CN114835789A

CN114835789A - Wheat powdery mildew resistance associated protein TaGLP-7A and coding gene and application thereof

Info

Publication number: CN114835789A
Application number: CN202210579558.4A
Authority: CN
Inventors: 李成伟; 胡平; 任月明; 宋普文; 陶烨; 未志源
Original assignee: Henan Institute of Science and Technology
Current assignee: Henan Institute of Science and Technology
Priority date: 2022-05-25
Filing date: 2022-05-25
Publication date: 2022-08-02
Anticipated expiration: 2042-05-25
Also published as: CN114835789B

Abstract

The invention belongs to the technical field of biology, and discloses a wheat powdery mildew resistance-related protein TaGLP-7A, and a coding gene and application thereof. The invention relates to a new gene cloned from a wheat variety Bainong 207GLPGene, its name isTaGLP‑7A. The invention is used for silencing wheat by constructionTaGLP‑7AGenetic induction of barley mosaic virusConductive carrier, reductionTaGLP‑7AExpression of genes to be silencedTaGLP‑7AWheat plant, silencingTaGLP‑7AAfter wheat is inoculated with powdery mildew, the powdery mildew resistance is obviously reduced. Moreover, the present invention further constructs overexpressionTaGLP‑7AStably genetically transformed wheat plants, over-expressionTaGLP‑7AThe level of powdery mildew resistance of wheat plants was significantly increased, thus demonstrating thatTaGLP‑7AAfter the expression quantity in the susceptible wheat plant is increased, the powdery mildew resistance of the susceptible wheat plant can be obviously improved, so that the gene can be used for cultivating powdery mildew resistant wheat by utilizing a genetic engineering means.

Description

Wheat powdery mildew resistance associated protein TaGLP-7A and coding gene and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a wheat powdery mildew resistance related protein TaGLP-7A and a coding gene and application thereof.

Background

Wheat (Triticum aestivum L.) is the main source of human food heat, and china is the first major country of wheat planting and yield, and plays an important role in guaranteeing domestic food safety. Wheat powdery mildew is a worldwide disease caused by the vital obligate parasitic fungus wheat powdery mildew (Blumeria graminis f.sp.tritici), which usually results in 13-34% of yield loss, 50% of yield loss when the disease is serious in heading and filling stages, and dry leaves and even plant death in some extreme disease cases. Along with the virulence structure variation of pathogenic bacteria, climate change and the implementation of certain farming modes, the incidence proportion of wheat powdery mildew in winter wheat areas in China is increased year by year, and the wheat powdery mildew tends to move from east to north.

The cultivation of resistant varieties is one of the most economical, effective and environment-friendly methods for reducing the loss of wheat powdery mildew, only a few disease-resistant genes such as Pm2, Pm3, Pm4, Pm6, Pm8, Pm21 and the like have been applied to large area in Chinese wheat production since the breeding of powdery mildew resistance in the last century, and the resistance of most of the specialized disease-resistant genes of the races has been continuously overcome by new toxic races, so that the application value in production is gradually lost, and the broad-spectrum powdery mildew-resistant genes widely applied in actual production are not many. Therefore, it is urgent to develop new durable broad-spectrum high-resistance genes and explore new ways for breeding wheat to resist powdery mildew to improve the durable broad-spectrum resistance of wheat to powdery mildew.

Germin-like proteins (GLPs) belong to CMembers of the upin superfamily, often consisting of two exons and one intron, encode proteins that contain about 220 amino acids and a conserved Cupin domain at the C-terminus. GLPs play an important role in response to plant defense, and some of them have oxalate oxidase (OXO) or superoxide dismutase (SOD) activity, which catalyze H production from oxalic acid or the like ₂ O ₂ Promote crosslinking of cell walls at sites of pathogenic infection, H ₂ O ₂ The protein can also activate a series of signal transduction pathways related to plant defense as an important intracellular signal to prevent the invasion of pathogenic bacteria. Research shows that peanut AhGLP shows a unique response mode to the stresses of aspergillus flavus, mosaic disease, rust disease and the like; GhABP19 in upland cotton plays an important role in regulating the resistance of cotton to verticillium wilt; the rice which over-expresses OsGLP2-1 has obviously enhanced resistance to rice blast and bacterial blight. The research shows that GLP genes play an important role in plant disease resistance, but the cloning and function research of the GLP genes in wheat powdery mildew research has few relevant reports.

Disclosure of Invention

Aiming at the problems and the defects in the prior art, the invention aims to provide a wheat powdery mildew resistance related protein TaGLP-7A, a coding gene and application thereof.

In a first aspect, the present invention provides a protein.

The protein provided by the invention is derived from Triticum aestivum L, is named TaGLP-7A and is a protein of the following a) or b) or c) or d):

a) the amino acid sequence is protein shown as SEQ ID NO. 2;

b) a fusion protein obtained by connecting a label to the N end and/or the C section of the protein shown in SEQ ID NO. 2;

c) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 2;

d) protein with 85% or more than 85% homology with the amino acid sequence shown in SEQ ID NO.2 and with the same function.

Wherein SEQ ID NO.2 consists of 212 amino acid residues.

In order to facilitate the purification of the protein in a), the amino terminus or the carboxyl terminus of the protein shown in SEQ ID NO.2 of the sequence Listing may be attached with a tag as shown in Table 1.

TABLE 1 sequences of tags

Label (R)	Residue(s) of	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	2-10 (generally 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

The protein of c) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The protein in the c) can be artificially synthesized, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene encoding the protein of c) above can be obtained by deleting one or several nucleotide codons from the DNA sequence shown in SEQ ID NO.1, and/or by performing missense mutation of one or several base pairs, and/or by attaching the coding sequence of the tag shown in Table 1 above to the 5 'end and/or 3' end thereof.

In a second aspect, the invention provides a nucleic acid molecule encoding a TaGLP-7A protein.

The coding sequence of the nucleic acid molecule is shown as SEQ ID NO. 1.

In a third aspect, the present invention provides a recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus comprising the nucleic acid molecule of the second aspect.

In a third aspect, the present invention provides a novel use of the protein of the first aspect or the nucleic acid molecule of the second aspect or the recombinant vector or expression cassette of the third aspect or the transgenic cell line or recombinant bacterium or recombinant virus.

The invention provides application of the TaGLP-7A protein or nucleic acid molecule or recombinant vector or expression cassette or transgenic cell line or recombinant bacterium or recombinant virus in regulation and control of powdery mildew resistance of plants.

The invention also provides application of the TaGLP-7A protein or the nucleic acid molecule or the recombinant vector or the expression cassette or the transgenic cell line or the recombinant bacterium or the recombinant virus in the first aspect in cultivating transgenic plants with reduced powdery mildew resistance.

The invention also provides application of the TaGLP-7A protein or the nucleic acid molecule or the recombinant vector or the expression cassette or the transgenic cell line or the recombinant bacterium or the recombinant virus in the first aspect in transgenic plants with improved powdery mildew resistance.

In the above application, the plant is a monocotyledon or a dicotyledon. The dicotyledonous plant may be Arabidopsis (Arabidopsis thaliana), and the monocotyledonous plant may be wheat (Triticum aestivum L.), maize, or the like.

In a fourth aspect, the present invention provides a method of breeding transgenic plants with improved resistance to powdery mildew.

The method for cultivating the transgenic plant with improved powdery mildew resistance comprises the steps of improving the expression quantity and/or activity of TaGLP-7A protein in a receptor plant to obtain the transgenic plant; the transgenic plant has a higher powdery mildew resistance than the recipient plant.

In the above method, the method for increasing the expression level and/or activity of a TaGLP-7A protein in a recipient plant comprises: overexpresses a TaGLP-7A protein in a recipient plant.

In the above method, the overexpression is carried out by introducing a gene encoding the TaGLP-7A protein into a recipient plant. Preferably, the nucleotide sequence of the coding gene of the TaGLP-7A protein is a DNA molecule shown in SEQ ID NO. 1.

According to the above method, the recipient plant is a monocotyledonous plant or a dicotyledonous plant. The dicotyledonous plant may be specifically Arabidopsis thaliana (Arabidopsis thaliana), and the monocotyledonous plant may be specifically wheat (Triticum aestivum L.), corn, and the like.

In a fifth aspect, the present invention provides a method of breeding transgenic plants with reduced resistance to powdery mildew.

The method for cultivating the transgenic plant with reduced powdery mildew resistance comprises the steps of inhibiting the expression quantity and/or activity of TaGLP-7A protein in a receptor plant to obtain the transgenic plant; the transgenic plant has lower powdery mildew resistance than the recipient plant.

In the above method, the method for inhibiting the expression level and/or activity of a TaGLP-7A protein in a recipient plant comprises: introducing a substance inhibiting the expression of a TaGLP-7A protein into a recipient plant to obtain a transgenic plant, wherein the transgenic plant has lower powdery mildew resistance than the recipient plant.

The invention has the following positive beneficial effects:

the invention clones a germinal-like gene with a Cupin structure domain from a wheat variety Bainong 207, names the germinal-like gene as TaGLP-7A, constructs a virus-induced vector for silencing the TaGLP-7A gene in wheat, reduces the expression of the TaGLP-7A gene, obtains the silenced TaGLP-7A wheat, and after the silenced TaGLP-7A wheat is inoculated with erysiphe necator, wheat plants show an obvious powdery mildew resistance reduction phenotype, which shows that the expression of the TaGLP-7A gene in the wheat in the plants can be inhibited by a silencing means, and the powdery mildew resistance of the wheat can be reduced. Furthermore, the invention further bombards the common wheat Bainong 207 immature embryo by a gene gun method to obtain a transgenic line stably over-expressing TaGLP-7A, and the T of the transgenic line over-expressing TaGLP-7A ₁ The generation plants are subjected to powdery mildew resistance identification, and the fact that the overexpression TaGLP-7A can obviously improve the disease resistance of a transgenic line to wheat powdery mildew is found. The research results show that the TaGLP-7A gene positively regulates the powdery mildew resistance of wheat, and the over-expression of the TaGLP-7A gene in wheat can improve the powdery mildew resistance of wheat.

Drawings

FIG. 1 shows TaGLP-7A gene expression analysis at different time points after Bainong 207 is inoculated with wheat powdery mildew; wherein the abscissa represents different time points (h: hours post infection) after the Bainong 207 is infected by the mixed strain of wheat powdery mildew; the ordinate represents the relative expression quantity of TaGLP-7A genes of inoculated leaves;

FIG. 2 is a diagram showing the results of detecting the expression level of TaGLP-7A gene in TaGLP-7A silenced wheat; wherein CK represents the infection of BSMV, gamma no-load control wheat plant; 1 and 2 both represent infected BSMV-Gamma-TaGLP-7A wheat plants;

FIG. 3 shows the phenotype of VIGS silencing wheat Bainong 207 gene. Wherein, BSMV gamma and BSMV TaGLP-7A respectively represent the phenotype of infecting BSMV gamma no-load contrast and inoculating powdery mildew on the leaves of BSMV gamma-TaGLP-7A plants;

FIG. 4 is a diagram of map structure of TaGLP-7A over-expression vector PBI220: TaGLP-7A;

FIG. 5 shows a PBI220 TaGLP-7A transgenic plant T ₀ Performing PCR identification; lane 1 is Marker DL2000 DNA standard molecular weight; lane 2 plasmid PBI220 TaGLP-7A positive control; lane 3 receptor bainong 207 negative control; lane 4 water control; lane 5TaGLP-7A-T ₀ -42 negative control; lanes 6, 7, 8 are TaGLP-7A-T, respectively ₀ -OE1、TaGLP-7A-T ₀ -OE2、TaGLP-7A-T ₀ -amplification results of OE3 positive transgenic plants;

FIG. 6 shows that TaGLP-7A gene is in TaGLP-7A-T ₁ -OE1、TaGLP-7A-T ₁ -OE2、TaGLP-7A-T ₁ -analysis of expression in leaves of OE3 transgenic positive lines; wherein the value of qRT-PCR is the expression quantity of TaTubulin as an internal reference relative receptor material WT (wheat), CK represents a transgenic negative control TaGLP-T ₁ -42; means significant difference analysis by one-way ANOVA LSD method (P)<0.01)；

FIG. 7 shows TaGLP-7A T transformed into Bainong 207 ₁ Identifying the resistance of the generation positive plants to powdery mildew; wherein, T ₁ -TaGLP-OE1 represents a TaGLP-7A positive strain T ₁ -identification of resistance of strain OE 1; t is ₁ -TaGLP-7A-OE2 represents a TaGLP-7A positive strain T ₁ -identification of resistance of strain OE 2; T1-TaGLP-7A-OE3 shows TaGLP-7A positive strain T ₁ -identification of resistance of strain OE 3; negative represents the resistance identification of the transgenic Negative control strain.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test reagents used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The first embodiment is as follows: cloning of TaGLP-7A Gene

1. Obtaining of cDNA

Bainong 207 (Bainong 207 is a good variety which is bred by Zhongmai 16/Bainong 64 hybridization through traditional breeding and integrates various good properties such as high yield, goodness, disease resistance and eurytoplasm, etc., Bainong 207 is highly sensitive to powdery mildew in the seedling stage and resistant in the adult stage) is used as a raw material, and the total RNA of the wheat leaf is extracted according to the steps shown in the instruction book of a plant RNA extraction kit (Vazyme). The resulting RNA was reverse-transcribed with a primer carrying polyT to obtain cDNA.

2. PCR amplification

Carrying out PCR amplification by using the cDNA obtained in the step 1 as a template and primers P1 and P2 designed according to the sequence of a Traes CS7A02G178300.1 transcript as primers and high fidelity enzyme to obtain a PCR amplification product, wherein the sequences of the primers are as follows:

primer P1: 5'-CAGTAGCAAGCCATGGCCAA-3', respectively;

primer P2: 5'-GAACTGCACAATTAGCCGCTGC-3' are provided.

The PCR amplification reaction conditions are as follows: 5min at 95 ℃; then, the temperature is 95 ℃ for 15s, 56 ℃ for 15s, and 72 ℃ for 1min, and 32 cycles are carried out; finally 5min at 72 ℃.

3. Electrophoresis and sequencing

And (2) connecting the PCR amplification product obtained in the step (2) to a pMD-19T vector (TaKaRa) for sequencing, splicing the sequencing result through DNAman software to obtain the full length of the TaGLP-7A gene, wherein the ORF sequence of the TaGLP-7A gene is shown as SEQ ID No.1, and the coded amino acid sequence is shown as SEQ ID No. 2.

Example two: expression analysis of TaGLP-7A in Bainong 207

1. The experimental method comprises the following steps:

soaking seeds of common wheat material Bainong 207 in clear water at room temperature for 24 hours, pouring out liquid after the seeds are swelled, keeping the seeds moist at room temperature for 24 hours, and planting the seeds in a basin after white exposure. The growth is carried out in a light incubator with 18 ℃/10h,22 ℃/14h and 70% humidity. Culturing to 2 leaves and one heart stage, carrying out infection treatment by using fresh powdery mildew spores, quickly freezing wheat seedling leaves which are subjected to infection treatment for 0h, 1h, 24h and 48h in liquid nitrogen, and shearing 3 plant leaves at each time point. The leaf materials were ground separately to extract total RNA, and then reverse-transcribed with HiScript III 1st Strand cDNA Synthesis Kit (+ gDNA wiper) (Vazyme) to obtain cDNA, and TaGLP-7A fragment was amplified using the cDNA as a template using primer P3(CAACACCAGCAACCTCATCA) and primer P4(GGTGACGAAGAGGAGCTCAG), and TaTubulin fragment was amplified using TaTubulin internal reference primer to analyze the expression of TaGLP-7A.

The PCR procedure was: the PCR reaction was amplified and fluorescence detected on a real-time fluorescent quantitative PCR instrument (Roche, Germany). The 20uL PCR reaction system contained 2 XTaq Pro Universal SYBR qPCR Master Mix 10uL, 0.5. mu.M primers P3 and P4, and reverse transcription cDNA template 2 uL. The amplification reaction conditions are as follows: 5 minutes at 95 ℃ followed by 15 seconds at 95 ℃ and 20 seconds at 60 ℃ for 40 cycles. After the reaction was completed, the melting curve was measured. The gene expression level was analyzed by sigmaplot14 software.

2. Results of the experiment

The results of real-time fluorescent quantitative PCR are shown in FIG. 1. As can be seen from figure 1, in Bainong 207 wheat, TaGLP-7A is significantly up-regulated and expressed 24h after being induced by powdery mildew, and is restored to the original expression level 48h later. Therefore, the TaGLP-7A gene expression can respond to the induction of powdery mildew, and the TaGLP-7A gene expression level is increased when powdery mildew is infected.

Example three: obtaining of wheat with silent TaGLP-7A and powdery mildew resistance research thereof

1. Obtaining of gene silencing fragment:

taking a pMD-18T vector containing an ORF sequence of TaGLP-7A as a template, carrying out PCR amplification by using primers P5 and P6(P5 and P6 carry SmaI restriction enzyme sites and 15bp and a vector complementary sequence) to obtain a target gene fragment with the fragment length of 248bp, and recording the target gene fragment as TaGLP-7A (VIGS) for constructing a VIGS silencing vector.

Wherein, the nucleotide sequences of the primers P5 and P6 are as follows:

P5：5’-TAGCTGAGCGGCCGCCCCGGGGGAACACCATGATGTCGCCCT-3’；

P6：5’-TAGCTGATTAATTAACCCGGGACACCAGCAACCTCATCAAGGC-3’。

the PCR amplification reaction system is as follows: mu.L plasmid template (30 ng/. mu.L), 2. mu.L forward primer P5, 2. mu.L reverse primer P6, 25. mu.L PCR mix, water to 50. mu.L.

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 deg.C for 10s, annealing at 55 deg.C for 15s, extension at 72 deg.C for 20s, 30 cycles, re-extension at 72 deg.C for 5min, and storage at 4 deg.C. The PCR amplification product is recovered after detecting the amplified band by 1.5% agarose gel electrophoresis.

2. Construction of the BSMV recombinant viral vector:

and (2) reversely inserting TaGLP-7A (VIGS) into Sma I enzyme cutting sites of the BSMV-VIGS virus vector gamma by the silent fragment obtained in the step 1 through a homologous recombination method according to a conventional molecular biology method, and keeping other sequences of the BSMV-VIGS virus vector gamma unchanged to obtain a recombinant vector gamma-TaGLP-7A.

3. BSMV-VIGS vector system:

the BSMV-VIGS viral vectors alpha, beta and gamma vectors together constitute the viral vector system BSMV gamma.

The BSMV-VIGS virus vectors alpha and beta and the recombinant vector gamma-TaGLP-7A jointly form a virus silencing vector system BSMV, gamma-TaGLP-7A capable of silencing TaGLP-7A genes.

The BSMV-VIGS virus vectors alpha and beta and the vector gamma-PDS jointly form a virus silencing vector system BSMV, gamma-PDS capable of silencing TaPDS genes, wherein the gamma-PDS is derived from Scofield Laboratory (Scofield et al 2005), comprises 185bp conserved segments of 185bp barley phytoene dehydrogenase genes (PDS), can be used for positive control of gene silencing, and can visually detect whether the silencing of the VIGS system is effective or not due to the fact that plant leaves have a whitening phenomenon after the gene silencing.

4. BSMV in vitro transcription:

(1) linearization of vectors

Mlu I is used for enzyme digestion of a BSMV virus vector alpha chain, a BSMV virus vector gamma chain, a recombinant vector gamma-TaGLP-7A and a recombinant vector gamma-PDS, and SpeI is used for enzyme digestion of a BSMV virus vector beta chain, so that linearized plasmids are obtained respectively.

(2) And (2) carrying out in vitro transcription by using the linearized plasmid obtained in the step (1) as a template to respectively obtain virus vectors alpha, beta, gamma-TaGLP-7A and gamma-PDS which are transcribed into RNA in vitro. The in vitro transcription reaction was performed according to the instructions of mMESSAGENMAXINE T7 in the vitro transcription kit (Invitrogen). The transcription reaction system and conditions were respectively: the total Reaction system is 10.0 mu L, comprises 3 mu L of linearized plasmid, 1 mu L of 10X Reaction Buffer, 5 mu L of 2X NTP/CAP and 1 mu L of Enzyme Mix, and is reacted for 2h at 37 ℃ in a PCR instrument, and the transcription product is stored at-80 ℃ for later use.

5. Culture and BSMV inoculation of wheat plants

Selecting full Bainong 207 seeds, sucking water in a culture dish for one day, pouring out the water in the culture dish, washing the seeds clean, keeping the seeds wet for one day, and selecting wheat seeds with consistent growth vigor to be sown in a pot after the seeds are whitened. The wheat after sowing is placed in a light incubator to grow at the temperature of 12 ℃/10 ℃ for 14h light/10 h dark. Culturing for a period of time until the wheat grows to have two leaves and one heart, and screening the wheat Bainong 207 with consistent growth when the second leaf is consistent with the first leaf. Before inoculation of the virus, wheat is watered sufficiently, and the BSMV, gamma-TaGLP-7A recombinant virus vector solution is smeared on a second blade of the wheat in a friction inoculation mode. And (3) placing the inoculated wheat in an incubator at 23 ℃, keeping dark culture for 24 hours, after 24 hours, converting the plant into 23 ℃, and growing under the conditions of 14 hours of light/10 hours of dark to obtain a plant infecting BSMV, namely gamma-TaGLP-7A (namely the wheat plant silencing TaGLP-7A gene).

Meanwhile, a part of the plants are inoculated with the BSMV-gamma-PDS virus carrier solution to obtain the BSMV-gamma-PDS transformed control plants, and a part of the plants are inoculated with the BSMV-gamma virus carrier solution to obtain the BSMV-gamma transformed no-load control plants.

The BSMV-Gamma-TaGLP-7A recombinant virus vector solution is prepared by mixing in vitro transcription products according to the ratio of 10 mu L alpha, 10 mu L beta, 10 mu L Gamma-TaGLP-7A and 225 mu L FES Buffer (0.1M glycine,0.06M K) ₂ HP0 ₄ buffer stabilizing 1% sodium pyrophosphate, 1% macroloid, 1% celite; pH to 8.5-9.0 with phosphoric acid).

The above BSMV-. gamma. -PDS virus vector solution is a solution obtained by mixing in vitro transcription products at a ratio of 10. mu.L. alpha., 10. mu.L. beta., 10. mu.L. gamma. -PDS, and 225. mu.L FES Buffer.

The above-mentioned BSMV-gamma virus vector solution is obtained by mixing in vitro transcription products in a ratio of 10. mu.L of alpha, 10. mu.L of beta, 10. mu.L of gamma and 225. mu.L of FES Buffer.

6. Identification of wheat silenced TaGLP-7A

In the experiment, after the virus vector is smeared for about 14 days, the 4 th leaf of the wheat inoculated with BSMV, gamma-PDS virus vector solution positive control shows PDS albino phenotype, which indicates that the genes in the wheat leaves in the period and corresponding leaf age are silenced. Therefore, the BSMV-VIGS system can be successfully applied to the gene silencing function research of the wheat variety Bainong 207.

In order to further verify the effect of silencing TaGLP-7A gene by the BSMV-VIGS system, the expression level of the TaGLP-7A gene is detected by using fluorescent quantitative PCR, and the specific detection method comprises the following steps: infecting BSMV-Gamma TaGLP-7A plants for 14 days by smearing viruses, infecting BSMV-Gamma no-load control plants, cutting fourth leaves with obvious symptoms of barley streak mosaic viruses to extract total RNA, and detecting the relative expression quantity of the TaGLP-7A gene by real-time fluorescent quantitative PCR after reverse transcription. TaTubulin is used as an internal reference gene and passes through 2 ^-ΔΔCt The method calculates the relative expression amount. The primers used for detecting the expression level were the same as in example two.

The results of measuring the relative expression level of the TaGLP-7A gene are shown in FIG. 2. As can be seen from FIG. 2, the relative expression level of TaGLP-7A gene in the BSMV gamma-TaGLP-7A infected plant is significantly reduced compared with that of the BSMV gamma no-load control infected plant, which indicates that the silencing sequence selected in the experiment is effective.

7. Powdery mildew resistance analysis of TaGLP-7A-silenced wheat

Placing the leaf segment of the 4 th leaf of the infected BSMV gamma-TaGLP-7A plant and the infected BSMV gamma no-load control plant which effectively silence the TaGLP-7A gene on a 6-BA culture medium, and inoculating fresh powdery mildew spores to culture for 6 days under the conditions of 22 ℃/18 ℃, 14h illumination/8 h dark. The phenotype was observed after 6 days, and the results are shown in FIG. 3.

As can be seen from FIG. 3, the disease condition of the infected BSMV gamma no-load control plant 6 days after the inoculation of powdery mildew is obviously weaker than that of the infected BSMV gamma-TaGLP-7A plant, a large amount of spore piles are generated on the surface of the leaf blade of the infected BSMV gamma-TaGLP-7A plant, and a small amount of spore piles are generated on the BSMV gamma control leaf. The fact that the resistance of Bainong 207 to powdery mildew is weakened after the TaGLP-7A gene is silenced in Bainong 207 of common wheat is shown.

Example four: construction of TaGLP over-expression vector Pbi220: TaGLP-7A

Takes pMD-18T vector containing TaGLP-7A ORF sequence as template, designs primer P7 (GGAGAGAACACGGG)GGATCCATGGCCAACGCAATGCTGCTC, BamHI recognition base sequence underlined) and P8 (AACGTCGTATGGGTA)AGGCCTGCCGCTGCCGCCGAGCA, StuI recognition base sequence underlined) was subjected to PCR amplification; wherein the primer P7 has a BamHI restriction site, the primer P8 has a StuI restriction site, and PCR amplified fragments are recovered. The amplified product was inserted into vector pBI220(Jefferson RA, Kavanagh, BevanmW. GUSES: beta-glucuronidase as a sensitive and versatic gene fusion marker in highher plants. EMBO J.1987,6:3901-3907.) double-digested with BamHI and StuI by homologous recombination, and TaGLP-7A was placed at the multiple cloning site behind the 35S promoter. Thus, the target gene TaGLP-7A is cloned to the downstream of the strong promoter 35S, and the expression vector pBI220: TaGLP-7A (the structural schematic diagram is shown in figure 4) is obtained. Sequencing verification shows that the vector construction is successful.

Example five: over-expressed TaGLP-7A wheat plant harvest

The overexpression pBI220: TaGLP-7A constructed in the embodiment 4 is transferred into wheat callus of a seedling powdery mildew receptor Bainong 207 by using a gene gun transformation method to obtain an overexpression TaGLP-7A wheat plant.

The specific experimental steps are as follows:

(1) picking about 2000 Bainong 207 young embryo callus tissues which are pre-cultured for 7 days, and pre-treating the callus tissues on a hypertonic culture medium (MS + ABA0.5mg/L + 500mg/L +2,4-D2mg/L + 30g/L +0.4mol/L mannitol, pH5.8) for 4 to 5 hours;

(2) the overexpression vector pBI220 of TaGLP-7A carrying the target gene TaGLP-7A and the pAHC 25 vector carrying the bar marker are co-transformed into the Bainong 207 callus by a gene gun bombardment method, and the Bainong 207 callus is continuously cultured on a hypertonic culture medium for 16 hours after bombardment.

(3) Transferring the callus to a recovery medium (1/2MS + 500mg/L casein hydrolysate +2,4-D2mg/L + 30g/L sucrose, pH5.8) for dark culture for 2 weeks;

(4) transferring the callus treated in the step (3) to a screening culture medium containing herbicide (1/2MS + ABA0.5mg/L + casein hydrolysate 500mg/L +2,4-D1mg/L + sucrose 30g/L +4 mg/LBialphos, pH5.8) for screening culture for 2 weeks;

(5) transferring the callus with herbicide resistance obtained by screening in the step (4) into a differentiation medium (1/2MS + L-glutamine 1mmol/L + hydrolyzed casein 200mg/L + KT 1mg/L + IAA 0.5mg/L + sucrose 30g/L + agar 0.8%, pH 5.8%) for differentiation, and transferring the callus into a rooting medium (1/2MS + KT 1mg/L + sucrose 30g/L + agar 0.8%, pH 5.8%) when a differentiated bud grows to 2-4 cm.

(6) When the regenerated seedlings grow about 8cm and the root systems are robust, the seedlings can be acclimatized for 1-2 days, and finally the culture medium residues carried by the root systems are washed off and transplanted into pots. A total of 80 regenerated plants were obtained.

Extracting genome DNA of all regeneration plants, and performing PCR amplification on the regeneration plants by using a promoter internal primer P9(AGTGGAAAAGGAAGGTGGCT) and a gene internal primer P10(CATGATGTCGCCCTTGTAGAGC) to identify positive plants over-expressing TaGLP-7A.

The PCR reaction system is as follows: 100ng of genomic DNA template, 10. mu.M of each of P9 and P10 in 0.4. mu.l; 5 μ l of 2 × mix; 3.2. mu.l of ddH ₂ And O. The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; 95 ℃ for 15s, 59 ℃ for 45s, 72 ℃ for 50s, 26 cycles; extension at 72 ℃ for 10 min. The PCR product was detected by electrophoresis on a 1% agarose gel. PCR amplification detection shows that 3 regenerated plants can amplify target bands and are identified as positive plants (marked as T) ₀ Generation positive plants). FIG. 5 shows T ₀ Selection of generation positive plants, including T ₀ -OE1、T ₀ -OE2、T ₀ -OE3。

Example six: identification of powdery mildew resistance of over-expressed TaGLP-7A wheat plant

Seeds of TaGLP-7A transgenic T0 positive plants T0-OE1, T0-OE2 and T0-OE3 obtained by screening in the fifth embodiment are respectively harvested, and seeds of the harvested T0 positive plants T0-OE1, T0-OE2 and T0-OE3 are planted in a pot to obtain T ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ -OE3 plants. For 3 references in one heart period with two leavesThe specific experimental method is the same as the second example, and the result shows that TaGLP-7A positive strain T is found ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ The expression level of-OE 3 plants was significantly higher than the negative control T1-42 (FIG. 6). In trefoil stage to T ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ the-OE 3 plant is obtained by cutting leaf segment of 3 rd leaf in three-leaf one-heart period, placing on 6-BA culture medium, using susceptible receptor Bainong 207 and transgenic negative plant as negative control, and inoculating fresh Erysiphe cichoracearum spore, and culturing at 22 deg.C/18 deg.C under 14h light/8 h dark condition for 6 days. The phenotype was observed 6 days after inoculation of powdery mildew spores, and the results are shown in FIG. 7.

As can be seen from FIG. 7, the susceptible control plant Bainong 207 and the transgenic negative control plant showed high susceptibility to powdery mildew, and the leaves were covered with powdery mildew sporophyte; t is ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ There were only a few powdery mildew spores on leaves of the-OE 3 plant. Thus, it is demonstrated that transgenic T is compared to untransformed Bainong 207 and regeneration negative lines ₁ Generation positive plant (T) ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ -OE3 plant) has significantly improved level of powdery mildew resistance, T ₁ -OE1 plant, T ₁ -OE2 plants and T ₁ Three strains of the-OE 3 plant show disease resistance.

The above identification results show that: after the expression level of TaGLP-7A in susceptible wheat plants is increased, the powdery mildew resistance of the susceptible wheat plants can be obviously increased, so that the gene can be used for cultivating powdery mildew resistant wheat by utilizing a genetic engineering means.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the present invention, but rather as the following description is intended to cover all modifications, equivalents and improvements falling within the spirit and scope of the present invention.

Sequence listing

<110> institute of science and technology of Henan

<120> wheat powdery mildew resistance associated protein TaGLP-7A, and coding gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 639

<212> DNA

<213> Triticum aestivum

<400> 1

atggccaacg caatgctgct ccccgtgctc atctccttcc tcgtcctgcc cttctccgcc 60

ctggccctga cccaggactt ctgcgtcgcc gacctgtcct gcagcgacac gccggccggg 120

tacccgtgca agaccggcgt cggcgcgggg gacttctact accacggcct cgccgccgcg 180

ggcaacacca gcaacctcat caaggcggcc gtgaccccgg ccttcgtcgg ccagttcccc 240

ggcgtgaacg ggctcggcat ctccgcggcg aggctcgaca tcgccgtggg cggcgtcgtg 300

ccgctgcaca cccacccggc cgcctctgag ctcctcttcg tcaccgaggg caccatcctg 360

gcgggcttca tcagctcctc ctccaacacc gtgtacacca agacgctcta caagggcgac 420

atcatggtgt tcccccaggg cctgctccac taccagtaca acggcggcgg ctcggcagcg 480

gtggcgctcg ttgcgttcag cggccccaac cccggcctgc agatcactga ctacgcgctc 540

ttcgccaaca acctgccgtc cgccgtcgtt gagaaggtca ccttcttgga cgacgcgcag 600

gtgaagaagc tcaagtccgt gctcggcggc agcggctaa 639

<210> 2

<211> 212

<212> PRT

<213> Triticum aestivum

<400> 2

Met Ala Asn Ala Met Leu Leu Pro Val Leu Ile Ser Phe Leu Val Leu

1 5 10 15

Pro Phe Ser Ala Leu Ala Leu Thr Gln Asp Phe Cys Val Ala Asp Leu

20 25 30

Ser Cys Ser Asp Thr Pro Ala Gly Tyr Pro Cys Lys Thr Gly Val Gly

35 40 45

Ala Gly Asp Phe Tyr Tyr His Gly Leu Ala Ala Ala Gly Asn Thr Ser

50 55 60

Asn Leu Ile Lys Ala Ala Val Thr Pro Ala Phe Val Gly Gln Phe Pro

65 70 75 80

Gly Val Asn Gly Leu Gly Ile Ser Ala Ala Arg Leu Asp Ile Ala Val

85 90 95

Gly Gly Val Val Pro Leu His Thr His Pro Ala Ala Ser Glu Leu Leu

100 105 110

Phe Val Thr Glu Gly Thr Ile Leu Ala Gly Phe Ile Ser Ser Ser Ser

115 120 125

Asn Thr Val Tyr Thr Lys Thr Leu Tyr Lys Gly Asp Ile Met Val Phe

130 135 140

Pro Gln Gly Leu Leu His Tyr Gln Tyr Asn Gly Gly Gly Ser Ala Ala

145 150 155 160

Val Ala Leu Val Ala Phe Ser Gly Pro Asn Pro Gly Leu Gln Ile Thr

165 170 175

Asp Tyr Ala Leu Phe Ala Asn Asn Leu Pro Ser Ala Val Val Glu Lys

180 185 190

Val Thr Phe Leu Asp Asp Ala Gln Val Lys Lys Leu Lys Ser Val Leu

195 200 205

Gly Gly Ser Gly

210

Claims

1. A protein which is a protein of a) or b) or c) or d) as follows:

a) the amino acid sequence is protein shown as SEQ ID NO. 2;

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule of claim 2, wherein: the coding sequence of the nucleic acid molecule is shown as SEQ ID NO. 1.

4. A recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus comprising the nucleic acid molecule of claim 2 or 3.

5. Use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus of claim 4 for modulating powdery mildew resistance in a plant;

or, the use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus of claim 4 for breeding transgenic plants with reduced powdery mildew resistance;

or, the use of the protein of claim 1 or the nucleic acid molecule of claim 2 or 3 or the recombinant vector, expression cassette, transgenic cell line, recombinant bacterium or recombinant virus of claim 4 for breeding transgenic plants with increased powdery mildew resistance.

6. A method for producing a transgenic plant having improved resistance to powdery mildew, comprising the step of increasing the expression level and/or activity of the protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has a higher powdery mildew resistance than the recipient plant.

7. The method according to claim 6, wherein the method for increasing the expression level and/or activity of the protein of claim 1 in the recipient plant comprises: overexpressing the protein of claim 1 in a recipient plant.

8. The method of claim 7, wherein the overexpression is performed by introducing a gene encoding the protein into the recipient plant.

9. A method for producing a transgenic plant having reduced powdery mildew resistance, comprising the step of inhibiting the expression level and/or activity of the protein of claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has lower powdery mildew resistance than the recipient plant.

10. The method according to any one of claims 6 to 9, wherein the plant is a monocotyledonous plant or a dicotyledonous plant.