CN114807167B - Cluster Mao Maiquan growth period broad-spectrum powdery mildew resistance gene Pm5V and application thereof - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and discloses a cluster Mao Maiquan broad-spectrum powdery mildew resistance gene Pm5V in a growth period and application thereof. The CDS sequence of the Pm5V gene is SEQ ID NO.1 and the coded amino acid sequence thereof is SEQ ID NO.2. The gene is derived from Haynaldia villosa (Dasypyrum villosum). Cloning Pm5V gene and amplifying primer sequences shown as SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6. The gene Pm5V with the cluster Mao Maiquan broad-spectrum powdery mildew resistance in the growth period can resist powdery mildew, improve the disease resistance of wheat, has excellent agronomic characters of the T5DL.5VS translocation line carrying the Pm5V gene, has no negative effect on important characters such as yield and the like, and has high breeding utilization value.

Description

Cluster Mao Maiquan growth period broad-spectrum powdery mildew resistance gene Pm5V and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and discloses a cluster Mao Maiquan broad-spectrum powdery mildew resistance gene Pm5V in a growth period and application thereof.

Background

Wheat is a worldwide food crop, has strong adaptability and wide distribution range, provides a main energy source for more than one third of human beings, and the yield and quality of the wheat are directly related to the food safety of the whole human beings. Is prepared from wheat powdery mildewBlumeria graminis f.sp tritici) caused powdery mildew of wheat is one of the main diseases of wheat. The wheat leaf growth regulator belongs to specialized parasitism, and can infect leaves, stems, ears and the like of wheat in the whole growth period, wherein the wheat leaf is mainly endangered, and the normal photosynthesis of the wheat is influenced when serious, so that the normal growth of the wheat is influenced, and the yield is reduced. In the last ten years, the incidence area of wheat powdery mildew in China is 667 ten thousand hm each year ² The annual average loss of about 1000 ten thousand tons is caused, and the safety production of wheat in China is seriously threatened, so that the prevention and the control of wheat powdery mildew are more and more interesting.

The excavation of disease-resistant genes and the cultivation of disease-resistant varieties are the most sustainable strategies for preventing and treating wheat powdery mildew. However, the frequent loss of single-resistance source resistance makes the breeding work always passively catch up with the change of pathogenic bacteria minispecies, and severely restricts the further improvement of the yield and quality level of wheat. Therefore, a new type of resistance source needs to be discovered, the genetic diversity of disease-resistant genes is improved, and the durability of powdery mildew resistance of wheat varieties is maintained.

The broad-spectrum powdery mildew resistance gene Pm5V in the whole growth period is positioned on the chromosome arm 5VS of the Haimago 01I140, and is highly resistant to all powdery mildew physiological races in China at present (Fan Yali, 2020). By creating a wheat-Haomao T5DL.5VS translocation line, the Pm5V gene is introduced into the genetic background of common wheat, and a new disease-resistant strain with different genetic backgrounds is created. The genetic segregation population was constructed using different t5dl.5vs translocation lines, and fine localization analysis was performed on the Pm5V gene (muster clear, 2021). Further sorting and sequencing the 5VS chromosome arm carrying the Pm5V gene, and combining functional analysis such as a localization interval, gene silencing and the like, so that map cloning of the Pm5V gene is realized. The T5DL.5VS translocation line carrying the Pm5V gene has excellent agronomic characters, has no negative effect on important characters such as yield and the like, has high breeding utilization value, develops a molecular marker easy to identify the Pm5V gene, and accelerates the breeding utilization of the gene.

Disclosure of Invention

The invention aims to disclose a cluster Mao Maiquan broad-spectrum powdery mildew resistance gene Pm5V in a growth period and a breeding utilization method thereof.

The DNA sequence of the Pm5V gene is positioned on a Haynaldia villosa 5VS chromosome, the total length of the DNA sequence is 3804bp, the nucleotide sequence is shown as SEQ ID NO.1, the encoding is of 1267 amino acids, and the amino acid sequence is shown as SEQ ID NO.2.

The sequences of the amplification primers of the Pm5V gene are shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

Recombinant expression vector containing said gene Pm5V.

The gene Pm5V is applied to cultivation of powdery mildew resistant wheat varieties.

As a preferable mode of the invention, the wheat-cluster wheat T5DL.5VS translocation line carrying the Pm5V gene is hybridized with a wheat variety not carrying the Pm5V gene, and a new wheat variety carrying the Pm5V gene is cultivated through molecular marker assisted selection, so that powdery mildew resistance of the wheat is improved; the molecular marker assisted selection uses primers shown as SEQ ID NO.3 and SEQ ID NO. 4.

As another preferred aspect of the present invention, the gene Pm5V is introduced into powdery mildew-susceptible wheat varieties by genetic engineering means to improve the resistance thereof to powdery mildew.

The recombinant expression vector is applied to cultivation of powdery mildew resistant wheat varieties.

A molecular marker primer of gene Pm5V consists of primers P1 and P2 shown in SEQ ID NO.3 and SEQ ID NO.4, and SEQ ID NO.5 and SEQ ID NO.6.

The molecular marker primer is applied to wheat powdery mildew resistance breeding.

Advantageous effects

The map cloning of the invention obtains a cluster Mao Maiquan growth period broad-spectrum powdery mildew resistance gene Pm5V, which is highly resistant to all powdery mildew physiological races in China at present (figure 1). Pm5V is used for disease-resistant breeding, and can improve powdery mildew resistance of wheat varieties (figure 10). The T5DL.5VS translocation chromosome carrying the Pm5V gene does not exchange recombination with 5DS in the wheat background, the Pm5V gene and other excellent genes on the 5VS are subjected to single-site linkage inheritance, the translocation chromosome has no negative effect on important characters such as yield and the like, and the breeding utilization efficiency is high (figure 8). The developed molecular marker of the Pm5V gene is easy to assist in molecular marker selection, and the breeding utilization of the gene is quickened (figure 3).

Drawings

FIG. 1 shows that Pm5V is resistant to the physiological race of powdery mildew in China by carrying out anti-spectrum analysis on a TF5V-11 gene material carrying Pm5V by using 24 Bgt strains from different wheat producing areas. Injecting; powdery mildew reaction type adopts 0-4 grade standard, 0: immunization; 0; : allergic necrosis; 1: high resistance; 2: moderate resistance; 3: moderate disease; 4: high susceptibility to disease

The analysis of the major agronomic traits of the higher-generation line containing the Pm5V gene and its recurrent parent NAU0686 of fig. 2 found that the t5dl.5vs translocation chromosome carrying the Pm5V gene had no significant negative effect on the major agronomic traits.

FIG. 3 PCR cloning of Pm5V gene. The gene is cloned in 2 segments, and the band size of the PCR product of the first segment of marker P1/P2 is 2478bp after gel electrophoresis; the PCR product of the second section of mark P3/P4 is gel electrophoresis, and the band size is 2223bp.

FIG. 4 shows that only the allele of Pm5V in the disease-resistant material TF5V-11 was expressed by powdery mildew induction by Q-PCR analysis of the differential expression of Pm5V allele in the powdery mildew-resistant material TF5V-11 and powdery mildew-susceptible material TF 5V-2. 0 hours: the relative expression amount of Pm5V in the uninduced sample; 8. 12, 24, 36, 72 hours: relative expression level of Pm5V in powdery mildew induced samples.

FIG. 5 shows that the Pm5V gene is silenced and verified by barley stripe Virus (VIGS), and the powdery mildew identification is carried out on the leaf blade with the phenotype of 4 th leaf blade, and after the expression level of the Pm5V gene is reduced, the leaf blade shows powdery mildew spores, which indicates that the Pm5V gene is related to powdery mildew resistance. The controls were 1: BSMV PDS, 2: TF5V-11, 3 without inoculation of any virus: BSMV: gamma null, 3 sets of treatments 4, 5, 6: BSMV: gamma-Pm 5V.

FIG. 6 VIGS silences Pm5V gene efficiency assay. RNA was extracted from each leaf of the 4 th leaf showing the streak phenotype after virus inoculation, and gene silencing efficiency was detected by qPCR after cDNA inversion. The control CK is BSMV: gamma null, and 1, 2, 3, 4 and 5 are silencing efficiencies of five independent single-plant inoculated recombinant viruses BSMV: gamma-Pm 5V. The black bar graph represents 5 individuals with silencing targets located in the Pm5V CC domain, and the gray bar graph represents 5 individuals with silencing targets located in the Pm5V NBS domain. The expression quantity of Pm5V is obviously reduced after inoculation, which indicates that the silencing efficiency is higher.

FIG. 7 Pm5V overexpression transgene assay. Constructing an agrobacterium transgenic vector by utilizing the connection of an over-expression promoter ubiquitin and a Pm5V full-length gene, and performing T on a agrobacterium infection transduction powdery mildew variety Fielder ₁ The generation 5 positive single plant is inoculated and identified by using powdery mildew physiological race E26, and the high level is found to be reached, so that the effectiveness of Pm5V on powdery mildew resistance is shown.

FIG. 8 GISH/FISH identification of materials carrying the Pm5V gene. GISH and FISH identification were performed simultaneously using the cluster wheat genome probes, oligo probes pAs1-1 and pAs 1-4. The green fluorescent signal is shown as the Hamamelis' chromosome, the red fluorescent signal is pAs1-1 and pAs1-4 probe signals, and the red fluorescent signal is mainly distributed on the wheat D group chromosome. And determining that the translocation chromosome is T5DL.5VS by referring to the Haimago chromosome karyotype and the common wheat Chinese spring chromosome karyotype.

FIG. 9 carries the identification of co-dominant molecular markers of Pm5V genetic material. . And (3) carrying out PCR amplification on leaf DNA of the selected material by utilizing a specific co-dominant molecular marker EST-237 on 5VS, and carrying out polyacrylamide gel electrophoresis on an amplified product. TF5V-11 expands specific band on 5VS and lacks band on 5DS, and molecular marker and cytology mutually verify that selective breeding material carries Pm5V gene.

FIG. 10 shows identification of powdery mildew in seedling stage and adult stage of new strain carrying Pm5V gene. The novel strain carrying the Pm5V gene is discovered to perform near immunity to the inoculated powdery mildew mixed physiological minispecies in both the seedling stage and the adult plant stage, and the utilization value of the gene in disease-resistant breeding is proved.

Detailed Description

EXAMPLE 1 cloning, expression analysis of Cluster Mao Maiquan growth-period broad-spectrum powdery mildew resistance gene Pm5V

To mine the cluster Mao Maiquan growth phase broad spectrum powdery mildew resistant gene Pm5V, 5VS chromosome arms in the antipathogenic material wheat-cluster hair translocation line TF5V-11 and the infectious material TF5V-2 were sorted and sequenced and assembled to the scaffoldes level. And screening out a sequence on 5VS by using a bioinformatics method, and carrying out gene annotation on the sequence to obtain the NLR gene. By fine localization, in combination with genotype and phenotype data, a specific NLR gene on Hamamelis was found in this interval. And preliminarily judging that the gene has correlation with powdery mildew resistance.

RNA extracted from leaves of disease-resistant material TF5V-11 induced by powdery mildew for 24 hours is reverse transcribed into cDNA as a template, and the Pm5V gene sequence is longer, so that PCR amplification is carried out in two sections. The gene sequence is used as a template to carry out similarity sequence comparison on NCBI database, and designed specific primers P1 (ATGGCTGCCTCTGCTGCATTTGT, SEQ ID NO. 3), P2 (GCTTATCAAACTGAGAGATGC, SEQ ID NO. 4), P3 (TGGGAACAAGAAGAAAGG, SEQ ID NO. 5) and P4 (TCAGTATGTTCCATCGGTAC, SEQ ID NO. 6) are used as primers to carry out PCR amplification, so that the full-length gene of Pm5V is obtained; the CDS sequence is shown as SEQ ID NO.1, and the coded protein sequence is shown as SEQ ID NO.2. (FIG. 3)

Real-time fluorescence quantitative PCR (Q-PCR) analysis was performed using the RNA reverse transcription cDNA induced by powdery mildew for 0, 8, 12, 24, 36, and 72 hours as templates and using P5 (CGGGAAAAGGAGAAACAAGAT, SEQ ID NO. 7) and P6 (TCACACGGGTAGCGGAATGT, SEQ ID NO. 8) as primers. The PCR procedure was: the PCR reaction was amplified and fluorescence detected on a real-time fluorescent quantitative PCR instrument (MyIQ, bio-Rad, inc., USA). The 20uL PCR reaction contained 2X SYBR Green PCR Master Mix 10uL, 0.5. Mu.M primers P3 and P4, and 2uL of the cDNA template was reverse transcribed. The amplification parameters were: 95℃for 10 minutes, then 95℃for 15 seconds, 60℃for 30 seconds, 72℃for 1 minute, for a total of 40 cycles. After the completion of the reaction, the melting curve was measured. The level of gene expression was detected and analyzed using the MyiQ system software. The result shows that in TF5V-11, pm5V is induced to up-regulate by powdery mildew, the up-regulation is obvious in 12 hours, the expression level is highest after 24 hours, and the expression is reduced in 36 and 72 hours; in TF5V-2, pm5V was not characterized by powdery mildew-induced expression, and the expression level in each period was lower than that in TF5V-11 (FIG. 4).

Example 2 verification of the function of the Pm5V Gene Using Gene silencing technology

The silencing vector is a barley streak mosaic virus vector (Xing et al, 2018). The construction flow is as follows: 1. primers P5 (CGGGAAAAGGAGAAACAAGAT, SEQ ID No. 9) and P6 (TCACACGGGTAGCGGAATGT, SEQ ID No. 8) are designed in the coding region by using the cloned gene sequence of Pm5V as a template; p7 (GAGTCGAAAGGGATAAGTGT, SEQ ID No. 10) and P8 (ATTGCTTTGCAAATGCTCA, SEQ ID No. 11) and the primer carries the NheI cleavage site. After recovery of the amplified product, it was completely digested with restriction enzyme NheI. In addition, the gamma-PDS vector was completely digested with restriction endonuclease NheI, and an insert of about 200bp (PDS gene sequence) and a vector fragment of more than 2Kb were excised. And (3) connecting the exogenous gene fragment after the enzyme digestion in the step (1) with the recovered vector fragment. The ligation product was transformed into competent E.coli, coated with ampicillin-resistant plates, and incubated at 37℃for 12-16h before shaking. 2. Linearizing a carrier: the gamma recombinant vector plasmid and gamma-PDS viral vector, which were verified to be correct, were linearized with MluI enzyme and the beta vector was linearized with SpeI enzyme. Each plasmid was cut at 8. Mu.g and divided into four tubes, which were digested at 37℃for 4 hours. 3. In vitro transcription: the procedure was as per RiboMAXTMLarge Scale RNA Production Systems-SP6 and T7. 4. The transcript was used to smear wheat leaves: identifying whether the VIGS silencing system is successful or not through inoculating the plant phenotype of gamma blank and gamma-PDS; the plants inoculated with BSMV: pm5V were used to silence the target gene, and the target gene and control were repeated twice, 12 strains each time. Spraying DEPC water after inoculation, placing in the dark at 22 ℃ for moisturizing culture for 24 hours, and placing in an illumination/darkness period of 16 hours/8 hours for culture at 18-20 ℃. And after the PDS is bleached, taking leaves with virus phenotype in the four-leaf stage, and simultaneously carrying out in-vitro identification and RNA extraction. The isolated leaves are orderly placed on a 6-BA culture medium, the tremella method is used for inoculating fresh spores of powdery mildew, and the disease condition of the leaves is observed after 6 days of inoculation. The result shows that the plants inoculated with BSMV, PDS, have a photo-bleaching phenomenon, and powdery mildew inoculated on the surfaces of leaves do not have powdery mildew, which shows that the effect of the silencing system of the experiment is obvious; the surface of the leaf after the in-vitro identification of the inoculated BSMV: gamma empty leaf is free from powdery mildew, and the surface of the leaf after the in-vitro identification of the inoculated BSMV: pm5V is free from macroscopic powdery mildew, which shows that the Pm5V gene has the powdery mildew resistance (figure 5). Gene expression analysis was performed on the extracted RNA, 3 biological replicates per sample. The results show that silencing of different coding regions of the Pm5V gene takes contemporaneous BSMV: gamma empty as a control, and single strains (1, 2, 3, 4 and 5) inoculated with recombinant virus BSMV: gamma-Pm 5V have different degrees of reduction of Pm5V expression, which indicates that the Pm5V silencing is successful (figure 6).

Example 3 transgenic overexpression verification of Pm5V Gene function

The full-length sequence (3804 bp) of Pm5V and the maize ubiquitin (Ubi) promoter are connected to a plGy-OE3 vector, and restriction enzymes are Stul and BamH1 respectively to construct a transgenic over-expression vector pUbi:Pm5V. The correctness of the insertion of the Pm5V gene into the vector was verified by Sanger sequencing. pUbi-Pm 5V plasmid is transferred into powdery mildew-sensitive wheat variety Fielder by agrobacterium infection, T ₀ And carrying out PCR amplification by using a Pm5V gene primer, and taking leaves of a positive plant for powdery mildew in-vitro identification. T (T) ₀ Extension T of substitution selfing ₁ The generation of positive plants was identified by inoculating powdery mildew in seedling stage and adult stage respectively to verify the function of the Pm5V gene (FIG. 7). Cloning of the full-length primer sequences P1 (ATGGCTGCCTCTGCTGCATTTGT, SEQ ID NO. 3) and P4 (TCAGTATGTTCCATCGGTAC, SEQ ID NO. 6) of the Pm5V gene. The template is genomic DNA of disease-resistant material TF 5V-11. Double digestion was performed using StuI and BamHI, and the gene of interest was inserted into the pLGY-OE3 vector at positions 2293-2302bp. The Ubi promoter is located in the pLGY-OE3 vector: 294-2286bp. The pLGY-OE3 vector is a commercial Agrobacterium universal vector.

Example 4 wheat-Haomaimai T5DL.5VS breeding utilization carrying Pm5V Gene

The TF5V-11 is used as a disease-resistant parent to be hybridized with a high-yield variety in production, the Pm5V gene is used for marking P1/P2 for molecular marker assisted selection, and the new variety of the disease-resistant wheat carrying the Pm5V gene is obtained by combining powdery mildew resistance identification and agronomic character analysis, breeding a new variety with high resistance to the powdery mildew of the wheat and excellent agronomic character and participating in a region test. And the new strain (species) selected and bred is identified as follows to determine whether the Pm5V gene is carried.

(1) wheat-Haomao T5DL.5VS chromosome GISH/FISH identification.

GISH and FISH identification are simultaneously carried out by using a cluster wheat genome probe, an oligo probe pAs1-1 and pAs1-4, and the result is shown in a graph (figure 8), wherein green fluorescent signals are cluster wheat chromosomes, red fluorescent signals are pAs1-1 and pAs1-4 probe signals and are mainly distributed on wheat D group chromosomes. The translocation chromosome was determined to be t5dl.5vs by reference to the cluster wheat chromosome karyotype (Zhang Wei, 2012), the common wheat chromosome karyotype of chinese spring (Wang Danrui et al, 2017).

(2) Wheat-villus t5dl.5vs chromosome molecular marker identification.

Leaf DNA of the selected material was PCR amplified using the co-dominant molecular marker EST-237 specific to 5VS and the amplified product was subjected to polyacrylamide gel electrophoresis (FIG. 9). TF5V-11 amplifies specific bands on 5VS and lacks bands on 5DS, and molecular marker identification is combined with GISH/FISH identification, so that the bred material is determined to carry Pm5V genes.

(3) Identification of powdery mildew in seedling stage and adult stage of new strain carrying Pm5V gene

And (3) inoculating and identifying the new strain (seed) which is bred in the seedling stage and the adult plant stage, wherein the whole growth period of the material with the Pm5V gene shows near immunity (figure 10). The seedling stage identification is carried out in a greenhouse, powdery mildew is inoculated in the 2-leaf stage, physiological seeds are mixed, and when the disease sensing material is ill, the disease grade investigation is carried out. The adult plant period identification is carried out in powdery mildew resistance identification nursery, and the induction row is planted vertically with the identification material. And in the jointing period, the physiological seeds of the induced row mixed powdery mildew are inoculated and identified, and disease investigation is carried out in the heading period and the grouting period.

Sequence listing

<110> Nanjing agricultural university

<120> one cluster Mao Maiquan growth period broad spectrum powdery mildew resistance gene Pm5V and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3804

<212> DNA

<213> Haimai (Dasypyrum villosum)

<400> 1

atggctgcct ctgctgcatt tgtttttgca gggaagtctg tggcgacttc ggccatatcc 60

ttcttggtca ccaaggcttt caactacatc gatgagtact gcaagtccga aaacatggat 120

gagttgaaga atcggctcct gcgggccatg ccacatatcc aggcggtgtt cgatgtcgtc 180

aacccggaac ttgtcaggga gcagagcagc ggcctcgacg cgtggctctg gcagctcagg 240

gacgcggtcg aggcggcgga ggacgccatc gatgagcttg aatactacga gctcgaggag 300

aaggccaagg accaaaaggt tagtgaatgg ggttctcctc ttggtaagat gaagcacaag 360

tttgtcagat ctcttggccc tgctgtcaac aagactatca agaaaattag tcaccgtgac 420

actctgaaga gattgatgaa atctgtggat gatttagaca aggctgccat aggtgttggt 480

gattttctaa agctcacaga ccatctcagt ggaggttctt ctaccagcag tcaacagaaa 540

gtgcagaaca atgatcgcca gactggttca acagaaagtg caacaaagtt tattggacgg 600

gaaaaggaga aacaagatat tattggatgg ctagccaaca cgtcagatga attgggtgaa 660

aatggggtca gaaggaccaa aagtattcca attatttcag ttattggtca tggtggcatg 720

gggaagactg ccttggctca gagcatatgt aatcaagatg aggtagtgaa gcattttaag 780

atcatctgga tcaccgtatc tactagcttt gatgcgacct cggtgacaag taaaatacta 840

cattccgcta cccgtgtgaa accaaacact gatcatttgg aaccactaca gcgagatctc 900

gaagagaaac tcaaatccat taagtttttg ctagttatgg atgatgtttg ggaagataag 960

aaaagagatg aatgggagaa gttatttgct cctatgaaga aactgaacac tgttgggagc 1020

aaaattttgt tgacaacccg aatgcaatct gtagcggaca tggctgcaaa ggtgatggga 1080

gtcgaaaggg ataagtgtct gacattacaa ggactagaag atgatgaaaa tctcaagctc 1140

ttcaaccatc atgccttttc cggtttgaat ccaggagatg atgcacattt gaagttaact 1200

ggagaacaaa ttgcaaagaa actaagagga tgtcccttgg taacaaaggt tgtcgctgag 1260

catttgcaaa gcaatataac acctgaatac tggaggagat tcttgcatca aggattggaa 1320

cattttaaag gaaccgaaaa ggatattatg gaagttctca gattgagcta ctaccactta 1380

ccaacagagc tacagatttg ctttcggtac tgttgcctat ttcggcagga ctatatgttt 1440

gaaaagaaag tgttggtgca aatgtggatt ggttctggat tgattgcaag tggcattcaa 1500

tctttggagg ataccgcaga acaattcttg gctcagctaa ctagaaagtc gttctttgat 1560

atgaaaccta taacttgtgg atgggaacaa gaagaaaggt atgtaatgca tgacttgatg 1620

catgaattag caagcaatgt gtccactggt gaatgtgcaa gaatagttga ccctgttcaa 1680

cttcaagatg agaagtatac agtccgacac ctatgcattg tcaatattca caggttctct 1740

gctgatgagg tcaagaaaat ctcccatttt aagaatctgc gcactattat cattgataat 1800

accccgccac ttgaaaatga tactcttcgc gcacttcaaa tgatagttga gacctcaaag 1860

gcactgcgac tattccatgc agaattatgg aacacatccc gttttactgt caattttggt 1920

aacttaaaac atcttcgcta tatccgcgtg agttcgatac cacaaggcaa gatatgtggg 1980

gtcgcaagac tttatcactt gatggtcctt cactatggtt cttccgggac cataatagat 2040

gaagcaagat atttagggaa ccttgaacgt ttgcggtatg tatcctatgg tgtgcatgga 2100

tttggtaatt tccccataag caggctcact tctcttcagg aattacatga ttaccaggta 2160

gaagaaagaa catgcaacca aataagtgca gttgggagct taagagatct tcgtagatta 2220

ggtctgctgg gtcttgagaa tgttaagaat tgtgaagaag ctaagaatgc caagttgaag 2280

gaaaaacaat atctcaactc attatttatg aagtggtcga cacctgacca aatcatgaca 2340

gataacttag ttcttgacca ccttgagcca catgttaata tcaaagaatt gcaaattcag 2400

ggttatccag gtcccaaaat tccatcttgg atggagaaca gctctgtcaa aaatctggca 2460

tctctcagtt tgataagctg cattaattgg gaataccttc cctctctcgg cgagttagta 2520

tttctgaagt ttcttatgtt gaaggacctt cgtaatctaa ggcagattgg tcgatcatct 2580

gatatgtccg gtagtagctc catggagttg ctgttacctc aaagacttga tagtttggaa 2640

gtaaatgaat gccgacaact gagagagtta cctattctac ctccaagcct agtgtcactg 2700

gatataggag atgtttgtct gaccaaactc cctatgattg gcaagatatc aagtgggaac 2760

atcgagccga aatcatctaa gttgaatgag atagttatca ccaactgtcc atgcttaagt 2820

tcgctggaag ggagcctttt ggagcaaaaa ttgcacatgg gaactctcca tatcctaaca 2880

attaataatt gtcaggatct ccaatccgcc cccataccat ttgaagaaat gaaagagctt 2940

aaggatctga caatacggga atgtccaaag ttgaggacgt tgagagatgg caaagataag 3000

cttgtgccat catcactaag agggcttact attggccggt gtggtgacct ggaacttcca 3060

ctacttgagt cactccaact gctcaccaac ttatctcatc ttgggctgca caactgctcg 3120

agtctggtgt ctctcccctc cgggaatgta ttcaagagtc tcaggttgct gcagagcatg 3180

cacatagagg aatgcgagaa tctctcgtcc ttgggaggtc tcggatcact tccaaccctc 3240

tattacttag caattagggg gtgcggtaaa ctcgcggagg ctgggtcctc ctcgctaact 3300

cgagttgcat ctggttccag tggcgagcat ctggtggagc ccagtagctc actggagata 3360

acaaatcttg acattgatct gtcgtccctg ctgcatcttg agccacttaa gagtctctgc 3420

cgcaccaaat atttgtgtat taacactgtg tcagagatgg atagcttacc tgaactatgg 3480

ctgctacaga atcgttcatc gctcagatgg ctgactatac acaaagcaga ttccttgaga 3540

tcgctcccac ccagaatgca agacctctgc tctctctcgc aattgagcct tgatgctggg 3600

caactccagt caattccata tctgccctcc tccttgaaga ccctttttct tccaggatgc 3660

catccagacc tggagaagaa gcttacgaaa catggaagcc ctgaatggaa caagattgct 3720

caaatccctt atgcggaaat aggtaccttc actctgccac tctcatcctc ttatttactg 3780

ctctgtaccg atggaacata ctga 3804

<210> 2

<211> 1267

<212> PRT

<213> Haimai (Dasypyrum villosum)

<400> 2

Met Ala Ala Ser Ala Ala Phe Val Phe Ala Gly Lys Ser Val Ala Thr

1 5 10 15

Ser Ala Ile Ser Phe Leu Val Thr Lys Ala Phe Asn Tyr Ile Asp Glu

20 25 30

Tyr Cys Lys Ser Glu Asn Met Asp Glu Leu Lys Asn Arg Leu Leu Arg

35 40 45

Ala Met Pro His Ile Gln Ala Val Phe Asp Val Val Asn Pro Glu Leu

50 55 60

Val Arg Glu Gln Ser Ser Gly Leu Asp Ala Trp Leu Trp Gln Leu Arg

65 70 75 80

Asp Ala Val Glu Ala Ala Glu Asp Ala Ile Asp Glu Leu Glu Tyr Tyr

85 90 95

Glu Leu Glu Glu Lys Ala Lys Asp Gln Lys Val Ser Glu Trp Gly Ser

100 105 110

Pro Leu Gly Lys Met Lys His Lys Phe Val Arg Ser Leu Gly Pro Ala

115 120 125

Val Asn Lys Thr Ile Lys Lys Ile Ser His Arg Asp Thr Leu Lys Arg

130 135 140

Leu Met Lys Ser Val Asp Asp Leu Asp Lys Ala Ala Ile Gly Val Gly

145 150 155 160

Asp Phe Leu Lys Leu Thr Asp His Leu Ser Gly Gly Ser Ser Thr Ser

165 170 175

Ser Gln Gln Lys Val Gln Asn Asn Asp Arg Gln Thr Gly Ser Thr Glu

180 185 190

Ser Ala Thr Lys Phe Ile Gly Arg Glu Lys Glu Lys Gln Asp Ile Ile

195 200 205

Gly Trp Leu Ala Asn Thr Ser Asp Glu Leu Gly Glu Asn Gly Val Arg

210 215 220

Arg Thr Lys Ser Ile Pro Ile Ile Ser Val Ile Gly His Gly Gly Met

225 230 235 240

Gly Lys Thr Ala Leu Ala Gln Ser Ile Cys Asn Gln Asp Glu Val Val

245 250 255

Lys His Phe Lys Ile Ile Trp Ile Thr Val Ser Thr Ser Phe Asp Ala

260 265 270

Thr Ser Val Thr Ser Lys Ile Leu His Ser Ala Thr Arg Val Lys Pro

275 280 285

Asn Thr Asp His Leu Glu Pro Leu Gln Arg Asp Leu Glu Glu Lys Leu

290 295 300

Lys Ser Ile Lys Phe Leu Leu Val Met Asp Asp Val Trp Glu Asp Lys

305 310 315 320

Lys Arg Asp Glu Trp Glu Lys Leu Phe Ala Pro Met Lys Lys Leu Asn

325 330 335

Thr Val Gly Ser Lys Ile Leu Leu Thr Thr Arg Met Gln Ser Val Ala

340 345 350

Asp Met Ala Ala Lys Val Met Gly Val Glu Arg Asp Lys Cys Leu Thr

355 360 365

Leu Gln Gly Leu Glu Asp Asp Glu Asn Leu Lys Leu Phe Asn His His

370 375 380

Ala Phe Ser Gly Leu Asn Pro Gly Asp Asp Ala His Leu Lys Leu Thr

385 390 395 400

Gly Glu Gln Ile Ala Lys Lys Leu Arg Gly Cys Pro Leu Val Thr Lys

405 410 415

Val Val Ala Glu His Leu Gln Ser Asn Ile Thr Pro Glu Tyr Trp Arg

420 425 430

Arg Phe Leu His Gln Gly Leu Glu His Phe Lys Gly Thr Glu Lys Asp

435 440 445

Ile Met Glu Val Leu Arg Leu Ser Tyr Tyr His Leu Pro Thr Glu Leu

450 455 460

Gln Ile Cys Phe Arg Tyr Cys Cys Leu Phe Arg Gln Asp Tyr Met Phe

465 470 475 480

Glu Lys Lys Val Leu Val Gln Met Trp Ile Gly Ser Gly Leu Ile Ala

485 490 495

Ser Gly Ile Gln Ser Leu Glu Asp Thr Ala Glu Gln Phe Leu Ala Gln

500 505 510

Leu Thr Arg Lys Ser Phe Phe Asp Met Lys Pro Ile Thr Cys Gly Trp

515 520 525

Glu Gln Glu Glu Arg Tyr Val Met His Asp Leu Met His Glu Leu Ala

530 535 540

Ser Asn Val Ser Thr Gly Glu Cys Ala Arg Ile Val Asp Pro Val Gln

545 550 555 560

Leu Gln Asp Glu Lys Tyr Thr Val Arg His Leu Cys Ile Val Asn Ile

565 570 575

His Arg Phe Ser Ala Asp Glu Val Lys Lys Ile Ser His Phe Lys Asn

580 585 590

Leu Arg Thr Ile Ile Ile Asp Asn Thr Pro Pro Leu Glu Asn Asp Thr

595 600 605

Leu Arg Ala Leu Gln Met Ile Val Glu Thr Ser Lys Ala Leu Arg Leu

610 615 620

Phe His Ala Glu Leu Trp Asn Thr Ser Arg Phe Thr Val Asn Phe Gly

625 630 635 640

Asn Leu Lys His Leu Arg Tyr Ile Arg Val Ser Ser Ile Pro Gln Gly

645 650 655

Lys Ile Cys Gly Val Ala Arg Leu Tyr His Leu Met Val Leu His Tyr

660 665 670

Gly Ser Ser Gly Thr Ile Ile Asp Glu Ala Arg Tyr Leu Gly Asn Leu

675 680 685

Glu Arg Leu Arg Tyr Val Ser Tyr Gly Val His Gly Phe Gly Asn Phe

690 695 700

Pro Ile Ser Arg Leu Thr Ser Leu Gln Glu Leu His Asp Tyr Gln Val

705 710 715 720

Glu Glu Arg Thr Cys Asn Gln Ile Ser Ala Val Gly Ser Leu Arg Asp

725 730 735

Leu Arg Arg Leu Gly Leu Leu Gly Leu Glu Asn Val Lys Asn Cys Glu

740 745 750

Glu Ala Lys Asn Ala Lys Leu Lys Glu Lys Gln Tyr Leu Asn Ser Leu

755 760 765

Phe Met Lys Trp Ser Thr Pro Asp Gln Ile Met Thr Asp Asn Leu Val

770 775 780

Leu Asp His Leu Glu Pro His Val Asn Ile Lys Glu Leu Gln Ile Gln

785 790 795 800

Gly Tyr Pro Gly Pro Lys Ile Pro Ser Trp Met Glu Asn Ser Ser Val

805 810 815

Lys Asn Leu Ala Ser Leu Ser Leu Ile Ser Cys Ile Asn Trp Glu Tyr

820 825 830

Leu Pro Ser Leu Gly Glu Leu Val Phe Leu Lys Phe Leu Met Leu Lys

835 840 845

Asp Leu Arg Asn Leu Arg Gln Ile Gly Arg Ser Ser Asp Met Ser Gly

850 855 860

Ser Ser Ser Met Glu Leu Leu Leu Pro Gln Arg Leu Asp Ser Leu Glu

865 870 875 880

Val Asn Glu Cys Arg Gln Leu Arg Glu Leu Pro Ile Leu Pro Pro Ser

885 890 895

Leu Val Ser Leu Asp Ile Gly Asp Val Cys Leu Thr Lys Leu Pro Met

900 905 910

Ile Gly Lys Ile Ser Ser Gly Asn Ile Glu Pro Lys Ser Ser Lys Leu

915 920 925

Asn Glu Ile Val Ile Thr Asn Cys Pro Cys Leu Ser Ser Leu Glu Gly

930 935 940

Ser Leu Leu Glu Gln Lys Leu His Met Gly Thr Leu His Ile Leu Thr

945 950 955 960

Ile Asn Asn Cys Gln Asp Leu Gln Ser Ala Pro Ile Pro Phe Glu Glu

965 970 975

Met Lys Glu Leu Lys Asp Leu Thr Ile Arg Glu Cys Pro Lys Leu Arg

980 985 990

Thr Leu Arg Asp Gly Lys Asp Lys Leu Val Pro Ser Ser Leu Arg Gly

995 1000 1005

Leu Thr Ile Gly Arg Cys Gly Asp Leu Glu Leu Pro Leu Leu Glu Ser

1010 1015 1020

Leu Gln Leu Leu Thr Asn Leu Ser His Leu Gly Leu His Asn Cys Ser

1025 1030 1035 1040

Ser Leu Val Ser Leu Pro Ser Gly Asn Val Phe Lys Ser Leu Arg Leu

1045 1050 1055

Leu Gln Ser Met His Ile Glu Glu Cys Glu Asn Leu Ser Ser Leu Gly

1060 1065 1070

Gly Leu Gly Ser Leu Pro Thr Leu Tyr Tyr Leu Ala Ile Arg Gly Cys

1075 1080 1085

Gly Lys Leu Ala Glu Ala Gly Ser Ser Ser Leu Thr Arg Val Ala Ser

1090 1095 1100

Gly Ser Ser Gly Glu His Leu Val Glu Pro Ser Ser Ser Leu Glu Ile

1105 1110 1115 1120

Thr Asn Leu Asp Ile Asp Leu Ser Ser Leu Leu His Leu Glu Pro Leu

1125 1130 1135

Lys Ser Leu Cys Arg Thr Lys Tyr Leu Cys Ile Asn Thr Val Ser Glu

1140 1145 1150

Met Asp Ser Leu Pro Glu Leu Trp Leu Leu Gln Asn Arg Ser Ser Leu

1155 1160 1165

Arg Trp Leu Thr Ile His Lys Ala Asp Ser Leu Arg Ser Leu Pro Pro

1170 1175 1180

Arg Met Gln Asp Leu Cys Ser Leu Ser Gln Leu Ser Leu Asp Ala Gly

1185 1190 1195 1200

Gln Leu Gln Ser Ile Pro Tyr Leu Pro Ser Ser Leu Lys Thr Leu Phe

1205 1210 1215

Leu Pro Gly Cys His Pro Asp Leu Glu Lys Lys Leu Thr Lys His Gly

1220 1225 1230

Ser Pro Glu Trp Asn Lys Ile Ala Gln Ile Pro Tyr Ala Glu Ile Gly

1235 1240 1245

Thr Phe Thr Leu Pro Leu Ser Ser Ser Tyr Leu Leu Leu Cys Thr Asp

1250 1255 1260

Gly Thr Tyr

1265

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atggctgcct ctgctgcatt tgt 23

<210> 4

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gcttatcaaa ctgagagatg c 21

<210> 5

<211> 18

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tgggaacaag aagaaagg 18

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tcagtatgtt ccatcggtac 20

<210> 7

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cgggaaaagg agaaacaaga t 21

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tcacacgggt agcggaatgt 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

gagtcgaaag ggataagtgt 20

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

attgctttgc aaatgctca 19

Claims (6)

1. Broad-spectrum powdery mildew resistance gene with cluster Mao Maiquan in growth periodPm5VThe sequence of the polypeptide is shown as SEQ ID NO. 1.

2. The gene of claim 1Pm5VThe amino acid sequence of the coded protein is SEQ ID NO.2.

3. The gene of claim 1Pm5VIs characterized in that the cloning primer is SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6.

4. Comprising the gene according to claim 1Pm5VIs a recombinant expression vector of (a).

5. The gene of claim 1Pm5VUse of the gene of claim 1 for breeding powdery mildew-resistant wheat varietiesPm5VThe wheat variety susceptible to powdery mildew is introduced into the wheat variety by genetic engineering means so as to improve the resistance of the wheat variety to powdery mildew.

6. The use of the recombinant expression vector of claim 4 in breeding powdery mildew resistant wheat varieties, characterized in that the recombinant expression vector of claim 4 is introduced into powdery mildew susceptible wheat varieties to improve the resistance thereof to powdery mildew.

Images