tttgccaacc ggaacttcat gcagttgatc catgatgact ctctcacctt 5520

taaggaggac atccagaaag cacaagtttc tggccagggg gacagtctgc acgagcacat 5580

cgctaatctt gcaggtagcc cagctatcaa aaagggaata ctgcagaccg ttaaggtcgt 5640

ggatgaactc gtcaaagtaa tgggaaggca taagcccgag aatatcgtta tcgagatggc 5700

ccgagagaac caaactaccc agaagggaca gaagaacagt agggaaagga tgaagaggat 5760

tgaagagggt ataaaagaac tggggtccca aatccttaag gaacacccag ttgaaaacac 5820

ccagcttcag aatgagaagc tctacctgta ctacctgcag aacggcaggg acatgtacgt 5880

ggatcaggaa ctggacatca atcggctctc cgactacgac gtggatcata tcgtgcccca 5940

gtcttttctc aaagatgatt ctattgataa taaagtgttg acaagatccg ataaaaatag 6000

agggaagagt gataacgtcc cctcagaaga agttgtcaag aaaatgaaaa attattggcg 6060

gcagctgctg aacgccaaac tgatcacaca acggaagttc gataatctga ctaaggctga 6120

acgaggtggc ctgtctgagt tggataaagc cggcttcatc aaaaggcagc ttgttgagac 6180

acgccagatc accaagcacg tggcccaaat tctcgattca cgcatgaaca ccaagtacga 6240

tgaaaatgac aaactgattc gagaggtgaa agttattact ctgaagtcta agctggtgtc 6300

agatttcaga aaggactttc agttttataa ggtgagagag atcaacaatt accaccatgc 6360

gcatgatgcc tacctgaatg cagtggtagg cactgcactt atcaaaaaat atcccaagct 6420

ggaatctgaa tttgtttacg gagactataa agtgtacgat gttaggaaaa tgatcgcaaa 6480

gtctgagcag gaaataggca aggccaccgc taagtacttc ttttacagca atattatgaa 6540

ttttttcaag accgagatta cactggccaa tggagagatt cggaagcgac cacttatcga 6600

aacaaacgga gaaacaggag aaatcgtgtg ggacaagggt agggatttcg cgacagtccg 6660

gaaggtcctg tccatgccgc aggtgaacat cgttaaaaag accgaagtac agaccggagg 6720

cttctccaag gaaagtatcc tcccgaaaag gaacagcgac aagctgatcg cacgcaaaaa 6780

agattgggac cccaagaaat acggcggatt cgattctcct acagtcgctt acagtgtact 6840

ggttgtggcc aaagtggaga aagggaagtc taaaaaactc aaaagcgtca aggaactgct 6900

gggcatcaca atcatggagc gatcaagttt cgaaaaaaac cccatcgact ttctggaggc 6960

gaaaggatat aaagaggtca aaaaagacct catcattaag ctgcccaagt actctctctt 7020

tgagcttgaa aacggccgga aacgaatgct cgctagtgcg ggcgagctgc agaaaggtaa 7080

cgagctggca ctgccctcta aatacgttaa tttcttgtat ctggccagcc actatgaaaa 7140

gctcaaaggg tcccccgaag ataatgagca gaagcagctg ttcgtggaac aacacaaaca 7200

ctaccttgat gagatcatcg agcaaataag cgagttctcc aaaagagtga tcctcgccga 7260

cgctaacctc gataaggtgc tttctgctta caataagcac agggataagc ccatcaggga 7320

gcaggcagaa aacattatcc acttgtttac tctgaccaac ttgggcgcac ctgcagcctt 7380

caagtacttc gacaccacca tagacagaaa gcggtacacc tctacaaagg aggtcctgga 7440

cgccacactg attcatcagt caattacggg gctctatgaa acaagaatcg acctctctca 7500

gctcggtgga gacagcaaga gtccagctgc taccaagaag gctggacagg ctaagaagaa 7560

gaagtgatgt agaagactga ccagctcgaa tttccccgat cgttcaaaca tttggcaata 7620

aagtttctta agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt 7680

gaattacgtt aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt 7740

ttttatgatt agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg 7800

cgcaaactag gataaattat cgcgcgcggt gtcatctatg ttactagatc gggccatccg 7860

cactgtagcg gatggcctaa aaaaaaaagt cgtagaggaa gagcagtctg agactcaggc 7920

tcttcggtcg cagtcataac ttcgtatagc atacattata cgaagttatg ggccgcatta 7980

ccctgttatc cctaggccgc ataacttcgt atagcctaca ttataggatg gagggatatc 8040

ctctcttaag gtagcgagca agctctaaga ggagtgtcga caagcttggc actggccgtc 8100

gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca 8160

catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa 8220

cagttgcgca gcctgaatgg cgaatgctag agcagcttga gcttggatca gattgtcgtt 8280

tcccgccttc agtttaaact atcagtgttt gacaggatat attggcgggt aaacctaaga 8340

gaaaagagcg tttattagaa taacggatat ttaaaagggc gtgaaaaggt ttatccgttc 8400

gtccatttgt atgtgcatgc caaccacagg gttcccctcg ggatcaaagt actttgatcc 8460

aacccctccg ctgctatagt gcagtcggct tctgacgttc agtgcaggag atgatcgcgg 8520

ccgggtacgt gttcgagccg cccgcgcatg tctcaaccgt gcggctgcat gaaatcctgg 8580

ccggtttgtc tgatgccaag ctggcggcct ggccggccag cttggccgct gaagaaaccg 8640

agcgccgccg tctaaaaagg tgatgtgtat ttgagtaaaa cagcttgcgt catgcggtcg 8700

ctgcgtatat gatgcgatga gtaaataaac aaatacgcaa ggggaacgca tgaaggttat 8760

cgctgtactt aaccagaaag gcgggtcagg caagacgacc atcgcaaccc atctagcccg 8820

cgccctgcaa ctcgccgggg ccgatgttct gttagtcgat tccgatcccc agggcagtgc 8880

ccgcgattgg gcggccgtgc gggaagatca accgctaacc gttgtcggca tcgaccgccc 8940

gacgattgac cgcgacgtga aggccatcgg ccggcgcgac ttcgtagtga tcgacggagc 9000

gccccaggcg gcggacttgg ctgtgtccgc gatcaaggca gccgacttcg tgctgattcc 9060

ggtgcagcca agcccttacg acatatgggc caccgccgac ctggtggagc tggttaagca 9120

gcgcattgag gtcacggatg gaaggctaca agcggccttt gtcgtgtcgc gggcgatcaa 9180

aggcacgcgc atcggcggtg aggttgccga ggcgctggcc gggtacgagc tgcccattct 9240

tgagtcccgt atcacgcagc gcgtgagcta cccaggcact gccgccgccg gcacaaccgt 9300

tcttgaatca gaacccgagg gcgacgctgc ccgcgaggtc caggcgctgg ccgctgaaat 9360

taaatcaaaa ctcatttgag ttaatgaggt aaagagaaaa tgagcaaaag cacaaacacg 9420

ctaagtgccg gccgtccgag cgcacgcagc agcaaggctg caacgttggc cagcctggca 9480

gacacgccag ccatgaagcg ggtcaacttt cagttgccgg cggaggatca caccaagctg 9540

aagatgtacg cggtacgcca aggcaagacc attaccgagc tgctatctga atacatcgcg 9600

cagctaccag agtaaatgag caaatgaata aatgagtaga tgaattttag cggctaaagg 9660

aggcggcatg gaaaatcaag aacaaccagg caccgacgcc gtggaatgcc ccatgtgtgg 9720

aggaacgggc ggttggccag gcgtaagcgg ctgggttgtc tgccggccct gcaatggcac 9780

tggaaccccc aagcccgagg aatcggcgtg acggtcgcaa accatccggc ccggtacaaa 9840

tcggcgcggc gctgggtgat gacctggtgg agaagttgaa ggccgcgcag gccgcccagc 9900

ggcaacgcat cgaggcagaa gcacgccccg gtgaatcgtg gcaagcggcc gctgatcgaa 9960

tccgcaaaga atcccggcaa ccgccggcag ccggtgcgcc gtcgattagg aagccgccca 10020

agggcgacga gcaaccagat tttttcgttc cgatgctcta tgacgtgggc acccgcgata 10080

gtcgcagcat catggacgtg gccgttttcc gtctgtcgaa gcgtgaccga cgagctggcg 10140

aggtgatccg ctacgagctt ccagacgggc acgtagaggt ttccgcaggg ccggccggca 10200

tggccagtgt gtgggattac gacctggtac tgatggcggt ttcccatcta accgaatcca 10260

tgaaccgata ccgggaaggg aagggagaca agcccggccg cgtgttccgt ccacacgttg 10320

cggacgtact caagttctgc cggcgagccg atggcggaaa gcagaaagac gacctggtag 10380

aaacctgcat tcggttaaac accacgcacg ttgccatgca gcgtacgaag aaggccaaga 10440

acggccgcct ggtgacggta tccgagggtg aagccttgat tagccgctac aagatcgtaa 10500

agagcgaaac cgggcggccg gagtacatcg agatcgagct agctgattgg atgtaccgcg 10560

agatcacaga aggcaagaac ccggacgtgc tgacggttca ccccgattac tttttgatcg 10620

atcccggcat cggccgtttt ctctaccgcc tggcacgccg cgccgcaggc aaggcagaag 10680

ccagatggtt gttcaagacg atctacgaac gcagtggcag cgccggagag ttcaagaagt 10740

tctgtttcac cgtgcgcaag ctgatcgggt caaatgacct gccggagtac gatttgaagg 10800

aggaggcggg gcaggctggc ccgatcctag tcatgcgcta ccgcaacctg atcgagggcg 10860

aagcatccgc cggttcctaa tgtacggagc agatgctagg gcaaattgcc ctagcagggg 10920

aaaaaggtcg aaaagatctc tttcctgtgg atagcacgta cattgggaac ccaaagccgt 10980

acattgggaa ccggaacccg tacattggga acccaaagcc gtacattggg aaccggtcac 11040

acatgtaagt gactgatata aaagagaaaa aaggcgattt ttccgcctaa aactctttaa 11100

aacttattaa aactcttaaa acccgcctgg cctgtgcata actgtctggc cagcgcacag 11160

ccgaagctcc cggatacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc 11220

cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt 11280

agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag 11340

tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc 11400

gttcatccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 11460

tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 11520

agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 11580

cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 11640

ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 11700

tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 11760

gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 11820

gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 11880

gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 11940

ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 12000

ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 12060

ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 12120

gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 12180

ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 12240

tggtcatgca ttctaggtac taaaacaatt catccagtaa aatataatat tttattttct 12300

cccaatcagg cttgatcccc agtaagtcaa aaaatagctc gacatactgt tcttccccga 12360

tatcctccct gatcgaccgg acgcagaagg caatgtcata ccacttgtcc gccctgccgc 12420

ttctcccaag atcaataaag ccacttactt tgccatcttt cacaaagatg ttgctgtctc 12480

ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt ttccgtcttt aaaaaatcat 12540

acagctcgcg cggatcttta aatggagtgt cctcttccca gttttcgcaa tccacatcgg 12600

ccagatcgtt attcagtaag taatccaatt cggctaagcg gctgtctaag ctattcgtat 12660

agggacaatc cgatatgtcg atggagtgaa agagcctgat gcactccgca tacagctcga 12720

taatcttttc agggctttgt tcatcttcat actcttccga gcaaaggacg ccatcggcct 12780

cactcatgag cagattgctc cagccatcat gccgttcaaa gtgcaggacc tttggaacag 12840

gcagctttcc ttccagccat agcatcatgt ccttttcccg ttccacatca taggtggtcc 12900

ctttataccg gctgtccgtc atttttaaat ataggttttc attttctccc accagcttat 12960

ataccttagc aggagacatt ccttccgtat cttttacgca gcggtatttt tcgatcagtt 13020

ttttcaattc cggtgatatt ctcattttag ccatttatta tttccttcct cttttctaca 13080

gtatttaaag ataccccaag aagctaatta taacaagacg aactccaatt cactgttcct 13140

tgcattctaa aaccttaaat accagaaaac agctttttca aagttgtttt caaagttggc 13200

gtataacata gtatcgacgg agccgatttt gaaaccgcgg tgatcacagg cagcaacgct 13260

ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc atccgtgttt caaacccggc 13320

agcttagttg ccgttcttcc gaatagcatc ggtaacatga gcaaagtctg ccgccttaca 13380

acggctctcc cgctgacgcc gt 13402

<210> 5

<211> 32

<212> DNA

<213>Artificial sequence

<400> 5

cagtggtctc aggcacccag agttggaagc ta 32

<210> 6

<211> 32

<212> DNA

<213>Artificial sequence

<400> 6

cagtggtctc aaaacgatag cttccaactc tg 32

<210> 7

<211> 24

<212> DNA

<213>Artificial sequence

<400> 7

tggagggagt acatgtttta ggtg 24

<210> 8

<211> 24

<212> DNA

<213>Artificial sequence

<400> 8

ataaacatgg ttgacaaata gagc 24

<210> 9

<211> 20

<212> DNA

<213>Paddy rice

<400> 9

acccagagtt ggaagctatc 20

<210> 10

<211> 49

<212> DNA

<213>Artificial sequence

<400> 10

cagtggtctc aggcacccag agttggaagc tatcgttttg agaccagtg 49

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence

<400> 11

ggcgtcttct actggtgcta 20

<210> 12

<211> 20

<212> DNA

<213>Artificial sequence

<400> 12

gtctttacgg cgagttctgt 20

<210> 13

<211> 21

<212> DNA

<213>Artificial sequence

<400> 13

agatgttggc gacctcgtat t 21

<210> 14

<211> 24

<212> DNA

<213>Artificial sequence

<400> 14

aagatcgtta tgtttatcgg cact 24

Claims (10)

1. a kind of method that utilization CRISPR/Cas9 systems fixed point knocks out rice Os PDCD5 gene Second Exons, its feature exists In：The 23bp sequences as shown in SEQ ID NO.2 in OsPDCD5 gene Second Exons are chosen as target sequence, mesh is expanded Fragment, purpose fragment is connected to by the way of digestion is connected on pBWA (V) H-cas9 carriers, obtains fusion vector；Use The fusion vector is transformed into paddy rice by agriculture bacillus mediated mode, the PCR identifications positive plant in transgenosis T1 offsprings, and The strain of mutational site homozygosis is found in T2 and T3 generations.

2. utilization CRISPR/Cas9 systems fixed point according to claim 1 knocks out rice Os PDCD5 gene Second Exons Method, it is characterised in that：The nucleotide sequence of specific primer used by the amplification purpose fragment is as follows：

yjstgt(+)：cagtGGTCTCaggcacccagagttggaagcta；

yjstgt(-)：cagtGGTCTCaaaacgatagcttccaactctg.

3. utilization CRISPR/Cas9 systems fixed point according to claim 1 knocks out rice Os PDCD5 gene Second Exons Method, it is characterised in that：It is described that in T2 and T3, the method for the strain of searching mutational site homozygosis is in：Use primer MPCD6-F：TGGAGGGAGTACATGTTTTAGGTG and MPCD6-R：In ATAAACATGGTTGACAAATAGAGC, detection plant The sequence of OsPDCD5 gene Second Exons, judges whether OsPDCD5 genes Second Exon is successfully struck according to testing result Remove.

4. a kind of recombinant expression carrier for being used to improve Rice Characters, it is characterised in that：As the nucleotides shown in SEQ ID NO.9 Fragment is connected and obtained with pBWA (V) H-cas9 carriers.

5. recombinant expression carrier according to claim 4, it is characterised in that：The nucleotide sequence of the recombinant expression carrier As shown in SEQ ID NO.4.

6. application of the recombinant expression carrier in improvement Rice Characters described in claim 4 or 5.

7. application of the rice Os PDCD5 genes Second Exon in improvement Rice Characters.

8. the application according to claim 6 or 7, it is characterised in that：The improvement Rice Characters are selected from：Increase rice plant Number of productive ear, branch stalk number, grain number per spike, increase the plant height of rice plant, leaf length, internode height, spike length, thousand of increase paddy rice Weight, yield.

9. the application according to claim 6 or 7, it is characterised in that：The rice varieties are the bright 1B of long-grained nonglutinous rice.

10. the application according to claim 6 or 7, it is characterised in that：It is fixed using CRISPR/Cas9 systems during concrete application Point knocks out OsPDCD5 gene Second Exons in rice paddy seed；Or：Recombinant expression carrier is transferred the possession of in paddy rice to pinpoint knockout water OsPDCD5 genes Second Exon in rice.