CN114835789B - Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof - Google Patents

Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof Download PDF

Info

Publication number
CN114835789B
CN114835789B CN202210579558.4A CN202210579558A CN114835789B CN 114835789 B CN114835789 B CN 114835789B CN 202210579558 A CN202210579558 A CN 202210579558A CN 114835789 B CN114835789 B CN 114835789B
Authority
CN
China
Prior art keywords
taglp
wheat
powdery mildew
plant
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210579558.4A
Other languages
Chinese (zh)
Other versions
CN114835789A (en
Inventor
李成伟
胡平
任月明
宋普文
陶烨
未志源
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Henan Institute of Science and Technology
Original Assignee
Henan Institute of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Henan Institute of Science and Technology filed Critical Henan Institute of Science and Technology
Priority to CN202210579558.4A priority Critical patent/CN114835789B/en
Publication of CN114835789A publication Critical patent/CN114835789A/en
Application granted granted Critical
Publication of CN114835789B publication Critical patent/CN114835789B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0089—Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y102/00—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2)
    • C12Y102/03—Oxidoreductases acting on the aldehyde or oxo group of donors (1.2) with oxygen as acceptor (1.2.3)
    • C12Y102/03004—Oxalate oxidase (1.2.3.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
    • C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
    • C12Y115/01001—Superoxide dismutase (1.15.1.1)
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to the technical field of biology, and discloses a wheat powdery mildew resistance related protein TaGLP-7A, and a coding gene and application thereof. The invention relates to a new clone obtained from wheat variety Bainong 207GLPGenes, which are designated asTaGLP‑7A. The invention is constructed to silence wheatTaGLP‑7ABarley streak mosaic virus inducible vector of gene, decreaseTaGLP‑7AExpression of the Gene is silencedTaGLP‑7AWheat plants, silencingTaGLP‑7AWheat inoculation powdery mildewAfter that, powdery mildew resistance is significantly reduced. Furthermore, the present invention further constructs overexpressionTaGLP‑7AWheat stable genetic transformation plant and overexpressionTaGLP‑7AThe powdery mildew resistance level of the wheat plants is obviously improved, thereby indicatingTaGLP‑7AAfter the expression quantity in the infected wheat plant is improved, the powdery mildew resistance of the infected wheat plant can be obviously improved, so that the gene can be used for cultivating powdery mildew resistant wheat by utilizing a genetic engineering means.

Description

Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof
Technical Field
The invention relates to the technical field of biology, in particular to a wheat powdery mildew resistance related protein TaGLP-7A, and a coding gene and application thereof.
Background
Wheat (Triticum aestivum l.) is the main source of human food calories, china is the first major country of wheat planting and yield, which plays an important role in guaranteeing domestic food safety. Wheat powdery mildew is a worldwide disease caused by the living nutrient obligate parasitic fungus wheat powdery mildew (Blumeria graminis f.sp.tritici), which can generally result in 13% -34% yield loss, 50% yield loss when the disease is serious in heading and grouting period, and leaf dryness even plant death under some extreme disease conditions. Along with the structural variation of germ virulence, climate change and the promotion of certain cultivation modes, the incidence rate of wheat powdery mildew in winter wheat areas in China is increased year by year, and the tendency of northeast expansion and north shift is realized.
The cultivation of resistant varieties is one of the most economical, effective and environment-friendly methods for reducing wheat powdery mildew loss, only a small number of disease-resistant genes such as Pm2, pm3, pm4, pm6, pm8 and Pm21 have been widely applied to the production of Chinese wheat since the last century powdery mildew resistance breeding, and the resistance of most of small-species specialized disease-resistant genes has been overcome by new toxic small-species, so that the application value in production is gradually lost, and the broad-spectrum powdery mildew resistance genes widely applied in practical production are not many. Therefore, the development of a new durable broad-spectrum high-resistance gene, the exploration of a new way of wheat powdery mildew resistance breeding, and the improvement of the durable broad-spectrum resistance of wheat to powdery mildew are urgent.
The germinating protein (GLPs) belongs to a member of the Cupin superfamily, often consisting of two exons and one intron, the encoded protein contains about 220 amino acids and contains a conserved Cupin domain at the C-terminus. GLPs play an important role in plant defense response, and part of GLPs have oxalate oxidase (OXO) or superoxide dismutase (SOD) activity, which catalyze H produced by oxalic acid and the like 2 O 2 Promote the crosslinking of cell walls at the infected part of pathogenic bacteria, H 2 O 2 As an important intracellular signal, it also activates a series of signal transduction pathways associated with plant defense, preventing invasion of pathogenic bacteria. Research shows that peanut AhGLP has a unique response mode on stress such as aspergillus flavus, mosaic disease, rust disease and the like; ghABP19 in upland cotton plays an important role in regulating the resistance of cotton to verticillium wilt; the resistance of the rice over-expressing OsGLP2-1 to rice blast and bacterial leaf blight is obviously enhanced. The research shows that GLP genes play an important role in plant disease resistance, but the cloning and function research of the genes are less in related reports in the research of wheat powdery mildew at present.
Disclosure of Invention
Aiming at the problems and the defects existing in the prior art, the invention aims to provide a wheat powdery mildew resistance related protein TaGLP-7A, and a coding gene and application thereof.
In a first aspect, the present invention provides a protein.
The protein provided by the invention is derived from wheat genus wheat (Triticum aestivum l.), and is named tagp-7A, which is a) or b) or c) or d) as follows:
a) The amino acid sequence is a protein shown as SEQ ID NO. 2;
b) A fusion protein obtained by connecting a tag to the N-terminal and/or C-segment of the protein shown in SEQ ID NO. 2;
c) A protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 2;
d) A protein which has 85% or more homology with the amino acid sequence shown in SEQ ID NO.2 and has the same function.
Wherein SEQ ID NO.2 consists of 212 amino acid residues.
In order to facilitate purification of the protein of a), the amino-or carboxyl-terminal linkage of the protein shown in SEQ ID NO.2 of the sequence Listing may be provided with the tag shown in Table 1.
TABLE 1 sequence of tags
Label (Label) Residues Sequence(s)
Poly-Arg 5-6 (usually 5) RRRRR
Poly-His 2-10 (usually 6) HHHHHH
FLAG 8 DYKDDDDK
Strep-tag II 8 WSHPQFEK
c-myc 10 EQKLISEEDL
The protein of c) above, wherein the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.
The protein in the c) can be synthesized artificially or can be obtained by synthesizing the coding gene and then biologically expressing.
The coding gene of the protein in c) can be obtained by deleting one or more nucleotide codons in the DNA sequence shown in SEQ ID NO.1 and/or carrying out one or more base pair missense mutations and/or linking the coding sequences of the tags shown in Table 1 at the 5 'end and/or the 3' end.
In a second aspect, the invention provides a nucleic acid molecule encoding a TaGLP-7A protein.
The coding sequence of the nucleic acid molecule is shown as SEQ ID NO. 1.
In a third aspect, the invention provides a recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus comprising a nucleic acid molecule as described in the second aspect above.
In a third aspect, the present invention provides a novel use of a protein according to the first aspect or a nucleic acid molecule according to the second aspect or a recombinant vector or expression cassette or transgenic cell line or recombinant bacterium or recombinant virus according to the third aspect.
The invention provides an application of the TaGLP-7A protein or nucleic acid molecule or recombinant vector or expression cassette or transgenic cell line or recombinant bacterium or recombinant virus in regulating and controlling powdery mildew resistance of plants.
The invention also provides application of the TaGLP-7A protein or nucleic acid molecule or recombinant vector or expression cassette or transgenic cell line or recombinant bacterium or recombinant virus in culturing transgenic plants with reduced powdery mildew resistance.
The invention also provides application of the TaGLP-7A protein or nucleic acid molecule or recombinant vector or expression cassette or transgenic cell line or recombinant bacterium or recombinant virus in transgenic plants with improved powdery mildew resistance.
In the above application, the plant is a monocotyledonous plant or a dicotyledonous plant. The dicotyledonous plant may be arabidopsis thaliana (Arabidopsis thaliana), and the monocotyledonous plant may be wheat (Triticum aestivum l.), maize, or the like.
In a fourth aspect, the present invention provides a method of breeding transgenic plants with increased powdery mildew resistance.
The method for cultivating the transgenic plant with improved powdery mildew resistance comprises the steps of improving the expression quantity and/or activity of TaGLP-7A protein in a receptor plant to obtain the transgenic plant; the transgenic plant has a higher powdery mildew resistance than the recipient plant.
In the method, the method for improving the expression quantity and/or activity of TaGLP-7A protein in the receptor plant comprises the following steps: the TaGLP-7A protein is overexpressed in the recipient plant.
In the above method, the overexpression method is to introduce the coding gene of the TaGLP-7A protein into a receptor plant. Preferably, the nucleotide sequence of the coding gene of the TaGLP-7A protein is a DNA molecule shown in SEQ ID NO. 1.
According to the above method, the recipient plant is a monocot or dicot. The dicotyledonous plant may specifically be arabidopsis thaliana (Arabidopsis thaliana), the monocotyledonous plant may specifically be wheat (Triticum aestivum l.), maize, etc.
In a fifth aspect, the present invention provides a method of growing a transgenic plant with reduced powdery mildew resistance.
The method for cultivating the transgenic plant with reduced powdery mildew resistance comprises the steps of inhibiting the expression quantity and/or activity of TaGLP-7A protein in a receptor plant to obtain the transgenic plant; the transgenic plant has lower powdery mildew resistance than the recipient plant.
In the method, the method for inhibiting the expression quantity and/or activity of TaGLP-7A protein in the receptor plant comprises the following steps: introducing a substance that inhibits expression of the TaGLP-7A protein into a recipient plant to obtain a transgenic plant, wherein the transgenic plant has lower powdery mildew resistance than the recipient plant.
According to the above method, the recipient plant is a monocot or dicot. The dicotyledonous plant may specifically be arabidopsis thaliana (Arabidopsis thaliana), the monocotyledonous plant may specifically be wheat (Triticum aestivum l.), maize, etc.
The invention has the positive beneficial effects that:
the invention clones the germinating element-like gene with Cupin structural domain from wheat variety Bainong 207, names the germinating element-like gene as TaGLP-7A, constructs a virus-induced vector for silencing the TaGLP-7A gene in wheat, reduces the expression of the TaGLP-7A gene, obtains the silencing TaGLP-7A wheat, and shows obvious powdery mildew resistance reduction phenotype after the silencing TaGLP-7A wheat is inoculated with powdery mildew, which indicates that the expression of the TaGLP-7A gene in wheat in plants is inhibited by a silencing means, and the resistance of the wheat to powdery mildew can be reduced. Furthermore, the invention further bombards the common wheat hundred-nong 207 embryo by a gene gun method to obtain a transgenic strain stably and over-expressing the TaGLP-7A, and T of the transgenic strain over-expressing the TaGLP-7A is obtained 1 The powdery mildew resistance of the generation plants is identified, and the over-expression of TaGLP-7A is found to obviously improve the disease resistance of the transgenic plant line to the powdery mildew of wheat. The research results show that the TaGLP-7A gene positively regulates the wheat powdery mildew resistance, and the overexpression of the TaGLP-7A gene in wheat can improve the wheat powdery mildew resistance.
Drawings
FIG. 1 shows TaGLP-7A gene expression analysis at various time points after wheat powdery mildew inoculation of Bainong 207; wherein the abscissa represents the different time points (h: hours post inoculation) after infestation of Bainong 207 with the wheat powdery mildew mixed strain; the ordinate represents the relative expression level of the inoculated leaf TaGLP-7A gene;
FIG. 2 is a graph showing the results of detecting the expression level of TaGLP-7A gene in silencing TaGLP-7A wheat; wherein CK represents infected BSMV, gamma no-load control wheat plants; 1 and 2 each represent an infested BSMV, gamma-TaGLP-7A wheat plant;
FIG. 3 shows the phenotype of the VIGS-silenced wheat hundred-nong 207 gene. Wherein, BSMV gamma and BSMV TaGLP-7A respectively represent the phenotype of infection BSMV gamma empty load control and BSMV gamma TaGLP-7A plant leaf inoculation powdery mildew;
FIG. 4 is a schematic diagram of the schematic structure of TaGLP-7A over-expression vector PBI 220;
FIG. 5 shows a PBI220 TaGLP-7A transgenic plant T 0 Generation PCR identification; lane 1 is Marker DL2000 DNA standard molecular weight; lane 2 plasmid PBI220 TaGLP-7A positive control; lane 3 receptor bailout 207 negative control; lane 4 water control; lane 5TaGLP-7A-T 0 -42 negative control; lanes 6, 7, 8 are TaGLP-7A-T, respectively 0 -OE1、TaGLP-7A-T 0 -OE2、TaGLP-7A-T 0 Amplification results of OE3 positive transgenic plants;
FIG. 6 shows the TaGLP-7A gene in TaGLP-7A-T 1 -OE1、TaGLP-7A-T 1 -OE2、TaGLP-7A-T 1 -expression analysis in leaves of OE3 transgenic positive lines; wherein the qRT-PCR value is the expression level of TaTubulin as reference relative receptor material WT (wheat), CK represents transgenic negative control TaGLP-T 1 -42; * Represents a significant difference analysis by the one-way ANOVA LSD method (P<0.01)；
FIG. 7 is a T of TaGLP-7A transformed Bainong 207 1 Powdery mildew resistance identification results of the generation positive plants; wherein T is 1 -TaGLP-OE1 means TaGLP-7A positive line T 1 -OE1 strain resistance identification; t (T) 1 -TaGLP-7A-OE2 means TaGLP-7A positive line T 1 -OE2 strain resistance identification; T1-TaGLP-7A-OE3 represents the TaGLP-7A positive line T 1 -OE3 strain resistance identification; negative indicates the identification of the resistance of the transgenic Negative control strain.
Detailed Description
The following examples facilitate a better understanding of the present invention, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test reagents used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.
Embodiment one: cloning of TaGLP-7A Gene
1. cDNA acquisition
The wheat leaf total RNA is extracted by taking leaves of Bainong 207 (Bainong 207 is a good variety which integrates multiple good characters such as high yield, high quality, disease resistance, wide adaptability and the like and is obtained by traditional breeding through hybridization of Zhou Mai/Bainong 64 by Henan scientific college), wherein Bainong 207 shows high sense on powdery mildew in a seedling stage and resists the powdery mildew in a adult plant stage for 24 hours as raw materials according to the steps shown in the specification of a plant RNA extraction kit (Vazyme). The obtained RNA was subjected to reverse transcription with a primer having a polyT to obtain cDNA.
2. PCR amplification
And (2) using the cDNA obtained in the step (1) as a template, and using primers P1 and P2 designed according to the sequence of the TraesCS7A02G178300.1 transcript as primers, and performing PCR amplification by using high-fidelity enzyme to obtain a PCR amplification product, wherein the primer sequence is as follows:
primer P1:5'-CAGTAGCAAGCCATGGCCAA-3';
primer P2:5'-GAACTGCACAATTAGCCGCTGC-3'.
The PCR amplification reaction conditions described above: 95 ℃ for 5min; then 15s at 95 ℃, 15s at 56 ℃, 1min at 72 ℃ for 32 cycles; finally, the temperature is 72 ℃ for 5min.
3. Electrophoresis and sequencing
And (2) connecting the PCR amplification product obtained in the step (2) to a pMD-19T vector (TaKaRa) for sequencing, splicing the sequencing result by DNAman software to obtain the full length of the TaGLP-7A gene, and naming the gene as TaGLP-7A, wherein the ORF sequence of the TaGLP-7A gene is shown as SEQ ID NO.1, and the encoded amino acid sequence is shown as SEQ ID NO. 2.
Embodiment two: expression analysis of TaGLP-7A in Bainong 207
1. The experimental method comprises the following steps:
soaking seeds of common wheat material Bainong 207 in clear water at room temperature for 24 hours, pouring out liquid after the seeds are swelled, keeping the seeds moist at room temperature for 24 hours, and planting the seeds in a pot after the seeds are whitened. Growing in a light incubator with humidity of 70% at 18 ℃/10h,22 ℃/14 h. Culturing to a period of 2 leaves and a heart, carrying out infection treatment by using fresh powdery mildew spores, respectively taking wheat seedling leaves subjected to the infection treatment for 0h, 1h, 24h and 48h, quick-freezing in liquid nitrogen, and cutting 3 plant leaves at each time point. The leaf materials are respectively ground, total RNA is extracted, reverse transcription is carried out by using a kit HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wind) (Vazyme) to obtain cDNA, the cDNA is used as a template, taGLP-7A fragments are amplified by using a primer P3 (CAACACCAGCAACCTCATCA) and a primer P4 (GGTGACGAAGAGGAGCTCAG), the Tubulin fragments are amplified by using a TaTubulin inner reference primer, and the expression situation of TaGLP-7A is analyzed.
The PCR procedure was: the PCR reaction was amplified and fluorescence detected on a real-time fluorescent quantitative PCR instrument (Roche, germany). The 20uL PCR reaction contained 2X Taq Pro Universal SYBR qPCR Master Mix 10uL, 0.5. Mu.M primers P3 and P4, and 2uL of the cDNA template was reverse transcribed. The amplification reaction conditions were: 95℃for 5 minutes, then 95℃for 15 seconds and 60℃for 20 seconds for a total of 40 cycles. After the completion of the reaction, the melting curve was measured. The detection of gene expression levels was analyzed using sigma plot14 software.
2. Experimental results
The detection results of the real-time fluorescent quantitative PCR are shown in FIG. 1. As can be seen from fig. 1, in wheat bainong 207, tagp-7A was significantly up-regulated for 24 hours after induction by powdery mildew, and recovered to the original expression level after 48 hours. Therefore, the expression of the TaGLP-7A gene can respond to the induction of powdery mildew, and the expression level of the TaGLP-7A gene is increased when powdery mildew is infected.
Embodiment III: acquisition of silencing TaGLP-7A wheat and powdery mildew resistance research thereof
1. Obtaining of the Gene silencing fragment:
the pMD-18T vector containing ORF sequence of TaGLP-7A is used as a template, primers P5 and P6 (the P5 and P6 have SmaI restriction sites and 15bp complementary sequences with the vector) are used for PCR amplification, and a target gene fragment with the fragment length of 248bp is obtained and is named as TaGLP-7A (VIGS) and used for constructing a VIGS silencing vector.
Wherein, the nucleotide sequences of the above primers P5 and P6 are as follows:
P5：5’-TAGCTGAGCGGCCGCCCCGGGGGAACACCATGATGTCGCCCT-3’；
P6：5’-TAGCTGATTAATTAACCCGGGACACCAGCAACCTCATCAAGGC-3’。
the PCR amplification reaction system is as follows: 1. Mu.L of plasmid template (30 ng/. Mu.L), 2. Mu.L of upstream primer P5, 2. Mu.L of downstream primer P6, 25. Mu.L of PCR mix, and water was added to 50. Mu.L.
The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 10s, annealing at 55℃for 15s, extension at 72℃for 20s,30 cycles, extension at 72℃for 5min and storage at 4 ℃. The PCR amplification product was recovered after detecting the amplified band by 1.5% agarose gel electrophoresis.
2. Construction of the BSMV recombinant viral vector:
according to a conventional molecular biology method, the silencing fragment obtained in the step 1 is reversely inserted between SmaI cleavage sites of the BSMV-VIGS virus vector gamma by a homologous recombination method, and other sequences of the BSMV-VIGS virus vector gamma are kept unchanged, so that the recombinant vector gamma-TaGLP-7A is obtained.
3. BSMV-VIGS vector system:
the BSMV-VIGS viral vectors alpha, beta and gamma together form the viral vector system BSMV: gamma.
The BSMV-VIGS virus vectors alpha, beta and the recombinant vector gamma-TaGLP-7A together form a virus silencing vector system BSMV: gamma-TaGLP-7A capable of silencing the TaGLP-7A gene.
The BSMV-VIGS virus vectors alpha, beta and the vector gamma-PDS together form a virus silencing vector system BSMV: gamma-PDS capable of silencing the TaPDS gene, wherein the gamma-PDS is derived from Scofield Laboratory (Scofield et al 2005) and comprises 185bp conservative fragments of 185bp barley phytoene dehydrogenase gene (PDS), the virus silencing vector system BSMV, gamma-PDS can be used for positive control of gene silencing, whitening of plant leaves after gene silencing can be visually detected whether the silencing of the VIGS system is effective.
4. BSMV in vitro transcription:
(1) Linearization of a Carrier
The alpha chain, gamma chain, recombinant vector gamma-TaGLP-7A and recombinant vector gamma-PDS of the BSMV viral vector are digested by MluI, and beta chain of the BSMV viral vector is digested by SpeI to obtain linearization plasmids respectively.
(2) And (3) carrying out in vitro transcription by taking the linearized plasmid obtained in the step (1) as a template to respectively obtain viral vectors alpha, beta, gamma-TaGLP-7A and gamma-PDS which are transcribed into RNA in vitro. The in vitro transcription reaction was performed according to the instructions of mMESSAGEmMACHINE T7 in vitro transcription kit (Invitrogen). The transcription reaction system and conditions are respectively: the reaction population was 10.0. Mu.L, including 3. Mu.L of linearized plasmid, 10X Reaction Buffer 1. Mu.L, 2 XNTP/CAP 5. Mu.L, enzyme Mix 1. Mu.L, reacted in a PCR apparatus at 37℃for 2h and the transcripts were stored at-80℃for later use.
5. Wheat plant culture and BSMV inoculation
And selecting full Bainong 207 seeds, pouring out water in the culture dish after the seeds are swelled and absorbed for one day, keeping the seeds moist for one day, and selecting wheat seeds with consistent growth vigor after the seeds are exposed to white and sowing the wheat seeds in a pot. The wheat after sowing is placed in an illumination incubator for growth at the temperature of 12 ℃/10 ℃ for 14 hours illumination/10 hours darkness. Culturing for a period of time until the wheat grows to a half of a heart, and screening wheat hundred agriculture 207 with consistent growth when the second leaf is consistent with the first leaf. And (3) watering the wheat fully before virus inoculation, and smearing the BSMV gamma-TaGLP-7A recombinant virus vector solution on a second leaf of the wheat in a friction inoculation mode. The inoculated wheat is placed in an incubator at 23 ℃ and is kept for culturing for 24 hours in darkness, the plants are transferred to 23 ℃ after 24 hours, and grow under the condition of illumination for 14 hours/darkness for 10 hours, so that the infected BSMV gamma-TaGLP-7A plants (namely, the wheat plants for silencing the TaGLP-7A genes) are obtained.
And simultaneously, inoculating a part of plants with BSMV: gamma-PDS virus vector solution to obtain a BSMV: gamma-PDS transferred control plant, and inoculating a part of plants with BSMV: gamma virus vector solution to obtain a BSMV: gamma transferred empty load control plant.
The above BSMV: gamma-TaGLP-7A recombinant virus vector solution is prepared by mixing in vitro transcription products according to 10. Mu.L alpha, 10. Mu.L beta, 10. Mu.L gamma-TaGLP-7A and 225. Mu.L FES Buffer (0.1M glycine,0.06M K) 2 HP0 4 buffer containing 1%sodium pyrophosphate,1%macaloid,1%celite; pH to 8.5-9.0. 9.0 with phosphoric acid).
The above BSMV-. Gamma. -PDS viral vector solution is a solution obtained by mixing in vitro transcription products at a ratio of 10. Mu.L. Alpha., 10. Mu.L. Beta., 10. Mu.L. Gamma. -PDS and 225. Mu.L FES Buffer.
The above BSMV: gamma virus vector solution was obtained by mixing in vitro transcription products in a ratio of 10. Mu.L alpha, 10. Mu.L beta, 10. Mu.L gamma and 225. Mu.L FES Buffer.
6. Identification of silencing TaGLP-7A wheat
The experiment shows that the 4 th leaf of wheat inoculated with BSMV gamma-PDS virus vector solution positive control shows PDS albino phenotype after about 14 days after virus vector application, which indicates that the genes in the leaf of wheat in the period and the corresponding leaf age have been silenced. Therefore, the BSMV-VIGS system can be successfully applied to the gene silencing function research of wheat variety Bainong 207.
In order to further verify the effect of the BSMV-VIGS system in silencing the TaGLP-7A gene, the expression quantity is detected by utilizing fluorescent quantitative PCR, and the specific detection method is as follows: and (3) infecting a BSMV gamma-TaGLP-7A plant by applying the virus for 14 days, infecting a BSMV gamma empty-load control plant, cutting a fourth leaf with obvious barley streak mosaic virus symptoms, extracting total RNA, and detecting the relative expression quantity of the TaGLP-7A gene by real-time fluorescence quantitative PCR after reverse transcription. TaTubulin is taken as an internal reference gene, and 2 -ΔΔCt The method calculates the relative expression level. The primers used for detecting the expression level were the same as in example two.
The results of the detection of the relative expression level of TaGLP-7A gene are shown in FIG. 2. As shown in FIG. 2, the relative expression level of TaGLP-7A gene in the infected BSMV: gamma-TaGLP-7A plant is remarkably reduced compared with that in the infected BSMV: gamma empty control plant, which proves that the silencing sequence selected in the experiment is effective.
7. Powdery mildew resistance analysis of TaGLP-7A-silenced wheat
And (3) placing leaf segments of 4 th leaves of the infected BSMV: gamma-TaGLP-7A plants with effectively silenced TaGLP-7A genes and infected BSMV: gamma empty control plants on a 6-BA culture medium, inoculating fresh powdery mildew spores, and culturing for 6 days under the dark condition of 22 ℃/18 ℃ and 14h illumination/8 h. The phenotype was observed after 6 days and the results are shown in FIG. 3.
As can be seen from FIG. 3, the disease condition of the infected BSMV: gamma empty control plant 6 days after the inoculation of powdery mildew is obviously weaker than that of the infected BSMV: gamma-TaGLP-7A plant, a large amount of spore stacks are generated on the leaf surfaces of the infected BSMV: gamma-TaGLP-7A plant, and a small amount of spore stacks are generated on the BSMV: gamma of the control leaf. It was shown that silencing the TaGLP-7A gene in wheat Bainong 207 attenuated Bainong 207 resistance to powdery mildew.
Embodiment four: construction of TaGLP overexpression vector Pbi220:TaGLP-7A
The primer P7 was designed using pMD-18T vector containing the ORF sequence of TaGLP-7A as a template (GGAGAGAACACGGG)GGATCCATGGCCAACGCAATGCTGCTC, underlined are BamHI recognition base sequences) and P8 (AACGTCGTATGGGTAAGGCCTGCCGCTGCCGCCGAGCA, underlined is the StuI recognition base sequence) was amplified by PCR; wherein the primer P7 has BamHI cleavage site, the primer P8 has StuI cleavage site, and the PCR amplified fragment is recovered. The amplified product was inserted into the BamHI and StuI double digested vector pBI220 (Jefferson RA, kavanaghTA, bevanMW.GUSfusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J.1987,6: 3901-3907.) by homologous recombination, and TaGLP-7A was placed at the multiple cloning site behind the 35S promoter. Thus, the target gene TaGLP-7A is cloned to the downstream of the strong promoter 35S to obtain an expression vector pBI220:TaGLP-7A (the structure schematic diagram of which is shown in FIG. 4). Sequencing verification shows that the vector construction is successful.
Fifth embodiment: wheat plant acquisition of overexpressing TaGLP-7A
The over-expression pBI220:TaGLP-7A constructed in the example 4 is transferred into wheat callus of a seedling powdery mildew receptor Bainong 207 by using a gene gun transformation method to obtain an over-expression TaGLP-7A wheat plant.
The specific experimental steps are as follows:
(1) Pre-culturing about 2000 pieces of Bainong 207 immature embryo callus for 7 days, and pre-treating for 4-5 hours on a hypertonic culture medium (MS+ABA0.5 mg/L+500 mg/L+2,4-D2 mg/L+30 g/L+0.4mol/L mannitol of glucose, pH 5.8);
(2) The overexpression vector pBI220 carrying the target gene TaGLP-7A, taGLP-7A and pAHC 25 carrying bar marker are co-transformed into Bainong 207 callus by a gene gun bombardment method, and the culture is continued on a hypertonic culture medium for 16 hours after bombardment.
(3) Transfer the callus to recovery medium (1/2 MS+hydrolyzed casein 500mg/L+2,4-D2 mg/L+sucrose 30g/L, pH 5.8) for dark culture for 2 weeks;
(4) Transferring the callus treated in the step (3) to a screening culture medium containing herbicide (1/2MS+ABA0.5 mg/L+500 mg/L+2,4-D1 mg/L+30 g/L+4mg/LBialaphos of hydrolyzed casein, pH 5.8) for screening and culturing for 2 weeks;
(5) Transferring the callus with herbicide resistance obtained by screening in the step (4) into a differentiation medium (1/2MS+L-Gu Antai amine 1 mmol/L+hydrolyzed casein 200 mg/L+KT1mg/L+IAA 0.5 mg/L+sucrose 30 g/L+agar 0.8%, pH 5.8), differentiating, and transferring the callus into a rooting medium (1/2MS+KT 1 mg/L+sucrose 30 g/L+agar 0.8%, pH 5.8) when the differentiated bud grows to 2-4 cm.
(6) When the regenerated seedlings grow by about 8cm and the root system is stronger, the open-tube seedling hardening can be performed for 1-2 days, and finally the culture medium residues carried by the root system are washed off and can be transplanted into a pot. A total of 80 regenerated plants were obtained.
All regenerated plant genomic DNA was extracted and the regenerated plants were PCR amplified using promoter inner primer P9 (AGTGGAAAAGGAAGGTGGCT) and gene inner primer P10 (CATGATGTCGCCCTTGTAGAGC) to identify positive plants overexpressing TaGLP-7A.
The PCR reaction system is as follows: 100ng of genomic DNA template, 10. Mu.M each of P9 and P10 0.4. Mu.l; 5 μl2×mix;3.2 μl ddH 2 O. The PCR reaction conditions were: pre-denaturation at 95 ℃ for 5min; 15s at 95 ℃, 45s at 59 ℃, 50s at 72 ℃,26 cycles; extending at 72℃for 10min. The PCR products were detected by 1% agarose gel electrophoresis. Through PCR amplification detection, 3 regenerated plants can amplify target bands, and are identified as positive plants (marked as T) 0 Generation positive plants). FIG. 5 shows T 0 Screening of the part of the generation of positive plants, including T 0 -OE1、T 0 -OE2、T 0 -OE3。
Example six: identification of powdery mildew resistance of wheat plants over-expressing TaGLP-7A
Separately harvesting seeds of the T0 generation positive plants T0-OE1, T0-OE2 and T0-OE3 obtained by the TaGLP-7A transgenic T0 generation positive plants T0-OE1, T0-OE2 and T0-OE3 obtained by the fifth screening of the example, and harvesting the seeds of the T0 generation positive plants T0-OE1, T0-OE2 and T0-OE3Planting in pot to obtain T 1 -OE1 plants, T 1 -OE2 plants and T 1 -OE3 plants. qRT-PCR analysis is carried out on the extracted RNA of 3 identified positive strains in the period of two leaves and one heart, and the specific experimental method is the same as that in the second example, and the result shows that the TaGLP-7A positive strain T is found 1 -OE1 plants, T 1 -OE2 plants and T 1 Expression levels of OE3 plants were significantly higher than negative control T1-42 (fig. 6). For T in trefoil period 1 -OE1 plants, T 1 -OE2 plants and T 1 The OE3 plant is cut at the three-leaf one-heart period, the leaf segment of the 3 rd leaf is placed on a 6-BA culture medium, meanwhile, the disease receptor Bainong 207 and the transgenic negative plant are used as negative as control, and fresh powdery mildew spores are inoculated and cultured for 6 days under the dark condition of 22 ℃/18 ℃ and 14h illumination/8 h. The phenotype was observed 6 days after inoculation of powdery mildew spores, the results of which are shown in fig. 7.
As can be seen from fig. 7, the disease-sensitive control plant Bainong 207 and the transgenic negative control plant show high sense to powdery mildew, and the leaves are fully covered with powdery mildew spore piles; t (T) 1 -OE1 plants, T 1 -OE2 plants and T 1 Only small amounts of powdery mildew spores were present on the leaves of the OE3 plants. This demonstrates that compared to untransformed hundred-pesticide 207 and regeneration negative lines, the transgenic T 1 Positive plants (T) 1 -OE1 plants, T 1 -OE2 plants and T 1 -OE3 plants) powdery mildew resistance levels are significantly improved, T 1 -OE1 plants, T 1 -OE2 plants and T 1 Three lines of OE3 plants all showed disease resistance.
The above identification results show that: after the expression level of TaGLP-7A in the infected wheat plant is improved, the powdery mildew resistance of the infected wheat plant can be obviously improved, so that the gene can be used for cultivating powdery mildew resistant wheat by utilizing a genetic engineering means.
The above description is merely illustrative of the preferred embodiments of the present invention and is not intended to limit the invention to the particular embodiments disclosed, but on the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the invention.
Sequence listing
<110> academy of science and technology in Henan
<120> wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 639
<212> DNA
<213> Triticum aestivum
<400> 1
atggccaacg caatgctgct ccccgtgctc atctccttcc tcgtcctgcc cttctccgcc 60
ctggccctga cccaggactt ctgcgtcgcc gacctgtcct gcagcgacac gccggccggg 120
tacccgtgca agaccggcgt cggcgcgggg gacttctact accacggcct cgccgccgcg 180
ggcaacacca gcaacctcat caaggcggcc gtgaccccgg ccttcgtcgg ccagttcccc 240
ggcgtgaacg ggctcggcat ctccgcggcg aggctcgaca tcgccgtggg cggcgtcgtg 300
ccgctgcaca cccacccggc cgcctctgag ctcctcttcg tcaccgaggg caccatcctg 360
gcgggcttca tcagctcctc ctccaacacc gtgtacacca agacgctcta caagggcgac 420
atcatggtgt tcccccaggg cctgctccac taccagtaca acggcggcgg ctcggcagcg 480
gtggcgctcg ttgcgttcag cggccccaac cccggcctgc agatcactga ctacgcgctc 540
ttcgccaaca acctgccgtc cgccgtcgtt gagaaggtca ccttcttgga cgacgcgcag 600
gtgaagaagc tcaagtccgt gctcggcggc agcggctaa 639
<210> 2
<211> 212
<212> PRT
<213> Triticum aestivum
<400> 2
Met Ala Asn Ala Met Leu Leu Pro Val Leu Ile Ser Phe Leu Val Leu
1 5 10 15
Pro Phe Ser Ala Leu Ala Leu Thr Gln Asp Phe Cys Val Ala Asp Leu
20 25 30
Ser Cys Ser Asp Thr Pro Ala Gly Tyr Pro Cys Lys Thr Gly Val Gly
35 40 45
Ala Gly Asp Phe Tyr Tyr His Gly Leu Ala Ala Ala Gly Asn Thr Ser
50 55 60
Asn Leu Ile Lys Ala Ala Val Thr Pro Ala Phe Val Gly Gln Phe Pro
65 70 75 80
Gly Val Asn Gly Leu Gly Ile Ser Ala Ala Arg Leu Asp Ile Ala Val
85 90 95
Gly Gly Val Val Pro Leu His Thr His Pro Ala Ala Ser Glu Leu Leu
100 105 110
Phe Val Thr Glu Gly Thr Ile Leu Ala Gly Phe Ile Ser Ser Ser Ser
115 120 125
Asn Thr Val Tyr Thr Lys Thr Leu Tyr Lys Gly Asp Ile Met Val Phe
130 135 140
Pro Gln Gly Leu Leu His Tyr Gln Tyr Asn Gly Gly Gly Ser Ala Ala
145 150 155 160
Val Ala Leu Val Ala Phe Ser Gly Pro Asn Pro Gly Leu Gln Ile Thr
165 170 175
Asp Tyr Ala Leu Phe Ala Asn Asn Leu Pro Ser Ala Val Val Glu Lys
180 185 190
Val Thr Phe Leu Asp Asp Ala Gln Val Lys Lys Leu Lys Ser Val Leu
195 200 205
Gly Gly Ser Gly
210

Claims (4)

1. The application of the protein with the amino acid sequence shown as SEQ ID NO.2 or the nucleic acid molecule encoding the protein or the recombinant vector containing the nucleic acid molecule, the expression cassette or the recombinant bacteria in improving the powdery mildew resistance of plants;
or, the application of the protein with the amino acid sequence shown as SEQ ID NO.2 or the nucleic acid molecule encoding the protein or the recombinant vector, the expression cassette or the recombinant bacteria containing the nucleic acid molecule in cultivating transgenic plants with improved powdery mildew resistance;
wherein the sequence of the nucleic acid molecule is shown as SEQ ID NO.1, and the plant is wheat.
2. A method of growing a transgenic plant with increased powdery mildew resistance comprising the step of increasing the expression and/or activity of a protein in a recipient plant to obtain a transgenic plant; the transgenic plant has a powdery mildew resistance higher than the recipient plant; the amino acid sequence of the protein is shown as SEQ ID NO.2, and the plant is wheat.
3. The method of claim 2, wherein the method of increasing the expression and/or activity of the protein in the recipient plant is: the protein is overexpressed in the recipient plant.
4. A method according to claim 3, wherein the over-expression is by introducing a gene encoding the protein into a recipient plant.
CN202210579558.4A 2022-05-25 2022-05-25 Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof Active CN114835789B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210579558.4A CN114835789B (en) 2022-05-25 2022-05-25 Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210579558.4A CN114835789B (en) 2022-05-25 2022-05-25 Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN114835789A CN114835789A (en) 2022-08-02
CN114835789B true CN114835789B (en) 2023-12-22

Family

ID=82572206

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210579558.4A Active CN114835789B (en) 2022-05-25 2022-05-25 Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN114835789B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116240209B (en) * 2023-02-14 2024-02-02 南京农业大学 Enhancer strongly induced by powdery mildew in Chinese spring wheat and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103194457A (en) * 2013-04-24 2013-07-10 昆明理工大学 Lilium regale germin-like protein gene LrGLP2 and application thereof
CN104878019A (en) * 2015-05-14 2015-09-02 昆明理工大学 Yangbi walnut germin-like protein gene JsGLP1 and application thereof
CN107011421A (en) * 2017-05-25 2017-08-04 中国科学院遗传与发育生物学研究所 Wheat anti-powdery mildew GAP-associated protein GAP TaEDS1 A1 and its encoding gene and application
CN108164589A (en) * 2017-12-26 2018-06-15 中国农业大学 One kind is from cotton plant fungal disease resistance Protein G hGLP2 and its encoding gene and application
CN111424049A (en) * 2019-10-17 2020-07-17 河南科技学院 Application of gene TaPT13 in improving resistance of plants to powdery mildew

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103194457A (en) * 2013-04-24 2013-07-10 昆明理工大学 Lilium regale germin-like protein gene LrGLP2 and application thereof
CN104878019A (en) * 2015-05-14 2015-09-02 昆明理工大学 Yangbi walnut germin-like protein gene JsGLP1 and application thereof
CN107011421A (en) * 2017-05-25 2017-08-04 中国科学院遗传与发育生物学研究所 Wheat anti-powdery mildew GAP-associated protein GAP TaEDS1 A1 and its encoding gene and application
CN108164589A (en) * 2017-12-26 2018-06-15 中国农业大学 One kind is from cotton plant fungal disease resistance Protein G hGLP2 and its encoding gene and application
CN111424049A (en) * 2019-10-17 2020-07-17 河南科技学院 Application of gene TaPT13 in improving resistance of plants to powdery mildew

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
Deep transcriptome sequencing provides new insights into the structural and functional organization of the wheat genome;Lise Pingault等;《Genome Biology》;第16卷;文章编号: 29 *
GenBank Accession: XM_037611761.1.PREDICTED: Triticum dicoccoides germin-like protein 8-14 (LOC119339857), mRNA.《GenBank》.2020, *
GenBank Accession: XM_044572138.1.PREDICTED: Triticum aestivum germin-like protein 8-14 (LOC123152637), mRNA.《GenBank》.2021, *
PREDICTED: Triticum aestivum germin-like protein 8-14 (LOC123152637), mRNA;GenBank Accession: XM_044572138.1;《GenBank》 *
PREDICTED: Triticum dicoccoides germin-like protein 8-14 (LOC119339857), mRNA;GenBank Accession: XM_037611761.1;《GenBank》 *
Transient expression of members of the germin-like gene family in epidermal cells of wheat confers disease resistance;P Schweizer等;《The Plant Journal》;第20卷(第5期);第541-552页 *
白粉菌诱导的小麦类萌发素蛋白的克隆、定位及表达分析;王俊美等;《中国农业科学》;第42卷(第9期);第3104-3111页 *

Also Published As

Publication number Publication date
CN114835789A (en) 2022-08-02

Similar Documents

Publication Publication Date Title
CN109400688B (en) OsHAP2C and application of coding gene thereof in regulation and control of bacterial leaf blight resistance of rice
CN112226455B (en) Rice grain length and grain weight related protein, and coding gene and application thereof
CN111235165B (en) Lily susceptible fungal gene LrWRKY-S1 and application thereof
CN110804090B (en) Protein CkWRKY33 and coding gene and application thereof
CN115992153A (en) Wheat stem rot resistance gene TaP CS, encoding protein and application thereof
CN114276429B (en) Method for cultivating TaLRK-R gene-transferred wheat with resistance to sheath blight and stem base rot and related biological material thereof
CN114835789B (en) Wheat powdery mildew resistance related protein TaGLP-7A, and coding gene and application thereof
CN111944030A (en) Wheat stress resistance regulatory protein TaCOR58 and coding gene and application thereof
CN110066325B (en) Application of Os01g0144100 and coding gene thereof in regulating and controlling plant disease resistance
CN112062823B (en) GLK7 protein and application of encoding gene thereof in drought resistance of plants
CN114369147A (en) Application of BFNE gene in tomato plant type improvement and biological yield improvement
CN112250745B (en) MYB21 gene for regulating and controlling bacterial leaf blight resistance of rice and application thereof
CN108864265B (en) Application of protein TabZIP60 in regulation and control of plant root system development
CN111205357A (en) Wheat stripe rust resistance related protein TaWLT14.2 and coding gene and application thereof
CN107937358B (en) Related protein TaPaO1 for inducing pollen abortion of plants, and coding gene and application thereof
CN115976052A (en) Wheat stem basal rot resistance gene TaHSP18.6, expression product, recombinant vector and application thereof
CN109535236B (en) Heme binding protein gene TaHBP1, recombinant interference vector and application thereof
CN106834248B (en) Gene TaABC1-2 with ABC1-like kinase structural domain and application thereof
CN110923214A (en) Method for breeding disease-resistant transgenic TaM2K wheat and related biological material thereof
KR100682129B1 (en) 1 OsCK1 GENE FROM ORYZA SATIVA EXPRESSION VECTOR COMPRISING THE GENE TRANSFORMANTS TRANSFORMED WITH THE VECTOR AND PRODUCTION METHOD OF THE TRANSFORMANTS
CN111454987B (en) Application of GhNAC091 gene in improving plant photosynthesis efficiency and strong light tolerance
CN115215931B (en) Use of protein IbC H18 related to vine cutting disease and soft rot disease or substance for regulating and controlling expression of protein IbC H18
CN115873085B (en) Application of soybean gene GmMAX2a in plant stress resistance
CN112592392B (en) Application of pleiotropic gene SbSnf4 in improvement of cane sugar yield, plant height, fresh weight of stems and/or juice amount
CN115927309B (en) China rose root specific expression promoter proRcPRX10 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant