CN112646011B

CN112646011B - Protein PHD-Finger17 related to plant stress resistance and coding gene and application thereof

Info

Publication number: CN112646011B
Application number: CN202110037863.6A
Authority: CN
Inventors: 孙明哲; 沈阳; 孙晓丽; 贾博为; 冷月; 才晓溪
Original assignee: Heilongjiang Bayi Agricultural University
Current assignee: Heilongjiang Bayi Agricultural University
Priority date: 2021-01-12
Filing date: 2021-01-12
Publication date: 2022-11-22
Anticipated expiration: 2041-01-12
Also published as: CN112646011A

Abstract

The invention discloses a protein PHD-Finger17 related to plant stress resistance, and a coding gene and application thereof. The coding gene sequence of the PHD-Finger17 is introduced into rice to obtain the PHD-Finger17 overexpression rice, and the DNA molecules of the coding PHD-Finger17 protein in the rice are knocked out to obtain the PHD-Finger17 gene knock-out rice. Experiments prove that: compared with wild rice, the cold resistance of the PHD-Finger17 overexpression rice is reduced, the cold resistance of the PHD-Finger17 gene knockout rice is improved, and the PHD-Finger17 gene knockout rice has the function of regulating and controlling the cold resistance of plants, and has great value for cultivating the cold-resistant plants by using a gene editing technology and increasing the yield of the plants.

Description

Protein PHD-Finger17 related to plant stress resistance and coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein PHD-Finger17 related to plant stress resistance, and a coding gene and application thereof.

Background

The rice as the crops with preference for temperature is sensitive to low temperature, and the low temperature cold damage exists in the whole growth and development period from the germination to the maturity of the seeds, particularlyIt is manifested by poor germination of seeds, suppressed and prolonged fertility, sterility caused by low temperature at meiosis stage and pollen formation stage, prolonged flowering stage and poor insemination, reduced maturing rate, etc., so low temperature may destructively reduce its yield. Rice is used as the most main grain crop, 2/3 of the population of China is bred, and the safe production of rice is directly related to the grain safety of China. At present, the low-temperature cold injury of rice occurs in many countries around the world, and 1500 kilohm exists all over the world ² The rice growing area is threatened by low temperature, and the low temperature disaster causes that the yield of the rice is reduced by 3 to 5 hundred million tons every year in China, so that the cultivation of low temperature resistant rice varieties is an important direction of rice breeding work.

Plant low temperature stress tolerance is a complex genetic trait, controlled by multiple gene/quantitative trait loci. Compared with other agronomic traits, the genetic research on the low-temperature resistance of the rice is slow, only a few low-temperature resistance genes are identified at present, but with the rapid development of bioinformatics, genetics and modern molecular biology and the gradual maturity of transgenic technology, molecular breeding through the modern genetic engineering technology becomes one of the rapid and effective ways for improving the cold resistance of the rice.

Disclosure of Invention

The first purpose of the invention is to provide a new application of PHD-Finger17 protein.

The invention provides an application of PHD-Finger17 protein in the following 1) or 2):

1) Regulating and controlling the stress tolerance of plants;

2) Cultivating a transgenic plant with reduced stress tolerance;

the PHD-Finger17 protein is a 1) or a 2) or a 3) or a 4):

a1 ) the amino acid sequence is the protein shown in the sequence 2;

a2 A fusion protein obtained by connecting a label to the N-terminal or/and the C-terminal of the protein shown in the sequence 2;

a3 Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in the sequence 2 and is related to the plant stress tolerance;

a4 Protein which is derived from rice and related to plant stress tolerance and has 90% identity with the amino acid sequence shown in the sequence 2.

The second purpose of the invention is to provide a new application of biological materials related to PHD-Finger17 protein.

The invention provides application of biological materials related to PHD-Finger17 protein in the following 1) or 2):

1) Regulating and controlling the stress tolerance of plants;

2) Cultivating a transgenic plant with reduced stress tolerance;

the biomaterial is any one of the following A1) to A8):

a1 Nucleic acid molecules encoding the PHD-Finger17 protein;

a2 An expression cassette comprising the nucleic acid molecule according to A1);

a3 A recombinant vector containing the nucleic acid molecule according to A1);

a4 A recombinant vector containing the expression cassette of A2);

a5 A recombinant microorganism containing the nucleic acid molecule according to A1);

a6 A recombinant microorganism containing the expression cassette of A2);

a7 A recombinant microorganism containing the recombinant vector of A3);

a8 A recombinant microorganism containing the recombinant vector of A4).

In the above application, the nucleic acid molecule of A1) is a gene represented by the following B1) or B2) or B3) or B4):

b1 A genomic DNA molecule shown in a sequence 1;

b2 A cDNA molecule shown in a sequence 3;

b3 A cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in B1) or B2) and encoding the PHD-Finger17 protein of claim 1;

b4 A cDNA molecule or a genomic DNA molecule which hybridizes under stringent conditions with a nucleotide sequence defined in B1) or B2) or B3) and encodes the PHD-Finger17 protein as claimed in claim 1.

In the application, the regulation and control of the plant stress tolerance is to reduce the plant stress tolerance; the stress resistance is cold resistance.

The reduction of the plant stress tolerance is embodied as follows: under cold stress treatment, the higher the content and/or activity of PHD-Finger17 protein in the plant or the higher the expression level of the PHD-Finger17 gene, the lower the cold tolerance of the plant; the method is further embodied as follows: under cold stress treatment, the higher the PHD-Finger17 protein content and/or activity or the higher the PHD-Finger17 gene expression level in the plant, the shorter the root length of the plant, the shorter the aerial part length, the lower the fresh weight, the higher the relative conductivity, the lower the proline content and the lower the soluble sugar content.

The third purpose of the invention is to provide the application of the substances shown as m1 or m2 in the following 3) or 4):

3) Improving the stress tolerance of the plants;

4) Cultivating transgenic plants with improved stress tolerance;

m1, a substance that inhibits or reduces the activity or content of PHD-Finger17 protein in a plant;

m2, a substance which inhibits or reduces the expression of a nucleic acid encoding a PHD-Finger17 protein in a plant or a substance which knocks out a nucleic acid encoding a PHD-Finger17 protein in a plant;

the PHD-Finger17 protein is a 1) or a 2) or a 3) or a 4):

a1 ) the amino acid sequence is the protein shown in the sequence 2;

In the above application, the stress resistance is cold resistance. The method for improving the stress tolerance of the plants is characterized by comprising the following steps: under cold stress treatment, PHD-Finger17 gene in the plant is deleted, and the cold resistance of the plant is improved; the method is further embodied as follows: under cold stress treatment, the PHD-Finger17 gene in the plant is deleted, the root length of the plant is lengthened, the overground part length is lengthened, the relative conductivity is lowered, the proline content is increased, and the survival rate is increased.

It is a fourth object of the present invention to provide a method for breeding a transgenic plant having improved stress tolerance.

The method for cultivating the transgenic plant with improved stress tolerance provided by the invention comprises the following steps: reducing the content and/or activity of PHD-Finger17 protein in a receptor plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance than the recipient plant.

Further, the transgenic plant has higher stress tolerance than the recipient plant is embodied in any one of the following Y1) -Y5):

y1) the transgenic plant has a higher root length than the recipient plant;

y2) the transgenic plant has a higher aerial part length than the recipient plant;

y3) the relative conductivity of the transgenic plant is lower than that of the recipient plant;

y4) the transgenic plant has a higher proline content than the recipient plant;

y5) the transgenic plant has a higher survival rate than the recipient plant.

The method for reducing the content and/or activity of PHD-Finger17 protein in the receptor plant is realized by knocking out or inhibiting or silencing a coding gene of the PHD-Finger17 protein in the receptor plant.

Further, the substance for knocking out the encoding gene of the PHD-Finger17 protein in the receptor plant is a CRISPR/Cas9 system; the target sequence of sgRNA in the CRISPR/Cas9 system is a DNA molecule shown in a sequence 5.

The fifth purpose of the invention is to provide a specific sgRNA or an expression cassette, a vector, a host cell, an engineering bacterium or a transgenic plant cell line containing the sgRNA coding gene, wherein the target sequence of the sgRNA is a DNA molecule shown as a sequence 5.

It is a sixth object of the present invention to provide a method for breeding a transgenic plant with reduced stress tolerance.

The method for cultivating the transgenic plant with reduced stress tolerance provided by the invention comprises the following steps: improving the content and/or activity of PHD-Finger17 protein in a receptor plant to obtain a transgenic plant; the transgenic plant has a lower stress tolerance than the recipient plant.

Further, the transgenic plant has a stress tolerance lower than that of the recipient plant embodied in any one of X1) to X6) as follows:

x1) said transgenic plant has a lower root length than said recipient plant;

x2) the transgenic plant has a lower aerial part length than the recipient plant;

x3) the fresh weight of the transgenic plant is lower than the recipient plant;

x4) the relative conductivity of the transgenic plant is higher than that of the recipient plant;

x5) the transgenic plant has a lower proline content than the recipient plant;

x6) the transgenic plant has a lower soluble sugar content than the recipient plant.

The method for improving the content and/or activity of the PHD-Finger17 protein in the receptor plant is to over-express the PHD-Finger17 protein in the receptor plant.

Furthermore, the overexpression method is to introduce a gene encoding PHD-Finger17 protein into a recipient plant.

In any of the above methods or uses, the cold tolerance is cold tolerance during germination and/or cold tolerance during seedling.

In any of the methods or uses described above, the plant is a dicot or monocot; further, the monocotyledon is a gramineous plant; further, the gramineous plant is rice.

The invention provides an application of PHD-Finger17 protein in regulation and control of plant stress tolerance. The invention introduces the DNA molecule of the PHD-Finger17 protein into the target plant to obtain the PHD-Finger17 overexpression rice, and the experiment proves that: the cold tolerance of the PHD-Finger17 overexpression rice is lower than that of a receptor plant, which shows that the cold stress tolerance of the plant is reduced by the PHD-Finger17 overexpression. The invention also knocks out the DNA molecule of PHD-Finger17 protein in the target plant to obtain PHD-Finger17 gene knock-out rice, and experiments prove that: the cold tolerance of the PHD-Finger17 gene knockout rice is higher than that of a receptor plant, which shows that the cold stress tolerance of the plant is improved by the PHD-Finger17 deletion. The above results show that: the PHD-Finger17 has the function of regulating and controlling the cold resistance of plants, and has great value for cultivating cold-resistant plants and increasing the yield of the plants.

Drawings

FIG. 1 shows the PHD-Finger17 cold stress expression pattern of qRT-PCR analysis.

FIG. 2 shows PCR and RT-PCR detection of PHD-Finger17 overexpression rice.

FIG. 3 is a cold tolerance analysis of PHD-Finger17 overexpression rice in germination stage. FIG. 3A is a comparison of the phenotype of wild-type rice and PHD-Finger17 over-expressed rice at germination stage; FIG. 3B is a comparison of the length of aerial parts in the germination period between wild type rice and PHD-Finger17 over-expressed rice; FIG. 3C is a comparison of root length in germination stage between wild type rice and PHD-Finger17 overexpressing rice.

FIG. 4 is a cold tolerance analysis of PHD-Finger17 overexpression rice at seedling stage. FIG. 4A is a comparison of phenotypes at the seedling stage of wild-type rice and PHD-Finger17 overexpressing rice; FIG. 4B is a comparison of root length between wild type rice and PHD-Finger17 overexpressing rice; FIG. 4C shows a comparison of the aerial parts of wild-type rice and PHD-Finger17 overexpressing rice; FIG. 4D is a comparison of fresh weights of wild type rice and PHD-Finger17 overexpressing rice; FIG. 4E shows the comparison of proline content in wild-type rice and PHD-Finger17 over-expressed rice; FIG. 4F is a comparison of the relative conductivities of wild type rice and PHD-Finger17 overexpressing rice; FIG. 4G is a comparison of soluble sugar content in wild type rice and PHD-Finger17 over-expressed rice.

FIG. 5 shows the construction of CRISPR-PHD-Finger17 gene knockout vector.

FIG. 6 shows the acquisition and identification of PHD-Finger17 knockout rice.

FIG. 7 is a cold tolerance analysis of PHD-Finger17 gene knock-out rice in germination stage.

FIG. 8 is a cold tolerance analysis of PHD-Finger17 gene knockout rice in the seedling stage.

Detailed Description

The following examples are intended to facilitate a better understanding of the invention, but are not intended to limit the invention thereto. The test methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The pCAMBIA330035Su vector in the following examples is described in the following documents: xiaoolin Sun, wei Ji, xiaoodong Ding, xi Bai, hua Cai, shanshan Yang, xue Qian, mingzhe Sun, yanming Zhu.GsVAMP72，a novel Glycine sojaIn R-SNARE protein, is immersed in a regulating Plant salt and ABA sensitivity, plant Cell tissue organic crop 2013, 113-199-215, publicly available from the applicant (university of eight agricultural cultivations, heilongjiang), this biomaterial was used only for repeating the relevant experiments of the present invention, and was not used for other purposes.

The psgR-Cas9-Os vectors in the following examples are described in: miao C, wang Z, zhang L, yao J, hua K, liu X, shi H, zhu JK. The grain based modulator miR156 regulated series of The gibberella in pathway in rice Commun. 2019 Aug 23 (1): 3822, publicly available from The applicant (university of eight agricultural cultivations, heilongjiang), this biomaterial was used only for repeating The relevant experiments of The present invention, and was not used for other purposes.

The pCAMBIA1300 vectors in the following examples are described in the following documents: in (18) e122, the public is available from the applicant (university of eight agricultural cultivations in Heilongjiang) and the biomaterial is only used for repeating the relevant experiments of the invention and can not be used for other purposes.

The wild type rice variety "Nipponbare" in the following examples is a rice genome-sequenced variety, and the detailed information is recorded in the American center for Biotechnology information (https:// www.ncbi.nlm.nih.gov/assembly/GCF _ 001433935.1), publicly available from the applicant (university of eight agricultural cultivations in Heilongjiang), and the biological material is used only for repeating the experiments related to the present invention, and is not used for other purposes.

Example 1 cloning of PHD-Finger17

1. Cloning of CDS region of PHD-Finger17 Gene

1. Design of primers

PHD-Finger17 cloning primers were designed using Primer Premier 5.0. The primer sequences are as follows:

PHD-Finger17-F：5’-ATGGGGAAGGGAGGGGAAGG-3’；

PHD-Finger17-R：5’-CTAGACACCTTCAGTTCCTTG-3’。

2. cloning of PHD-Finger17

Mature and plump rice seeds (Nipponbare) are selected and treated for 3-5 days at 42 ℃ to break dormancy. Sterilizing with 10% NaClO for 30 min, cleaning with sterile distilled water for 5 times, soaking in dark for 1 day, transferring germinated rice seeds to 30 deg.C environment, performing germination acceleration in dark for 1 day, transferring germinated rice seedlings to Yoshida solution, and irradiating at 28 deg.C for 12 hr (illumination intensity of 250 μmol m) ⁻² s ⁻¹ ) Culturing at 25 deg.C for 12h in dark to obtain three-leaf stage. Taking three-leaf-stage seedling leaves, extracting total RNA by Trizol (Invitrogen company), carrying out reverse transcription to obtain cDNA, carrying out PCR amplification by using the obtained cDNA as a template and PHD-Finger17-F and PHD-Finger17-R primers to obtain a PCR product, and sequencing the PCR product.

PCR amplification is carried out to obtain a fragment with the size of 2400bp, the nucleotide sequence of the fragment is shown as a sequence 3, and the fragment comprises the CDS region sequence of PHD-Finger17.

Example 2 analysis of expression Pattern of PHD-Finger17 under Cold stress

The three-leaf stage rice seedlings in example 1 were cold-treated at 4 ℃ for 0h, 0.5h, 1h, 3h, 6h, 9h, 12h and 24h, and then the overground tissue was harvested and total RNA was extracted by Trizol method,the reverse transcription kit SuperScript is adopted ^TM III Reverse transcription of Reverse transcription kit (Invitrogen, carlsbad, calif., USA) to obtain cDNA. Diluting the obtained cDNA by 5 times, taking the diluted cDNA as a template, and carrying out RT-PCR by adopting PHD-Finger17-qRT-F and PHD-Finger17-qRT-R primers. Meanwhile, the elongation factor 1-alpha gene (osa-ELF 1-alpha) of rice is used as an internal reference gene. The primer sequences used for detection are as follows:

PHD-Finger17-qRT-F：5’-TGTGCAGGGTGTGCTGGATT-3’；

PHD-Finger17-qRT-R：5’-CCTTTGACGACTTTGTGATTGTTG-3’；

osa-ELF1-α-F：5’-GCACGCTCTTCTTGCTTTCAC-3’；

osa-ELF1-α-R：5’-TCTTGTCAGGGTTGTAGCCGAC-3’。

the results of the qRT-PCR assay are shown in FIG. 1. The results show that: after cold stress treatment, the expression level of PHD-Finger17 is in an ascending trend and reaches the highest value when the cold stress treatment is carried out for 12 hours, which indicates that the expression of PHD-Finger17 is induced by cold stress.

Example 3 acquisition of PHD-Finger 17-overexpressing Rice and Cold tolerance analysis

1. Construction of PHD-Finger17 plant overexpression vector

1. Taking cDNA of Nipponbare as a template, and adopting PHD-Finger17-u-F and PHD-Finger17-u-R primers to carry out PCR amplification to obtain a CDS sequence of PHD-Finger17. Primer sequences are as follows (underlined represents the linker sequence required for vector construction, where U is the USER cleavage site):

PHD-Finger17-u-F：5’-GGCTTAAUATGGGGAAGGGAGGGGAAGG-3’；

PHD-Finger17-u-R：5’-GGTTTAAUCTAGACACCTTCAGTTCCTTGGAA-3’。

2. using restriction endonucleasesPacI andNt.BbvCi, carrying out double enzyme digestion on the pCAMBIA330035Su vector to obtain a vector enzyme digestion product. Incubating the obtained vector enzyme digestion product, USER enzyme (NEB, M5505S) and the PHD-Finger17 fragment obtained in the step 1 for 20min at 37 ℃, and cutting uracil of the PHD-Finger17 fragment by using the USER enzyme to form a vector which can be mixed with pCAMBIA330035SuComplementary cohesive ends, then incubated for 20min at 25 ℃ to obtain a recombinant expression vector pCAMBIA330035sU-PHD-Finger17, and sent for sequencing.

The sequencing result shows that: pCAMBIA330035sU-PHD-Finger17 are two vectors in pCAMBIA330035SuPacThe DNA molecule shown in the sequence 3 is inserted between the enzyme cutting sites of I, and the other sequences of the pCAMBIA330035Su vector are kept unchanged to obtain the vector.

2. Acquisition and identification of PHD-Finger17 overexpression rice

1. And (3) transforming the pCAMBIA330035sU-PHD-Finger17 obtained in the first step into the Agrobacterium tumefaciens EHA105 by a freeze-thaw method to obtain a recombinant bacterium pCAMBIA330035sU-PHD-Finger17/EHA105.

2. The recombinant bacterium pCAMBIA330035sU-PHD-Finger17/EHA105 bacterial liquid is used for infecting the embryogenic callus of a rice variety Nipponbare for 20min by adopting an agrobacterium-mediated method, and then the callus is transferred to a co-culture medium (NB medium containing 20mg/L acetosyringone, pH 5.2).

3. After dark culture at 25 ℃ for 2-4 days, the callus is taken, washed by sterile aqueous solution containing 500mg/L of cefamycin and then inoculated to a screening culture medium (NB culture medium containing 15mg/L of penoxsulam and 100mg/L of amoxicillin clavulanate potassium, pH 5.8).

4. Culturing at 32 deg.C under 24h light for 6 weeks, taking callus, inoculating to differentiation medium (MS culture medium containing 30g/L sorbitol, 2g/L casein hydrolysate, 100mg/L amoxicillin potassium clavulanate, 2mg/L KT and 0.02mg/L NAA, pH 5.8), culturing at 25 deg.C in dark for 5-7 days, and culturing at 26 deg.C under 16h light/8 h dark until there is green spot on callus surface.

5. The callus with green spots was transferred to a new differentiation medium and cultured at 26 ℃ for 16h light/8 h dark until the length of the regenerated shoot of the seedling was about 2cm.

6. Transferring the seedling to rooting culture medium (MS culture medium containing 100mg/L amoxicillin and clavulanate potassium, pH 5.8), culturing at 26 deg.C under 16 hr light/8 hr dark condition until plant height is 10-15cm and root system is developed to obtain regenerated plant (T) ₀ Generation).

7. Will regenerate the plant (T) ₀ Passage) was transplanted to a culture medium (composition of culture medium: 1 part of turfy soil, 1 part of kaffir lily soil and 3 parts of soil) by mass, watering, firstly placing under the dark light condition for culturing for 3-5 days, and then moving to the outdoor for normal culture.

8. Taking the leaf of the regeneration plant, extracting genome DNA, and carrying out PCR identification by using a primer pair (taking Bar gene as a target gene) consisting of Bar-277-F and Bar-277-R to obtain a regeneration plant with positive PCR identification (figure 2A). The primer sequences are as follows:

bar-277-F：5’-TGGGCAGCCCGATGACAGCGACCAC-3’；

bar-277-R：5’-ACCGAGCCGCAGGAACCGCAGGAGT-3’。

9. respectively taking tender leaves of the regeneration plants with positive PCR identification, extracting total RNA and synthesizing cDNA through reverse transcription. Taking cDNA as a template, adopting a primer pair consisting of PHD-Finger17-qRT-F and PHD-Finger17-qRT-R to carry out RT-PCR, and taking an elongation factor 1-alpha gene (osa-ELF 1-alpha) of rice as an internal reference gene.

The RT-PCR identification results are shown in FIG. 2B. As can be seen from the figure: the expression level of PHD-Finger17 is higher than that of the wild type in the seven transgenic lines.

10. Selfing the regenerated plants with positive RT-PCR identification, and respectively harvesting T from each individual plant ₁ Generation of seeds, and treatment of T according to the method of step 9 ₁ Carrying out RT-PCR identification on plants grown by the generation seeds; identification of positive T by RT-PCR ₁ Selfing the generation plants, and respectively harvesting T from each individual plant ₂ Generation of seeds, and treatment of T according to the method of step 9 ₂ Carrying out RT-PCR identification on plants grown by the generation seeds; for a certain T ₁ For the generation plant, if it is T obtained by selfing ₂ All generation plants are positive in RT-PCR identification, and the T is ₁ The generation plant is a homozygous transgenic plant, the T ₁ The generation plant and the inbred generation thereof are a homozygous transgenic line until T is obtained ₃ The generation PHD-Finger17 transgenic rice homozygote line. Random selection of T ₃ Generation PHD-Finger17 transgenic 4 rice homozygote lines PHD-Finger17-2, 3, 4 and 5The cold resistance was analyzed as follows.

3. Cold resistance analysis of PHD-Finger17 overexpression rice

1. Cold resistance analysis of PHD-Finger17 overexpression rice germination period

Selecting plump wild rice variety Nipponbare (WT) and T ₃ The generation PHD-Finger17 overexpression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 seeds are soaked in distilled water at 30 ℃ and germinate for 3-5 days until the breast is broken and white. Then, the seeds were transplanted into Yoshida solution and cultured under the conditions of 28 ℃ for 16 hours of light at 22 ℃ for 8 hours of darkness in the control group (without cold treatment) and 10 ℃ for 16 hours of light at 10 ℃ for 8 hours of darkness in the experimental group (with cold treatment). After 7 days of culture, the roots and stem heights (aerial part length) were photographed and counted, respectively. The experiment was repeated three times, using 30 plants per line treated.

The results are shown in FIG. 3. As can be seen from the figure: the phenotype, root length and aerial part of the PHD-Finger17 over-expression rice of the control group have no significant difference with wild rice. Growth of wild type and PHD-Finger17 overexpressing rice was inhibited after cold stress (FIG. 3A), but T ₃ The overground part length and root length of generation PHD-Finger17 overexpression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are lower than those of wild type rice (figure 3B and figure 3C), wherein wild type rice varieties Nipponbare (WT), T and ₃ the average overground part lengths of the generation PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are 2.3 cm, 1.5 cm and 2.0 cm respectively, and the wild type rice varieties Nipponbare (WT), T and ₃ the average root length of the generation PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 is 2.3 cm, 1.8 cm and 2.1 cm respectively.

2. Cold tolerance analysis of PHD-Finger17 overexpression rice seedling stage

Selecting plump wild rice variety Nipponbare (WT) and T ₃ The generation PHD-Finger17 overexpression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 seeds are soaked in distilled water at 30 ℃ and germinate for 3-5 days until the breast is broken and white. Sowing the germinated seeds to a moist stateThe seedling stage cold treatment is carried out after the three-leaf stage culture in the seedling raising soil, and the cold treatment method comprises the following steps: culturing at 4 deg.C for 3 days, and recovering culture for 6 days. After cold treatment, photographing and counting the length, the root length and the fresh weight of the overground part; before and after 3 days of cold treatment, taking leaves at the same part of rice seedlings, and determining the contents of proline and soluble sugar by adopting a method in an ultraviolet spectrophotometry reference miR535 genetic regulations column in rice, wherein each index is used for determining 30 samples; the conductivity meter reference "Mingzhe Sun, yang Shen, junkai Yang, xiaoxi Cai, hongyu Li, yanming Zhu, bowei Jia Xiaoli Sun" was used.miR535Molecular Breeding, 2020,40 (1): 14 ″, in the method of measuring the relative conductivity of rice leaves before and after cold treatment. Relative conductivity (%) = conductivity of leachate (R1)/resistance of leachate (R2) × 100%. The experiment was repeated three times, using 30 plants per line treated.

The results are shown in FIG. 4. As can be seen from the figure: after cold treatment, wild rice and PHD-Finger17 overexpression rice gradually lose green and even die, but the growth vigor of the wild rice after recovery is obviously superior to that of the PHD-Finger17 overexpression rice (figure 4A). The average overground part lengths of wild type rice varieties Nipponbare (WT), PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are respectively 19.8 cm, 12.5 cm and 15.2 cm; the average root lengths of wild type rice varieties Nipponbare (WT), PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are respectively 13 cm, 8 cm and 10.5 cm; the overground part length and root length of the PHD-Finger17 over-expression rice are significantly lower than those of the wild type (FIG. 4B, C). Wild type rice varieties Nipponbare (WT), T ₃ The average fresh weights of the generation PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are 390 mg, 200 mg and 310 mg respectively, and the fresh weight of the PHD-Finger17 over-expression rice is obviously lower than that of the wild type (FIG. 4D). Wild type rice varieties Nipponbare (WT), T ₃ The average relative conductivities of the generation PHD-Finger17 overexpression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 are respectively 50%, 72% and 65%, and the PHD-Finger17-5The relative conductivity of the ger17 over-expressed rice was significantly higher than that of the wild type (fig. 4F). Wild type rice varieties Nipponbare (WT), T ₃ The average proline content of the generation PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 is 198 mug/g, 132 mug/g and 148 mug/g respectively; wild type rice varieties Nipponbare (WT), T ₃ The average soluble sugar content of the generation PHD-Finger17 over-expression rice homozygote strains PHD-Finger17-3 and PHD-Finger17-5 is 2.6 mg/g, 2.15 mg/g and 2.1 mg/g respectively; the proline content and soluble sugar content in the PHD-Finger17 over-expressed rice are significantly lower than the wild type (FIG. 4E, G).

As described above, the overexpression of PHD-Finger17 reduces the tolerance of rice to cold stress.

Example 4 acquisition of PHD-Finger17 Gene-knocked-out Rice and Cold tolerance analysis

1. CRISPR-PHD-Finger17 gene knockout vector construction

1. sgRNA target sequence

According to the PHD-Finger17 gene sequence, the sgRNA target sequence for constructing the CRISPR-PHD-Finger17 is designed through an online website Optimized CRISPR Design (https:// zlab. Bio/guide-Design-resources), and the designed sgRNA target sequence is as follows: GGACTGAACCCACCTTCCGAC (sequence 5).

2. Synthesizing two single-stranded primers PHD-Finger17-sgRNA-F/R, annealing to synthesize double-stranded sgRNA, and annealingBbsConnecting the I digested psgR-Cas9-Os vectors, and transforming the Escherichia coli competence by the connection product to obtain an intermediate vector psgR-Cas9-PHD-Finger17.

PHD-Finger17-sgRNA-F：TGGCGGACTGAACCCACCTTCCGAC；

PHD-Finger17-sgRNA-R：AAACGTCGGAAGGTGGGTTCAGTCC。

3. By usingHindIII withEcoRI double enzyme digestion intermediate vector psgR-Cas9-PHD-Finger17 to obtain sgRNA-Cas9 expression cassette segment, andHindIII、EcoRi digested pCAMBIA1300 vectors are connected to obtain a CRISPR-PHD-Finger17 gene knockout vector, and the CRISPR-PHD-Finger17 gene knockout vector is subjected to sequencing.

The sequencing result shows that: the CRISPR-PHD-Finger17 gene knockout vector isOf pCAMBIA1300 vectorHindIII、EcoRAnd (3) inserting a DNA molecule shown as a sequence 4 between the enzyme cutting sites of the I enzyme, and keeping other sequences of the pCAMBIA1300 vector unchanged to obtain the vector.

2. Acquisition and identification of PHD-Finger17 gene knockout rice

1. And (3) transforming the CRISPR-PHD-Finger17 gene knockout vector obtained in the step one into the agrobacterium tumefaciens EHA105 by adopting a freeze-thaw method to obtain a recombinant bacterium CRISPR-PHD-Finger17/EHA105.

2. Infecting the embryogenic callus of a rice variety Nipponbare with a recombinant bacterium CRISPR-PHD-Finger17/EHA105 bacterial liquid by adopting an agrobacterium-mediated method for 20min, and then transferring the callus to a co-culture medium (NB medium containing 20mg/L acetosyringone, pH 5.2).

3. After dark culture at 25 ℃ for 2-4 days, the callus is taken, washed with a sterile aqueous solution containing 500mg/L of cefamycin and then inoculated into a screening medium (NB medium containing 40mg/L of hygromycin and 100mg/L of amoxicillin clavulanate potassium, pH 5.8).

7. Will regenerate the plant (T) ₀ Passage) was transplanted to a culture medium (composition of culture medium: 1 mass part of turfy soil, 1 mass part of kaffir lily soil and 3 mass parts of soil), watering,culturing in dark light for 3-5 days, and culturing in the open air.

8. Taking leaves of regenerated plants, extracting genome DNA, carrying out PCR amplification by using a primer consisting of CRISPR-CJ-PHD-Finger17-F and CRISPR-CJ-PHD-Finger17-R, and sending PCR products to a company for sequencing. The primer sequences are as follows:

CRISPR-CJ-PHD-Finger17-F：5’-GGTGAGGGTTAAGAATATGGGGC-3’；

CRISPR-CJ-PHD-Finger17-R：5’-GTCTGTCGTGTCTGAATCAATAGTAGG-3’。

since rice is a diploid plant, when Cas9 acts to cut a specific gene, both alleles on two homologous chromosomes in the same cell are likely to be edited, resulting in mutations of the same type or different types, and two alleles in one plant are considered as two gene editing events. Homozygous mutant means that the PHD-Finger17 genes of two homologous chromosomes of the plant are subjected to the same mutation.

Finally obtaining PHD-Finger17 gene homozygous mutant plants of different editing types, namely CRISPR-PHD-Finger17-1, CRISPR-PHD-Finger17-2 and CRISPR-PHD-Finger17-5.

The sequencing result shows that:

compared with the genome DNA of a wild rice variety 'Nipponbare', the homozygous PHD-Finger17 mutant CRISPR-PHD-Finger17-1 has the difference that the deletion mutation of a base C is generated at the 1246 th position of the CDS region sequence of the PHD-Finger17 gene shown in the sequence 3.

Compared with the genome DNA of a wild rice variety 'Nipponbare', the homozygous PHD-Finger17 mutant CRISPR-PHD-Finger17-2 has the difference that the insertion mutation of a base A is generated between the 1247 th position and the 1248 th position of the CDS region sequence of the PHD-Finger17 gene shown in the sequence 3.

Compared with the genome DNA of a wild rice variety 'Nipponbare', the homozygous PHD-Finger17 mutant CRISPR-PHD-Finger17-5 has the difference that the deletion mutation of a base A is generated at the 1250 th position of the CDS region sequence of the PHD-Finger17 gene shown in the sequence 3, and the deletion mutation of a base G is generated at the 1251 th position.

The mutation profile of each mutant is shown in FIG. 6.

9. Selfing the regenerated plants successfully edited by the genes, and respectively harvesting T from each individual plant ₁ Seed generation, and step 8 for T ₁ Carrying out PCR amplification and sequencing identification on the plant grown by the generation seed; sequencing was identified as successfully edited T ₁ Selfing the generation plants, and respectively harvesting T from each individual plant ₂ Seed generation, and step 8 for T ₂ Carrying out PCR amplification and sequencing identification on the plant grown by the generation seed; for a certain T ₁ For the generation plant, if it is T obtained by selfing ₂ All the generation plants are successfully edited by identification, and the T is ₁ The generation plant is a homozygous gene editing plant, the T ₁ The generation plant and the inbred generation thereof are a homozygous transgenic line until T is obtained ₃ The generation PHD-Finger17 gene knocks out a rice homozygous strain. Randomly choosing T ₃ The generation PHD-Finger17 gene knockout rice homozygous lines CRISPR-PHD-Finger17-1 and CRISPR-PHD-Finger17-2 were used for the following cold tolerance analysis.

3. Cold resistance analysis of PHD-Finger17 gene knockout rice

1. Cold resistance analysis of PHD-Finger17 gene knockout rice germination period

Selecting plump wild rice variety Nipponbare (WT) and T ₃ Generation PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17-1, T ₃ The seeds of the generation PHD-Finger17 overexpression rice homozygote strain PHD-Finger17-4 were used as experimental materials, and the cold resistance analysis was performed according to the method in step three of example 3, step 1.

The results are shown in FIG. 7 (CRISPR-1 represents CRISPR-PHD-Finger17-1, OX-4 represents PHD-Finger 17-4). As can be seen from the figure: after cold treatment, T ₃ The length of the overground part and the root length of the generation PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17-1 are obviously higher than those of a wild type rice, wherein wild type rice varieties such as Nipponbare (WT) and T ₃ The average length of the overground part of the generation PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17-1 is 2.2 cm and 2.5 cm respectively, and the wild type isRice varieties Nipponbare (WT), T ₃ The average root length of the generation PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17-1 is 2.1 cm and 2.3 cm respectively. The phenotype, root length and overground part length of the CRISPR-PHD-Finger17-1 rice line of the control group have no significant difference with the Nipponbare of a wild type rice variety.

2. Cold resistance analysis of PHD-Finger17 gene knockout rice seedling stage

Selecting plump wild rice variety Nipponbare (WT) and T ₃ Generation PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17-1, CRISPR-PHD-Finger17-2 and T ₃ The seeds of the generation PHD-Finger17 overexpression rice homozygote lines PHD-Finger17-3 and PHD-Finger17-4 were used as experimental materials, and the cold resistance analysis was performed according to the method in step three of example 3, step 2.

The results are shown in FIG. 8 (CRISPR-1 represents CRISPR-PHD-Finger17-1, CRISPR-2 represents CRISPR-PHD-Finger17-2, OX-2 represents PHD-Finger17-2, and OX-4 represents PHD-Finger 17-4). As can be seen from the figure: after cold stress treatment, the wild rice and PHD-Finger17 gene knockout rice homozygous strain CRISPR-PHD-Finger17 gradually lose green and even die, but T ₃ After the homozygous lines CRISPR-PHD-Finger17-1 and CRISPR-PHD-Finger17-2 of the generation PHD-Finger17 gene knockout rice are recovered, the growth vigor is obviously superior to that of the wild type (figure 8A); after the Cold treatment, wild type rice varieties Nipponbare (WT), T ₃ The average survival rates of the generation PHD-Finger17 gene knockout rice homozygous lines CRISPR-PHD-Finger17-1 and CRISPR-PHD-Finger17-2 are respectively 68%, 78% and 76%, and the survival rate of the generation PHD-Finger17 gene knockout rice is obviously higher than that of the wild type (figure 8D); wild type rice varieties Nipponbare (WT), T ₃ The average proline content of the generation PHD-Finger17 gene knockout rice homozygous lines CRISPR-PHD-Finger17-1 and CRISPR-PHD-Finger17-2 is respectively 200 mug/g, 225 mug/g and 215 mug/g, and the proline content in the PHD-Finger17 gene knockout rice is obviously higher than that of a wild type (figure 8B); wild type rice varieties Nipponbare (WT), T ₃ The relative conductivity of the generation PHD-Finger17 gene editing homozygote strains CRISPR-PHD-Finger17-1 and CRISPR-PHD-Finger17-2 is respectively 38%, 32% and 33%, and the PHD-Finger17 baseThe relative conductivity of the knockout rice was significantly lower than that of the wild type (fig. 8C).

As described above, the PHD-Finger17 gene deletion improves the cold stress tolerance of plants.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> university of eight agricultural reclamation of Heilongjiang

<120> protein PHD-Finger17 related to plant stress resistance, and coding gene and application thereof

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 4465

<212> DNA

<213> Artificial Sequence

<400> 1

ggaagccacc agcccggcca agccagccag ccacccctac caacgcgtcc cgtgcgagga 60

gagagaggtt gcaagcgagg ataaagcgcc cgcacctcgc cgtactccga tccgatgctt 120

cccccctccg tcccctcgta gcctccgcgt tcccccgtcc ccgtcccggc gcgcgcacgc 180

tcgcccccct ttccgttttc gagccgagct cctcgccgcc gccttctctg acctgcgcgt 240

ggtcgtatat attaaaccga ttcaaaccca cggggtaacc actaggcgct ggaaagggaa 300

accaccagat aagctctgga gctggtattg gattagtggg tggtggtggt ggtggtggtg 360

cgaggccgtc gctgggcggt gctggttttc tcgcgcggct ggtgcgatcg gagaggtggg 420

tgtgtgcttg tttcggcgtg tgatttgggc ggagggatcc ggcgatctgg ttctgattcg 480

ttgttttttt tcttcctctt ggtgtgtagg gatggggaag ggaggggaag gggcggttcc 540

cgtgggggag agcggcgggc ggcggcggag gaggccgggc gaggacggag gcgacgacga 600

cgacgaggag tatgtggtgg aggaggatga ggaggaagag tgcgacgagg atctgtctgc 660

ctcgagcgcc ggcgagggag gagagggcac agacgaggaa tacgaagagg gtgatgagga 720

cgaagaggag gatgagaccc cgcggccgag gcagcctgtc aagagccgcg agaatgggcg 780

gaaggggaag gcagacccac ccgttgcgcg atctcgtcga cgtaagtacg aggatgacga 840

tgactactcg gaagaagaag acgatcgggt cgacgagtac ggcgaggatc ttgaggagga 900

ggaagaggat cttgaggagg aggaagagga ggacgatgag gcgccacgat ccaagcgcat 960

gaagaaacgt ggtggccgca acgtggaggg gaagcttcct ctggagcgat caaatcgccg 1020

gaggtatgag gaggacatgg actttgaccc tgacatggat gaggaggaag aggaggagga 1080

tgttgatttc gatcctgaag tggaggacga ggaggaagaa gattttgagg atgaggaaga 1140

tgatgaattg gaagcgacta aggtgagggt taagaatatg gggcggcgaa agtctacttt 1200

gaatcagcga cgagggaaga tgaagagcag ctctaaggtg gccagtcgga aggtgggttc 1260

agtcaaggca aggaacgctg cgtctataag acggaggcag aaaaaacgtt caatgcttga 1320

tcgttatgag gatgacgact tcattgtgga ggacgaggtt atggctgatt ggcaaccaag 1380

gaaaaaggct agaattagga agcagatgga ggttgatcct ccgacaccag tttttgaggc 1440

tgagatatgg cctactattg attcagacac gacagacttc gaatttgtaa catccgatga 1500

ggaagcagcc attgctgagc ctactagggt tattaagaag gggaggaaga aaagggtatt 1560

tgtgtcagat tcatcctcag attctgaatt cgttgtatca gataaggaat tggggaattt 1620

gaaggagtct gagcctccag agtctctgaa agtgctgcct tcatcaccca ggaagatttc 1680

tgttacaggt aatggggagc acaaggggaa ggagaaaaag gaaccacagg aggctggaag 1740

ggcaacgtgc gggatttgcc tttctgaaga acagagagtg actgtgcagg gtgtgctgga 1800

ttgctgttca cactattttt gctttgcatg catcatgcaa tggtctaagg ttgagtcaag 1860

gtgtccgttg tgtaaacggc ggttcacaac aatcacaaag tcgtcaaagg aggatactgg 1920

tttggaactg acaaattctg taattagggt tgaagaacgt gatcaggtaa cctttccttg 1980

ctgcggttgt catataatat caaatccgac agctaaattt gttaacttca tttctgattt 2040

atatgggcag tctattcaaa ataatattca tgaatatgtt tactgtcatt ctgctgtaca 2100

cgtttcattt attcttataa atactcttat cctttcatta tttttatgtg acttctcact 2160

gttactgcgt ttgttcattt ccatgttaga actagttgcc ttaggggaca aatgttattt 2220

ggagaactaa ttttcggaac tatttttcat ttaccattta caaatcatag gcaatgttat 2280

tttttgcatt agctttcctg gtacttcagc tatatacagt ttgcaaagcc ttccccgtct 2340

taatggtctt tgcagagaaa agttattctt gctaatctgg tggagatttt ccatcatcat 2400

actatgctgt caatataaag acaaatcttt attgctctta cgatcaagta tagaaagcta 2460

tttgatggat gagatggcat aggatatctg aggtccaact tgtggccaga tgatggggag 2520

gctcttgaca acgccttctt ttgttccaaa aatggaggga aagggcaaac ttcatgtttg 2580

gtttattttt gtttgttgat ttctaaaatg ccagagatct agtgttttat ataagagttt 2640

gttatgtaca gtgcaataat attataatct tggaacatct gaacatgtaa catcctgcac 2700

agttggcgtt gttggagtgt tcaatgtaaa ccacattaat tccctggttt gattatgttc 2760

ttggacatca tatgctgtct cttgattttt gcacaggttt atcagcctac ggaagaggaa 2820

ataagacgtt ggctagatcc atacgagaat gttgtgtgca tagagtgcaa tcaaggtggt 2880

gatgacagtc tcatgttact atgcgatatt tgtgactcct cagcacatac ttactgtgtt 2940

ggtttgggaa gagaagtacc tgaaggaaat tggtactgtg gaggttgtag actcgatggc 3000

gaagcacatt cataccataa tcatgtgaat ggcaattctg ggatgtttgg tgcaatttca 3060

ccaattggca cttttgaaag gcaggggatt gatctaaatg tatctccaag agagattcct 3120

aggggaaatc attctgttga gtctcaagct tctactgcag gagcatcaac tccatctgga 3180

aggcagacaa acgcaacgaa ttttagaaga cgtcaaatgc atgactggat acgcagtttg 3240

ctttctagac caaggacaac acttgggcca gttatgcatc ataatggtgt gcatcagagt 3300

ggttttgtac caagcactga accagaccac atgaactttt gcgcaccatt agaatctgac 3360

actttacaca acactgggtc tgtaccacaa agtgaaccaa gccagaactt ccatgttatg 3420

tcagaagcca acacttcaga gacttccttt ggaaggcatg cagctctttc tgaaagacgt 3480

caaatttatg aacgtttttt catgttgcta tctagaccaa gcccgactat tagaccggac 3540

ttgtgccata atgcctcaga gcatggtagt tctgtaccaa gagttgaacc aaaccacatg 3600

aactttcatg ctccgccagt agccaacagt ccacaaactc tgcttgatgg cattccaaac 3660

cgcagcaatg gtttttcttt tactcaggct cacagtaatt ttgtagatgg aaacaacttc 3720

caaggaactg aaggtgtcta gagcaacagc aacttgtcaa gcaaatatgt atgcagagta 3780

caagtacttg ctaggtaaat tgctagttaa gtcatttctt tatacttcac tatacaaaaa 3840

gaatggtgaa ttttgctacg catgccaatg tagcgaagtg aaagtatagt tcacactgtt 3900

taggaattta ctttattttt ctggtgtttc ataggctcta acatgtcctt gcttgtttca 3960

gaagaaaccc acaaacatat tcaggggagt aaaatgtgcc catcgatgag aggcttatgg 4020

aaatcgagac aaggggacgc tggttgtcat cccttcatgt cctcctagca attgctgtca 4080

ttctccgggc aattattctt gttgaaaata gctgttcatc atgctgctta tctgtcagca 4140

atgtgatcga tgacataaac ggcatgcttt tgtaaagttt ttctgtttta gactaggcat 4200

ttatatctgc tgttactgcc atttgttcag tcgtaaaggc gacctaaaag atcacacaac 4260

ggccaagata atttggatag cttagaatgt atagattgtg ccattgggga aatcaggttt 4320

taggaaggcc attcattctg ttgacacgct ctttcgccca tgaatatttt tttttctaat 4380

tgaattgccc tatttgtctc atttgtatga ttttttattg tgatgtggta ttcgatcatc 4440

tcttaaaggt ggtggtttta tcctt 4465

<210> 2

<211> 799

<212> PRT

<213> Artificial Sequence

<400> 2

Met Gly Lys Gly Gly Glu Gly Ala Val Pro Val Gly Glu Ser Gly Gly

1 5 10 15

Arg Arg Arg Arg Arg Pro Gly Glu Asp Gly Gly Asp Asp Asp Asp Glu

20 25 30

Glu Tyr Val Val Glu Glu Asp Glu Glu Glu Glu Cys Asp Glu Asp Leu

35 40 45

Ser Ala Ser Ser Ala Gly Glu Gly Gly Glu Gly Thr Asp Glu Glu Tyr

50 55 60

Glu Glu Gly Asp Glu Asp Glu Glu Glu Asp Glu Thr Pro Arg Pro Arg

65 70 75 80

Gln Pro Val Lys Ser Arg Glu Asn Gly Arg Lys Gly Lys Ala Asp Pro

85 90 95

Pro Val Ala Arg Ser Arg Arg Arg Lys Tyr Glu Asp Asp Asp Asp Tyr

100 105 110

Ser Glu Glu Glu Asp Asp Arg Val Asp Glu Tyr Gly Glu Asp Leu Glu

115 120 125

Glu Glu Glu Glu Asp Leu Glu Glu Glu Glu Glu Glu Asp Asp Glu Ala

130 135 140

Pro Arg Ser Lys Arg Met Lys Lys Arg Gly Gly Arg Asn Val Glu Gly

145 150 155 160

Lys Leu Pro Leu Glu Arg Ser Asn Arg Arg Arg Tyr Glu Glu Asp Met

165 170 175

Asp Phe Asp Pro Asp Met Asp Glu Glu Glu Glu Glu Glu Asp Val Asp

180 185 190

Phe Asp Pro Glu Val Glu Asp Glu Glu Glu Glu Asp Phe Glu Asp Glu

195 200 205

Glu Asp Asp Glu Leu Glu Ala Thr Lys Val Arg Val Lys Asn Met Gly

210 215 220

Arg Arg Lys Ser Thr Leu Asn Gln Arg Arg Gly Lys Met Lys Ser Ser

225 230 235 240

Ser Lys Val Ala Ser Arg Lys Val Gly Ser Val Lys Ala Arg Asn Ala

245 250 255

Ala Ser Ile Arg Arg Arg Gln Lys Lys Arg Ser Met Leu Asp Arg Tyr

260 265 270

Glu Asp Asp Asp Phe Ile Val Glu Asp Glu Val Met Ala Asp Trp Gln

275 280 285

Pro Arg Lys Lys Ala Arg Ile Arg Lys Gln Met Glu Val Asp Pro Pro

290 295 300

Thr Pro Val Phe Glu Ala Glu Ile Trp Pro Thr Ile Asp Ser Asp Thr

305 310 315 320

Thr Asp Phe Glu Phe Val Thr Ser Asp Glu Glu Ala Ala Ile Ala Glu

325 330 335

Pro Thr Arg Val Ile Lys Lys Gly Arg Lys Lys Arg Val Phe Val Ser

340 345 350

Asp Ser Ser Ser Asp Ser Glu Phe Val Val Ser Asp Lys Glu Leu Gly

355 360 365

Asn Leu Lys Glu Ser Glu Pro Pro Glu Ser Leu Lys Val Leu Pro Ser

370 375 380

Ser Pro Arg Lys Ile Ser Val Thr Gly Asn Gly Glu His Lys Gly Lys

385 390 395 400

Glu Lys Lys Glu Pro Gln Glu Ala Gly Arg Ala Thr Cys Gly Ile Cys

405 410 415

Leu Ser Glu Glu Gln Arg Val Thr Val Gln Gly Val Leu Asp Cys Cys

420 425 430

Ser His Tyr Phe Cys Phe Ala Cys Ile Met Gln Trp Ser Lys Val Glu

435 440 445

Ser Arg Cys Pro Leu Cys Lys Arg Arg Phe Thr Thr Ile Thr Lys Ser

450 455 460

Ser Lys Glu Asp Thr Gly Leu Glu Leu Thr Asn Ser Val Ile Arg Val

465 470 475 480

Glu Glu Arg Asp Gln Val Tyr Gln Pro Thr Glu Glu Glu Ile Arg Arg

485 490 495

Trp Leu Asp Pro Tyr Glu Asn Val Val Cys Ile Glu Cys Asn Gln Gly

500 505 510

Gly Asp Asp Ser Leu Met Leu Leu Cys Asp Ile Cys Asp Ser Ser Ala

515 520 525

His Thr Tyr Cys Val Gly Leu Gly Arg Glu Val Pro Glu Gly Asn Trp

530 535 540

Tyr Cys Gly Gly Cys Arg Leu Asp Gly Glu Ala His Ser Tyr His Asn

545 550 555 560

His Val Asn Gly Asn Ser Gly Met Phe Gly Ala Ile Ser Pro Ile Gly

565 570 575

Thr Phe Glu Arg Gln Gly Ile Asp Leu Asn Val Ser Pro Arg Glu Ile

580 585 590

Pro Arg Gly Asn His Ser Val Glu Ser Gln Ala Ser Thr Ala Gly Ala

595 600 605

Ser Thr Pro Ser Gly Arg Gln Thr Asn Ala Thr Asn Phe Arg Arg Arg

610 615 620

Gln Met His Asp Trp Ile Arg Ser Leu Leu Ser Arg Pro Arg Thr Thr

625 630 635 640

Leu Gly Pro Val Met His His Asn Gly Val His Gln Ser Gly Phe Val

645 650 655

Pro Ser Thr Glu Pro Asp His Met Asn Phe Cys Ala Pro Leu Glu Ser

660 665 670

Asp Thr Leu His Asn Thr Gly Ser Val Pro Gln Ser Glu Pro Ser Gln

675 680 685

Asn Phe His Val Met Ser Glu Ala Asn Thr Ser Glu Thr Ser Phe Gly

690 695 700

Arg His Ala Ala Leu Ser Glu Arg Arg Gln Ile Tyr Glu Arg Phe Phe

705 710 715 720

Met Leu Leu Ser Arg Pro Ser Pro Thr Ile Arg Pro Asp Leu Cys His

725 730 735

Asn Ala Ser Glu His Gly Ser Ser Val Pro Arg Val Glu Pro Asn His

740 745 750

Met Asn Phe His Ala Pro Pro Val Ala Asn Ser Pro Gln Thr Leu Leu

755 760 765

Asp Gly Ile Pro Asn Arg Ser Asn Gly Phe Ser Phe Thr Gln Ala His

770 775 780

Ser Asn Phe Val Asp Gly Asn Asn Phe Gln Gly Thr Glu Gly Val

785 790 795

<210> 3

<211> 2400

<212> DNA

<213> Artificial Sequence

<400> 3

atggggaagg gaggggaagg ggcggttccc gtgggggaga gcggcgggcg gcggcggagg 60

aggccgggcg aggacggagg cgacgacgac gacgaggagt atgtggtgga ggaggatgag 120

gaggaagagt gcgacgagga tctgtctgcc tcgagcgccg gcgagggagg agagggcaca 180

gacgaggaat acgaagaggg tgatgaggac gaagaggagg atgagacccc gcggccgagg 240

cagcctgtca agagccgcga gaatgggcgg aaggggaagg cagacccacc cgttgcgcga 300

tctcgtcgac gtaagtacga ggatgacgat gactactcgg aagaagaaga cgatcgggtc 360

gacgagtacg gcgaggatct tgaggaggag gaagaggatc ttgaggagga ggaagaggag 420

gacgatgagg cgccacgatc caagcgcatg aagaaacgtg gtggccgcaa cgtggagggg 480

aagcttcctc tggagcgatc aaatcgccgg aggtatgagg aggacatgga ctttgaccct 540

gacatggatg aggaggaaga ggaggaggat gttgatttcg atcctgaagt ggaggacgag 600

gaggaagaag attttgagga tgaggaagat gatgaattgg aagcgactaa ggtgagggtt 660

aagaatatgg ggcggcgaaa gtctactttg aatcagcgac gagggaagat gaagagcagc 720

tctaaggtgg ccagtcggaa ggtgggttca gtcaaggcaa ggaacgctgc gtctataaga 780

cggaggcaga aaaaacgttc aatgcttgat cgttatgagg atgacgactt cattgtggag 840

gacgaggtta tggctgattg gcaaccaagg aaaaaggcta gaattaggaa gcagatggag 900

gttgatcctc cgacaccagt ttttgaggct gagatatggc ctactattga ttcagacacg 960

acagacttcg aatttgtaac atccgatgag gaagcagcca ttgctgagcc tactagggtt 1020

attaagaagg ggaggaagaa aagggtattt gtgtcagatt catcctcaga ttctgaattc 1080

gttgtatcag ataaggaatt ggggaatttg aaggagtctg agcctccaga gtctctgaaa 1140

gtgctgcctt catcacccag gaagatttct gttacaggta atggggagca caaggggaag 1200

gagaaaaagg aaccacagga ggctggaagg gcaacgtgcg ggatttgcct ttctgaagaa 1260

cagagagtga ctgtgcaggg tgtgctggat tgctgttcac actatttttg ctttgcatgc 1320

atcatgcaat ggtctaaggt tgagtcaagg tgtccgttgt gtaaacggcg gttcacaaca 1380

atcacaaagt cgtcaaagga ggatactggt ttggaactga caaattctgt aattagggtt 1440

gaagaacgtg atcaggttta tcagcctacg gaagaggaaa taagacgttg gctagatcca 1500

tacgagaatg ttgtgtgcat agagtgcaat caaggtggtg atgacagtct catgttacta 1560

tgcgatattt gtgactcctc agcacatact tactgtgttg gtttgggaag agaagtacct 1620

gaaggaaatt ggtactgtgg aggttgtaga ctcgatggcg aagcacattc ataccataat 1680

catgtgaatg gcaattctgg gatgtttggt gcaatttcac caattggcac ttttgaaagg 1740

caggggattg atctaaatgt atctccaaga gagattccta ggggaaatca ttctgttgag 1800

tctcaagctt ctactgcagg agcatcaact ccatctggaa ggcagacaaa cgcaacgaat 1860

tttagaagac gtcaaatgca tgactggata cgcagtttgc tttctagacc aaggacaaca 1920

cttgggccag ttatgcatca taatggtgtg catcagagtg gttttgtacc aagcactgaa 1980

ccagaccaca tgaacttttg cgcaccatta gaatctgaca ctttacacaa cactgggtct 2040

gtaccacaaa gtgaaccaag ccagaacttc catgttatgt cagaagccaa cacttcagag 2100

acttcctttg gaaggcatgc agctctttct gaaagacgtc aaatttatga acgttttttc 2160

atgttgctat ctagaccaag cccgactatt agaccggact tgtgccataa tgcctcagag 2220

catggtagtt ctgtaccaag agttgaacca aaccacatga actttcatgc tccgccagta 2280

gccaacagtc cacaaactct gcttgatggc attccaaacc gcagcaatgg tttttctttt 2340

actcaggctc acagtaattt tgtagatgga aacaacttcc aaggaactga aggtgtctag 2400

<210> 4

<211> 439

<212> DNA

<213> Artificial Sequence

<400> 4

aaggaatctt taaacatacg aacagatcac ttaaagttct tctgaagcaa cttaaagtta 60

tcaggcatgc atggatcttg gaggaatcag atgtgcagtc agggaccata gcacaagaca 120

ggcgtcttct actggtgcta ccagcaaatg ctggaagccg ggaacactgg gtacgtcgga 180

aaccacgtga tgtgaagaag taagataaac tgtaggagaa aagcatttcg tagtgggcca 240

tgaagccttt caggacatgt attgcagtat gggccggccc attacgcaat tggacgacaa 300

caaagactag tattagtacc acctcggcta tccacataga tcaaagctga tttaaaagag 360

ttgtgcagat gatccgtggc agctcgcagg tgaacacaac acctgcacac aaacgtcgga 420

aggtgggttc agtccgcca 439

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 5

ggactgaacc caccttccga c 21

Claims

1. The application of the substance for knocking out nucleic acid encoding PHD-Finger17 protein in plants in 1) or 2) as follows:

1) The stress tolerance of the plant is improved;

2) Cultivating a transgenic plant with improved stress tolerance;

the PHD-Finger17 protein is a protein shown in a sequence 2;

the stress tolerance is cold tolerance;

the plant is rice.

2. A method of breeding a transgenic plant with improved stress tolerance comprising the steps of: introducing a substance for knocking out PHD-Finger17 protein coding nucleic acid in a receptor plant into the receptor plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance than the recipient plant;

the PHD-Finger17 protein is a protein shown in a sequence 2;

the stress resistance is cold resistance;

the plant is rice.

3. The method of claim 2, wherein: the substance for knocking out the PHD-Finger17 protein encoding nucleic acid in the receptor plant is a CRISPR/Cas9 system.

4. The method of claim 3, wherein: the target sequence of the sgRNA in the CRISPR/Cas9 system is a DNA molecule shown in a sequence 5.

5. A specific sgRNA or an expression cassette, a vector, a host cell, an engineering bacterium or a transgenic plant cell line containing the sgRNA coding gene is disclosed, wherein the target sequence of the sgRNA is a DNA molecule shown in a sequence 5.