CN107383179A

CN107383179A - A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application

Info

Publication number: CN107383179A
Application number: CN201710822313.9A
Authority: CN
Inventors: 孙晓丽; 朱延明; 段香波; 孙明哲; 贾博为; 于洋
Original assignee: Heilongjiang Bayi Agricultural University
Current assignee: Heilongjiang Bayi Agricultural University
Priority date: 2017-09-13
Filing date: 2017-09-13
Publication date: 2017-11-24
Anticipated expiration: 2037-09-13
Also published as: CN107383179B

Abstract

The invention discloses a kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application.Present invention clone from wild soybean obtains GsSLAH3 genes, its carbonate suspension stress-inducing up-regulated expression；Tissue positioning analysis shows that GsSLAH3 genes are mainly expressed in the tissue such as root, stem, hypocotyl and Fruit pod；By its transient expression in onion epidermis cell, it is found that fusion protein fluorescence signal is mainly appeared in cell membrane；GsSLAH3 genes are overexpressed in arabidopsis, it is found that GsSLAH3 genes can strengthen patience of the arabidopsis to carbonic acid salt stress.The present invention has established Research foundation to cultivate alkaline-resisting New Crop Varieties, to developing saline alkali land resource important in inhibiting.

Description

A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application

Technical field

The invention belongs to biological technical field, and in particular to a kind of and plant stress tolerance correlative protein GsSLAH3 and its volume Code gene and application.

Background technology

Up to 1,500,000,000 mu of China's saline alkali land area, just there is as many as fifty-five million mu only the Northeast.Saline and alkaline adverse circumstance seriously endangers The growth and development of crop, it is the significant problem for restricting China's agricultural production.There is number Heilongjiang Province with ten million mu of salinization of soil Soil, develop these land resources, to improve China's farm output, Ensuring Food Safety have important practical significance and Strategic importance, while will also create huge ecological benefits and social benefit.Our province salt-soda soil predominantly contains Na₂CO₃And NaHCO₃ Basic soil, with neutral salt such as NaCl, Na₂SO₄Etc. comparing, carbonate is while osmotic stress and Ion toxicity is caused, also Add by CO₃ ^2-And HCO₃ ^-The high pH injuries Deng caused by, so as to produce mixing toxic action.Therefore carbonic acid salt stress is than neutral Salt action mechanism is increasingly complex, is endangered to caused by plant bigger.

Improve salt tolerance of crops has turned into current agricultural and the focus and difficult point of animal husbandry art research, and The significant problem of urgent need to resolve at present.In recent years, with the development of functional genomics and molecular biology, Salt And Alkali Tolerance is excavated Key gene, being cultivated using technique for gene engineering, there are the New Crop Varieties of good Salt And Alkali Tolerance character, which to have become, effectively improves work One of means of thing salt tolerant alkali ability.Wild soybean can survive in low temperature and height wetland with saline-alkaline, adaptable wide With resistance of reverse it is strong the features such as, be obtain saline-resisting and alkaline-resisting gene preferable donor material.

The physiology such as anion channel wide participation plant organic acid secretion, film potential change, turgescence control and crop tolerance to salt Process.It is incorporated in from the point of view of being studied in model plant arabidopsis and rice, wherein slow type anion channel (S-type anion Channel) critical function is played in plant is to the abiotic stress response such as light, arid, salt.Therefore, excavate wild big Beans slow type anion channel GFP, it will provide function significant genetic resources for the resistance to inverse molecular breeding of crop.

The content of the invention

The technical problems to be solved by the invention are how to regulate and control plant stress tolerance.

In order to solve the above technical problems, present invention firstly provides a kind of and plant stress tolerance correlative protein.

It is provided by the present invention with the entitled GsSLAH3 of plant stress tolerance correlative protein, for it is following a) or b) or c) or D) protein：

A) amino acid sequence is the protein shown in sequence 2；

B) fused protein obtained in N-terminal and/or C-terminal the connection label of the protein shown in sequence 2；

C) by the amino acid sequence shown in sequence 2 by one or several amino acid residues substitution and/or missing and/or Add the obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the egg with identical function White matter.

Wherein, sequence 2 is made up of 561 amino acid residues.

In order that the protein in a) is easy to purify, the amino terminal of protein that can be in sequence table shown in sequence 2 or The upper label as shown in table 1 of carboxyl terminal connection.

The sequence of table 1, label

Label	Residue	Sequence
			Poly-Arg	5-6 (being usually 5)	RRRRR
Poly-His	2-10 (being usually 6)	HHHHHH
			FLAG	8	DYKDDDDK
Strep-tag II	8	WSHPQFEK
			c-myc	10	EQKLISEEDL

It is above-mentioned c) in protein G sSLAH3, the substitution of one or several amino acid residues and/or missing and/or It is added to substitution and/or missing and/or addition no more than 10 amino acid residues.

It is above-mentioned c) in protein G sSLAH3 can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression Obtain.

It is above-mentioned c) in protein G sSLAH3 encoding gene can by will in the DNA sequence dna shown in sequence 1 lack one Or the codon of several amino acid residues, and/or carry out the missense mutation of one or several base-pairs, and/or its 5 ' end and/ Or 3 ' end connect the coded sequence of label shown in table 1 and obtain.

In order to solve the above technical problems, invention further provides the biomaterial with GsSLAH3 albumen qualitative correlations.

Any of provided by the invention with the biomaterial of GsSLAH3 albumen qualitative correlations is following A 1) to A12)：

A1 the nucleic acid molecules of GsSLAH3 protein) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A5 A1) is contained) recombinant microorganisms of the nucleic acid molecules；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector；

A9 A1) is contained) the transgenic plant cells systems of the nucleic acid molecules；

A10 A2) is contained) the transgenic plant cells system of the expression cassette；

A11 A3) is contained) the transgenic plant cells system of the recombinant vector；

A12 A4) is contained) the transgenic plant cells system of the recombinant vector.

In above-mentioned biomaterial, A1) nucleic acid molecules for it is following 1) or 2) or 3) shown in gene：

1) its coded sequence is cDNA molecules or the genomic DNA molecule shown in sequence 1；

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes GsSLAH3 protein CDNA molecules or genomic DNA molecule；

1) or 2) 3) and the cDNA of GsSLAH3 protein is encoded with the nucleotide sequence hybridization limited under strict conditions Molecule or genomic DNA molecule.

Wherein, the nucleic acid molecules can be DNA, such as cDNA, genomic DNA or recombinant DNA；The nucleic acid molecules also may be used To be RNA, such as mRNA or hnRNA.

Wherein, sequence 1 is made up of 1686 nucleotides, the amino acid sequence shown in coded sequence 2.

Those of ordinary skill in the art can be easily using known method, such as the side of orthogenesis and point mutation Method, the coding GsSLAH3 of present invention nucleotide sequence is mutated.Those have and the present invention by manually modified Isolated GsSLAH3 nucleotide sequence 75% or the nucleotides of higher homogeneity, as long as encoding GsSLAH3 and having Identical function, it is the nucleotide sequence derived from the present invention and is equal to the sequence of the present invention.

Term " homogeneity " used herein refers to the sequence similarity with native sequence nucleic acid." homogeneity " includes and this hair Shown in bright coded sequence 2 amino acid sequence composition protein nucleotide sequence have 75% or higher, or 85% or It is higher, or 90% or higher, or the nucleotide sequence of 95% or higher homogeneity.Homogeneity can with the naked eye or computer software Evaluated.Using computer software, homogeneity between two or more sequences can use percentage (%) to represent, it can be with For evaluating the homogeneity between correlated series.

Above-mentioned 75% or more than 75% homogeneity, can be 80%, 85%, 90% or more than 95% homogeneity.

In above-mentioned biomaterial, A2) described in the nucleic acid molecules containing coding GsSLAH3 expression cassette (GsSLAH3 genes Expression cassette), it is the DNA for referring to express GsSLAH3 in host cell, the DNA not only may include to start GsSLAH3 transcriptions Promoter, it may also include the terminator for terminating GsSLAH3 transcriptions.Further, the expression cassette may also include enhancer sequence.Can Promoter for the present invention includes but is not limited to：Constitutive promoter；Tissue, organ and the special promoter of development and induction Type promoter.Suitable transcription terminator includes but is not limited to：Agrobacterium nopaline syntase terminator (NOS terminator), flower Cauliflower mosaic virus CaMV 35S terminators, tml terminators, pea rbcS E9 terminators and nopaline and octopine close Enzyme terminator.

The recombinant vector of the GsSLAH3 expression casettes can be contained with existing expression vector establishment.The plant table Carrier up to carrier including double base agrobacterium vector and available for plant micropellet bombardment etc..As pAHC25, pBin438, pCAMBIA1302、pCAMBIA2300、pCAMBIA2301、pCAMBIA1301、pCAMBIA1300、pBI121、 PCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA companies) etc..The plant expression vector can also include foreign gene 3 ' end untranslated regions, i.e., processed comprising polyadenylation signals and any other participations mRNA or the DNA fragmentation of gene expression. The bootable polyadenylic acid of polyadenylation signals is added to 3 ' ends of mRNA precursor, as Agrobacterium crown gall nodule induces (Ti) plasmid Gene (such as rouge alkali synthetase gene Nos), the non-translational region of the end of plant gene (such as soybean storage protein genes) 3 ' transcription are equal With similar functions.During using gene constructed plant expression vector of the invention, enhancer, including translational enhancer also can be used Or transcriptional enhancer, these enhancer regions can be ATG initiation codon or neighboring region initiation codon etc., but must be with The reading frame of coded sequence is identical, to ensure the correct translation of whole sequence.The translation control signal and initiation codon Source is extensive, can be natural or synthesis.Translation initiation region can come from transcription initiation region or knot Structure gene.For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out Processing, as add the coding that can be expressed in plant can produce color change enzyme or luminophor gene (gus gene, Luciferase genes etc.), the marker gene of antibiotic (as assigned to kanamycins and the nptII genes of associated antibiotic resistance, The bar genes to herbicide phosphinothricin resistance are assigned, assign the hph genes to antibiotic hygromycin resistance, and assign to ammonia The dhfr genes of methotrexate resistant, assign the EPSPS genes to glyphosate) or anti-chemical reagent marker gene etc. is (such as Anti- herbicide gene), provide metabolism mannose ability mannose-6-phosphate isomerase gene.From the safety of genetically modified plants Property consider, any selected marker can be not added with, directly with adverse circumstance screen transformed plant.

In above-mentioned biomaterial, the carrier can be plasmid, sticking grain, bacteriophage or viral vector.

In above-mentioned biomaterial, the microorganism can be yeast, bacterium, algae or fungi, such as Agrobacterium.

In above-mentioned biomaterial, the transgenic plant cells system does not include propagating materials.

In order to solve the above technical problems, the present invention also provides the new application of GsSLAH3 protein or above-mentioned biomaterial.

The invention provides the application of GsSLAH3 protein or above-mentioned biomaterial in plant stress tolerance is regulated and controled.

It is described to be regulated to improve in above-mentioned application.

Present invention also offers GsSLAH3 protein or above-mentioned biomaterial to cultivate the genetically modified plants of resistance of reverse raising In application.

Present invention also offers the application of GsSLAH3 protein or above-mentioned biomaterial in plant breeding.

In above-mentioned application, the resistance of reverse is alkali resistance；The alkali resistance is specially the salt stress of resistance to carbonic acid；The resistance to carbonic acid Salt stress is specially resistance to NaHCO₃Stress.

In above-mentioned application, the plant is monocotyledon or dicotyledon, the dicotyledon concretely beans Section plant and/or crucifer and/or feverfew；The legume can be that soybean, crowtoe, clover or water are yellow Skin；The crucifer can be arabidopsis or rape；The feverfew can be sunflower；The arabidopsis can be to intend south Mustard (Columbia ecotype col-0).

In order to solve the above technical problems, the present invention finally provides a kind of side for cultivating the genetically modified plants that resistance of reverse improves Method.

The method provided by the invention for cultivating the genetically modified plants that resistance of reverse improves includes improving GsSLAH3 in recipient plant Protein expression amount and/or activity, the step of obtaining genetically modified plants；The resistance of reverse of the genetically modified plants higher than it is described by Body plant.

In the above method, it is described improve recipient plant in GsSLAH3 protein expressions amount and/or activity method be GsSLAH3 protein is overexpressed in recipient plant.

In the above method, the method for the overexpression is that the encoding gene of GsSLAH3 protein is imported into recipient plant；Institute The nucleotide sequence for stating the encoding gene of GsSLAH3 protein is the DNA molecular shown in sequence 1.

In an embodiment of the invention, the encoding gene (nucleotides i.e. shown in sequence 1) of GsSLAH3 albumen is logical The recombinant vector pCAMBIA230035S-GsSLAH3 for crossing the expression cassette of the encoding gene containing GsSLAH3 albumen imports Agrobacterium In LBA4404.The recombinant vector pCAMBIA230035S-GsSLAH3 be by the SmaI of pCAMBIA230035S carriers and DNA fragmentation between XbaI enzyme cutting site replaces with the GsSLAH3 genes shown in sequence 1 in sequence table, and keeps The carrier obtained after the other sequences of pCAMBIA230035S carriers are constant.The recombinant vector pCAMBIA230035S- GsSLAH3 expresses GsSLAH3 albumen.

In the above method, the resistance of reverse is alkali resistance；The alkali resistance is specially the salt stress of resistance to carbonic acid.

In the above method, the salt stress of resistance to carbonic acid is resistance to NaHCO₃Stress, is embodied as in NaHCO₃The condition of stress Under：The seed germination rate of genetically modified plants is longer than recipient plant higher than the root long of recipient plant and/or genetically modified plants and/or turned The Aboveground Biomass of Young of gene plant is higher than recipient plant higher than the chlorophyll content of recipient plant and/or genetically modified plants And/or the Electrolyte Leakage Rate of genetically modified plants is less than recipient plant.The NaHCO₃Concentration concretely 4mM, 5mM, 7mM, 8mM and 150mM.

In the above method, the genetically modified plants are interpreted as not only including the GsSLAH3 genetic transformation recipient plant Obtained first generation genetically modified plants, also including its filial generation.For genetically modified plants, the gene can be bred in the species, The gene transfer can also be entered to other kinds of same species with traditional breeding method, particularly including in commercial variety.It is described Genetically modified plants include seed, callus, intact plant and cell.

In the above method, the recipient plant is monocotyledon or dicotyledon, and the dicotyledon specifically may be used For legume and/or crucifer and/or feverfew；The legume can be soybean, crowtoe, clover or water Calusena lansium；The crucifer can be arabidopsis or rape；The feverfew can be sunflower；The arabidopsis can be to intend Southern mustard (Columbia ecotype col-0).

Present invention clone from wild soybean obtains GsSLAH3 genes, its carbonate suspension stress-inducing up-regulated expression；Tissue Positioning analysis shows that GsSLAH3 genes are mainly expressed in the tissue such as root, stem, hypocotyl and Fruit pod；By its transient expression in ocean In green onion epidermal cell, it is found that fusion protein fluorescence signal is mainly appeared in cell membrane；GsSLAH3 genes are overexpressed southern in intending In mustard, it is found that GsSLAH3 genes can strengthen patience of the arabidopsis to carbonic acid salt stress.The present invention is the alkaline-resisting New Crop Varieties of cultivation Research foundation is established, to developing saline alkali land resource important in inhibiting.

Brief description of the drawings

Fig. 1 is GsSLAH3 genes in wild soybean root in 50mM NaHCO₃Expression pattern under processing.

Fig. 2 is the relative expression quantity of GsSLAH3 genes in wild soybean different tissues.

Fig. 3 is GsSLAH3 Subcellular Localization.

Fig. 4 is the RT-PCR identifications for turning GsSLAH3 arabidopsis.

Fig. 5 is to turn GsSLAH3 Arabidopsis plants in 7mM NaHCO₃With 8mM NaHCO₃Processing under germination period phenotype and sprout The statistical analysis of hair rate.

Fig. 6 is to turn GsSLAH3 genes Arabidopsis plant in 4mM NaHCO₃With 5mM NaHCO₃Seedling Stage phenotype under processing And the statistical analysis of root long and Aboveground Biomass of Young.

Fig. 7 is to turn GsSLAH3 genes Arabidopsis plant in 150mM NaHCO₃Under processing into seedling stage phenotype and chlorophyll The statistical analysis of content and Electrolyte Leakage Rate.

Embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

Material used, reagent etc., unless otherwise specified, are commercially obtained in following embodiments.

Quantitative test in following embodiments, it is respectively provided with and repeats to test three times, results averaged.

Wild-type soy G07256 in following embodiments is recorded in following document：Mingzhe Sun,Xiaoli Sun, Yang Zhao,Hua Cai,Chaoyue Zhao,Wei Ji,Huizi DuanMu,Yang Yu,Yanming Zhu.Ectopic expression of GsPPCK3and SCMRP in Medicago sativa enhances plant alkaline stress tolerance and methionine content.PLOS ONE 2014,9(2):E89578, it is public Crowd can obtain from applicant (Heilongjiang Bayi Agricultural Reclamation University), the biomaterial only attach most importance to duplicate invention related experiment institute With can not be used as other purposes.

PBSK-35S-eGFP carriers in following embodiments are recorded in following document：Xiaoli Sun,Wei Ji, Xiaodong Ding,Xi Bai,Hua Cai,Shanshan Yang,Xue Qian,Mingzhe Sun,Yanming Zhu.GsVAMP72,a novel Glycine soja R-SNARE protein,is involved in regulating plant salt tolerance and ABA sensitivity.Plant Cell Tiss Organ Cult 2013,113: 199-215, the public can obtain from applicant (Heilongjiang Bayi Agricultural Reclamation University), the biomaterial only attach most importance to duplicate invention phase Close used in experiment, can not be used as other purposes.

PCAMBIA230035S carriers in following embodiments are recorded in following document：Ailin Liu,Yang Yu, Xiangbo Duan,Xiaoli Sun,Huizi Duanmu,Yanming Zhu.GsSKP21,a Glycine soja Sphase kinase associated protein,mediates the regulation of plant alkaline tolerance and ABA sensitivity.Plant Mol Biol(2015)87:111-124, the public can be from applicant (Heilongjiang Bayi Agricultural Reclamation University) place is obtained, and the biomaterial is only attached most importance to used in the related experiment of duplicate invention, can not be used as it Its purposes uses.

Agrobacterium LBA4404 in following embodiments is recorded in following document：Ailin Liu,Yang Yu,Xiangbo Duan,Xiaoli Sun,Huizi Duanmu,Yanming Zhu.GsSKP21,a Glycine soja Sphase kinase associated protein,mediates the regulation of plant alkaline tolerance and ABA sensitivity.Plant Mol Biol(2015)87:111-124, the public can (Heilungkiang Aug. 1st be land-reclaimable from applicant University) place obtain, the biomaterial only attach most importance to duplicate invention related experiment used in, can not be used as other purposes.

The clone of embodiment 1, wild soybean GsSLAH3 genes

1st, full wild soybean G07256 seeds are selected 10min is handled in the concentrated sulfuric acid to remove to desilt film, the dense sulphur of evacuation It is positioned over after acid with aseptic water washing 3-4 after on the filter paper of moistening, the vernalization in 3 days of 25 DEG C of light cultures, treats that bud grows to about 1-2cm When, it is transferred into the alms bowl for filling Huo Gelan nutrient solutions, is fixed with space wadding, bud is immersed in nutrient solution, and placed Cultivated in growth cabinet.

2nd, treat that seedling is grown to 3 week old, take its root 3cm to be put into EP pipes, be placed in -80 DEG C of preservations.RNA extraction reference RNAprep pure kits (TRANSGEN BIOTECH) specification, cDNA synthesis is carried out afterwards.

3rd, using the cDNA of synthesis as template, enter performing PCR with primer Primer-KS and Primer-KAS and expand.Primer sequence It is as follows：

Primer-KS：5’–TATAACCTGTGCTTCTGATAGTGTGT–3’；

Primer-KAS：5’–TGTTGGTTGCCTCATTATTTTCTT–3’.

PCR amplification system (50 μ L)：μ L, the 10 × PS buffer (Mg of cDNA 4²⁺) 10 μ L, dNTP Mixture (2.5mM) 411 μ L, Prime Star DNA Polymerase (TaKaRa) of μ L, Primer-KAS of μ L, Primer-KS 0.5 μ L, ddH₂O 29.5μL.PCR amplification conditions are：98℃8min；98 DEG C of 10s, 58 DEG C of 10s, 72 DEG C of 2min, 30 circulations；72℃10min；4℃ Terminate.

Pcr amplification product is subjected to 1.5% agarose gel electrophoresis detection, obtains the band that molecular weight is about 1.9Kb, is used Ago-Gel QIAquick Gel Extraction Kit (TRANSGEN BIOTECH) reclaims pcr amplification product；By itself and pEASY-Blunt Simple carriers (TRANSGEN BIOTECH) connect, and obtain recombinant plasmid pEASY-Blunt Simple-GsSLAH3.And will It delivers sequencing after converting bacillus coli DH 5 alpha competent cell.

Sequencing result shows：PCR expands to obtain the amplified production that size is 1910bp, and it is comprising complete size 1686bp ORFs (ORF), size be 1686bp DNA fragmentation nucleotide sequence as shown in sequence 1 in sequence table, And by the unnamed gene shown in sequence 1 be GsSLAH3 genes, sequence in the amino acid sequence of GsSLAH3 gene codes such as sequence table Shown in row 2, the amino acid sequence shown in sequence 2 is named as GsSLAH3 albumen.

The expression characterization analysis of embodiment 2, GsSLAH3 genes

First, GsSLAH3 genes expression pattern analysis under alkaline stress in wild soybean root

1st, full wild soybean G07256 seeds are selected 10min is handled in the concentrated sulfuric acid and go to desilt film, the evacuation concentrated sulfuric acid Aseptic water washing is used afterwards 3-4 times, be positioned on the filter paper of moistening, 25 DEG C of light culture 3d vernalization, removed when bud is about 1-2cm, Water planting is carried out with Huo Gelan fluid nutrient mediums.

2nd, treat that wild soybean seedling is grown to 3 week old, in 50mM NaHCO₃(pH8.5) under the conditions of handle 0h, 1h, 3h, 6h, Rapid tender of clip children, is placed in -80 DEG C of preservations after 9h, 12h, 24h.Total serum IgE is extracted, reverse transcription is that cDNA is stand-by as template.

3rd, using Real time-PCR methods, using wild soybean GAPDH genes as reference gene, with untreated samples As control, the relative expression quantity of analysis GsSLAH3 genes different time points after treatment.The relative expression quantity of gene use than Compared with C_TMethod (Δ Δ C_T) calculate：2^-ΔΔCT=2^{- (Δ CT processing-Δ CT controls)}=2^{- [(CT processing-CT internal references)-(CT control-CT internal references)]}.GsGAPDH and GsSLAH3 gene primers difference is as follows：

GsGAPDH-S：5’–GACTGGTATGGCATTCCGTGT–3’；

GsGAPDH-AS：5’–GCCCTCTGATTCCTCCTTGA–3’；

GsSLAH3-S：5’–AGAGCCAGCAAGCGGTGTC–3’；

GsSLAH3-AS：5’–GTAACTGTGGACCCTCCAATGTT–3’.

PCR reaction conditions：95℃2min→[95℃15s→60℃30s]×40→95℃1min→55℃1min→95 ℃30s。

As a result it is as shown in Figure 1.It can be seen that in 50mM NaHCO₃Under processing, the expression of GsSLAH3 gene upregulations, And reach peak in 6h, expression quantity relative reduction but relative 0h still keeps higher level afterwards.It is one to illustrate GsSLAH3 genes Individual alkaline stress response gene.

2nd, the tissue expression pattern analysis of GsSLAH3 genes

1st, full wild soybean G07256 seeds are selected 10min is handled in the concentrated sulfuric acid and remove to desilt film, used after evacuation is dense Aseptic water washing 3-4 times, is positioned on the filter paper of moistening, 25 DEG C of light culture 3d vernalization, when bud is about 1-2cm, is shifted Into the seedling-growing container for filling 30% turfy soil, 70% common soil, then it is positioned in growth cabinet and cultivates.

2nd, wild soybean different tissues (root, stem, spire, climax leaves, hypocotyl, embryo, Fruit pod and flower) are taken, are put respectively In -80 DEG C of preservations.

3rd, it is that to do template standby by cDNA to extract the RNA of wild soybean different tissues and reverse transcription.

4th, according to the GsSLAH3 gene relative expression quantities in the method detection wild soybean different tissues in the 3 of step 1.

As a result it is as shown in Figure 2.As can be seen from the figure：GsSLAH3 genes are mainly expressed in root, stem, hypocotyl and Fruit pod In, wherein the expression quantity highest in hypocotyl；And GsSLAH3 gene expression amounts are relatively low in flower, leaf and embryo.

Embodiment 3, the GsSLAH3 protein subcellular positioning analysises of biolistic bombardment mediation

1st, using wild soybean G07256 cDNA as template, performing PCR is entered using GsSLAH3-YS and GsSLAH3-YAS and expanded Increase, obtain GsSLAH3 genes.Primer sequence is following, and (the restriction enzyme site sequence that underscore mark introduces, its left side are protection alkali Base)：

GsSLAH3-YS：5’–GGGTCGACATGGAAAACAACCTTAAC–3’；

GsSLAH3-YAS：5’–CGTCTAGATGGCTCCCAAGTCTTAAATG–3’。

PCR amplification system：20μL 5×PrimeSTAR^TMHS PCR buffer solutions, 8 μ L dNTP mix are (A, G, T, C, each 2.5mM), 2 μ L upstream and downstream primers (10 μM), 1 μ L dilute the common template of 100 times (plasmid containing target gene), 1 μ L high-fidelities Enzyme [PrimeSTAR DNA Polymerase (TaKaRa)], sterile ddH₂O supplies volume (the μ L of cumulative volume 100).

PCR reaction conditions：98℃8min；98 DEG C of 10s, 60 DEG C of 10s, 72 DEG C of 1.5min, 30 circulations；72℃10min；4 DEG C terminating reaction.

2nd, above-mentioned pcr amplification product and carrier pBSK-35S-eGFP are carried out with restriction enzyme SalI and XbaI double Digestion, connection, obtains recombinant plasmid.Coupled reaction system is：10 × Buffer 1 μ L, T₄The μ L of DNA ligase 1, carrier are large stretch of Section and the concentration ratio of target gene are 1:1, ddH₂O supplies volume (the μ L of cumulative volume 10), and 16 DEG C of connections are overnight.

3rd, above-mentioned recombinant plasmid and empty carrier (pBSK-35S-eGFP) are bombarded by onion epidermis cell using particle bombardment (specific method is referring to U.S. Bio-Rad Bole's Helios gene gun systems specification).After light culture 12h, clip was bombarded Onion epidermis cell, load, green fluorescence is observed under laser confocal microscope.It was observed that after the fluorescence of recombinant protein, Matter wall is separated with 30% (w/v) sucrose solution processing load, further observes fluorescence again.

As a result it is as shown in Figure 3.Turn empty carrier fluorescence signal has expression in whole cell；And it is glimmering to turn recombinant plasmid green Optical signal is concentrated mainly on cell membrane, and after plasmolysis, fluorescence signal strengthens on film.Illustrate GsSLAH3 mainly as film Protein exhibits function.

Embodiment 4, the acquisition for turning GsSLAH3 Arabidopsis plants and its salt stress of resistance to carbonic acid analysis

First, acquisition and the Molecular Identification of GsSLAH3 arabidopsis are turned

1st, using the recombinant plasmid pEASY-Blunt Simple-GsSLAH3 in embodiment 1 as template, using GsSLAH3- ES and GsSLAH3-EAS primers enter performing PCR amplification, obtain the CDS areas of GsSLAH3 genes.Primer sequence is as follows：

GsSLAH3-ES：5’–AGGCCCGGGATGGAAAACAACCTTAACCGT–3’；

GsSLAH3-EAS：5’–TCGTCTAGATCATGGCTCCCAAGTCTTAAATGG–3’。

PCR amplification system (20 μ L)：0.2 2 μ L, dNTP Mixture of μ L, 10 × buffer of template 2 μ L, Mg²⁺1 μ L, 0.6 0.6 μ L, KOD DNA Polymerase (TaKaRa) of μ L, GsSLAH3-EAS of GsSLAH3-ES 0.4 μ L, ddH₂O 13.2 μL。

PCR amplification conditions：95℃2min；95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1.5min, 30 circulations；72℃10min；4 DEG C terminating reaction.

2nd, production is expanded with Restriction enzyme Sma I and the XbaI PCR obtained to pCAMBIA230035S carriers and step 1 Thing carries out double digestion, connection, obtains recombinant plasmid pCAMBIA230035S-GsSLAH3.And sequence verification is carried out to it.

Sequencing result shows：Recombinant vector pCAMBIA230035S-GsSLAH3 is by pCAMBIA230035S carriers DNA fragmentation between SmaI and XbaI enzyme cutting site replaces with the GsSLAH3 genes shown in sequence 1 in sequence table, and keeps The carrier obtained after the other sequences of pCAMBIA230035S carriers are constant.Recombinant vector pCAMBIA230035S-GsSLAH3 tables Up to the GsSLAH3 protein shown in sequence 2.

3rd, recombinant vector pCAMBIA230035S-GsSLAH3 is converted in agrobacterium tumefaciens lba4404 using freeze-thaw method, Identify to obtain positive transformant through PCR, for infecting Arabidopsis plant.

4th, using dip in colored method by the Agrobacterium containing recombinant plasmid pCAMBIA230035S-GsSLAH3 infect wild type intend Southern mustard (Columbia ecotype col-0).Harvest T₁For seed and in the 1/2MS culture mediums of kanamycins containing 25mg/L (kana) Upper screening.It is of future generation caused by the seedling obtained to screening to carry out kana screenings again, so repeat, finally obtain T₃In generation, turns GsSLAH3 arabidopsis homozygous lines.

5th, T is extracted₃In generation, turns GsSLAH3 Arabidopsis plant total serum IgEs, passes through RT-PCR method qualitative detection GsSLAH3 genes Relative expression quantity, gene primer sequence is the same as embodiment 2.Simultaneously using Actin2 as reference gene, primer sequence is as follows：

Actin2-S：5’–TTACCCGATGGGCAAGTC–3’；

Actin2-AS：5’–GCTCATACGGTCAGCGATAC–3’.

PCR reaction systems：5 μ L 2 × Easy Taq DNA Polymerase, 0.8 μ L sense primers (10 μM), 0.8 μ L Anti-sense primer (10 μM), 1 μ L dilute 100 times of cDNA, sterile ddH₂O supplies volume (the μ L of cumulative volume 10).

PCR amplification conditions：GsSLAH3：94℃10min→[94℃30s→60℃30s→72℃90s]×30→72℃ 10min → 4 DEG C terminating reaction；

Actin2：94 DEG C of 10min → [94 DEG C of 30s → 60 DEG C 30s → 72 DEG C 90s] × 28 → 72 DEG C of 10min → 4 DEG C terminate Reaction.

Enter row agarose gel electrophoresis detection to PCR primer, partial results are as shown in Figure 4.As can be seen from the figure：It is wild The RT-PCR of type Arabidopsis plant is without amplified production, and T₃Generation, which turns GsSLAH3 arabidopsis homozygous lines #14 and #15, can expand Increase and purpose band, show that foreign gene GsSLAH3 has not only smoothly been incorporated on the genome of arabidopsis, and can turn Normal transcription is expressed in gene arabidopsis.Choose T₃In generation, turns GsSLAH3 arabidopsis homozygous lines #14 and #15 and is used for next step Phenotypic analysis.

2nd, phenotypic analysis of the GsSLAH3 arabidopsis under alkaline stress is turned

1st, germination period phenotype and germination rate of the GsSLAH3 arabidopsis under alkali process are turned

Choose full wildtype Arabidopsis thaliana and T₃In generation, turns GsSLAH3 arabidopsis homozygous lines #14 and #15 seed, uses 5% hypochlorite disinfectant 5min, afterwards with sterilizing ddH₂O is rinsed 3-5 times, is placed in 4 DEG C of processing 3d.Then seed is broadcast respectively In containing 0mM, 7mM and 8mM NaHCO₃1/2MS culture mediums on, 22 DEG C culture 3d, daily observe phenotype simultaneously count seed sprouting Rate.In triplicate, every kind of each strain of processing uses 30 plants of plant for experiment.

As a result it is as shown in Figure 5.As can be seen from the figure：(0mM NaHCO under normal operation₃The control group of processing), it is wild Raw type arabidopsis and turn GsSLAH3 arabidopsis germinating and germination rate without significant difference, illustrate that GsSLAH3 is not southern to intending The seed of mustard, which is sprouted, to be had an impact；But in 7mM and 8mM NaHCO₃Under processing, wildtype Arabidopsis thaliana and turn GsSLAH3 arabidopsis Sprouting by a certain degree of suppression, but relative to wildtype Arabidopsis thaliana, turn the seed germination rate of GsSLAH3 arabidopsis more Height, it is significantly higher than wild type.Therefore, overexpression GsSLAH3 genes improve patience of the arabidopsis in germination period to alkaline stress.

2nd, Seedling Stage phenotype and root long and fresh weight of the GsSLAH3 arabidopsis under alkali process are turned

Choose full wildtype Arabidopsis thaliana and T₃In generation, turns GsSLAH3 arabidopsis homozygous lines #14 and #15 seed, uses 5% hypochlorite disinfectant 5min, afterwards with sterilizing ddH₂O is rinsed 3-5 times, is placed in 4 DEG C of Stratificated treatment 3d.Then seed is broadcast In 1/2MS solid mediums.After 1 week, select the consistent wildtype Arabidopsis thaliana of growing way and turn GsSLAH3 Arabidopsis thaliana Seedlings and turn respectively Move to the NaHCO containing 0mM, 4mM and 5mM₃Culture medium on cultivate vertically, observe the arabidopsis of alkaline stress treatment group and control group Growing way, root long and Aboveground Biomass of Young (fresh weight) are counted after 7d.

As a result it is as shown in Figure 6.As can be seen from the figure：(0mM NaHCO under normal operation₃The control group of processing), it is wild Give birth to type arabidopsis and turn GsSLAH3 arabidopsis #14, #15 growth conditions, root long and fresh weight without significant difference；And in 4mM and 5mM NaHCO₃Under processing, wildtype Arabidopsis thaliana is suppressed with the growth for turning GsSLAH3 arabidopsis, but wildtype Arabidopsis thaliana It is even more serious that suppressed degree ratio turns GsSLAH3 arabidopsis：Root long and the Aboveground Biomass of Young for turning GsSLAH3 arabidopsis are obvious Higher than wild type.Therefore, overexpression GsSLAH3 genes improve patience of the arabidopsis in Seedling Stage to alkaline stress.

3rd, turn GsSLAH3 arabidopsis under alkali process into seedling stage phenotype and the measure of physical signs

Choose full wildtype Arabidopsis thaliana and T₃In generation, turns GsSLAH3 arabidopsis homozygous lines #14 and #15 seed, 4 DEG C Stratificated treatment 3d, be sowed at afterwards in nutritive cube (Nutrition Soil, kaffir lily soil, vermiculite press 1：1：1 mixing), it is placed in greenhouse and cultivates (22 DEG C, illumination 16h/d).After 3 weeks, a 150mM NaHCO is poured per 3-4d for the seedling of alkali process group₃Solution.20d is observed The arabidopsis growing way of (alkali) treatment group and untreated fish group, and determine outside the chlorophyll content and electrolyte for the treatment of group and untreated fish group Ooze rate (detection method referring to document " plant physiology experiment/Hao Zaibin etc. edits Harbin Institute of Technology publishing house, 2004.9 ").

As a result it is as shown in Figure 7.As can be seen from the figure：In 150mM NaHCO₃Under processing, wildtype Arabidopsis thaliana is shown as Yellow leaf, crimp, wilt；And turn that GsSLAH3 arabidopsis chlorosis phenomenons are relatively fewer, and blade only slightly turns to be yellow.Chlorophyll contains Amount measurement result shows：In 150mM NaHCO₃After processing, although wildtype Arabidopsis thaliana and turning GsSLAH3 arabidopsis ' chlorophylls and containing Amount reduces, but turns GsSLAH3 arabidopsis reduction amplitude and be significantly lower than wild type, illustrates the photosynthetic system of wild-type Arabidopsis plants System receives bigger injury.Abiotic stress normally results in plant electrolyte extravasation, therefore Electrolyte Leakage Rate can be anti- Reflect the degree that plant sustains an injury.In 150mM NaHCO₃After processing, wildtype Arabidopsis thaliana and the electrolysis for turning GsSLAH3 arabidopsis Matter extravasation rate raises, and illustrates that all strains receive different degrees of injury, but compared with wildtype Arabidopsis thaliana, turns GsSLAH3 arabidopsis Electrolyte Leakage Rate is significantly lower than wild type, shows that it is relatively light by the extent of injury of alkaline stress.Cause This, overexpression GsSLAH3 genes improve arabidopsis in the patience into seedling stage to alkaline stress.

The above results show that GsSLAH3 gene overexpressions significantly improve the resistance of reverse of plant, especially alkali resistance, GsSLAH3 genes are capable of the alkali resistance of positive regulation arabidopsis.

Sequence table

<110>Heilongjiang Bayi Agricultural Reclamation University

<120>A kind of and plant stress tolerance correlative protein GsSLAH3 and its encoding gene and application

<160>2

<210>1

<211>1686bp

<212>DNA

<213>Artificial sequence

<220>

<223>

<400>1

atggaaaaca accttaaccg tgaaacagaa gggcatggct tgcctaaaat tccatcacta 60

gttcaacata tatcatcaaa tgatgaagga aactttgaca atggtgactt gaaaaatcta 120

agctcatctt tcaaagagaa tgaaacaatc ttagcaggaa gccaaggtga tgaacatgca 180

gccattaatc atcggaataa gcattcggta tctatcaaca taccattctc ttgtgaagag 240

gttcagctgc ataacaccgt aagagttctc tatagtggcg aaaatgattt ctcttctcaa 300

tcaactacta cagactccaa gccaccatta ccatcacaat caatgccaaa tggcagtctg 360

cactcagagc cagcaagcgg tgtcaatttt aacaatcaag aaagcgtcat aagcttgaat 420

aataagagga ttgatttttt caaaacatgg tccagtaaac tagggggaca catatcagtt 480

atgagtggaa aggtacatac agaaagtgca gaagatgata acagcttatg caacactaat 540

aagcctttac ctgttgattt gttcttcaaa acattggagg gtccacagtt acaaactcct 600

aagaagtctt cagaagagat ggtgcttcct caggacaagc agtggccatt tcttcttcgg 660

tttccggttt catcttttgg tatttgtctt ggagttagca gtcaagcaat tctttggaaa 720

gcattggcca cgtctccttc cactgcattt cttcacataa cccctaaaat aaatttcatc 780

ctgtggttca tctccattgg tattgttgct actattttca ccacctatct cttcaaaata 840

attctccatt ttgaagcagt tcgtcgtgag taccaacatc cggttcgtgt taacttcttc 900

tttgcaccat ggatagccct tttgttccta gctcttggag ttcccccatc agttaccaag 960

gacttgcatc aagcagtttg gtacattcta atgattccat tgttctgcct taagctaaag 1020

atatatggac agtggatgtt tgggggcaaa agaatgctgt caaaggtggc caatccaaca 1080

aatctcttag caattgttgg aaattttgta ggagccttat tgggtgcatc aatgggccta 1140

aaagaagggc ctcttttctt ctttgctctt gggcttgctc actacatggt gttgtttgta 1200

actctctccc agatgcttcc aacaaataag accatcccaa aagacctcca tccagtgttc 1260

tttctttttg tggcaccgcc tagtgttgct gctatggcat gggctaagat tcagggttca 1320

tttcattatg aatcaaggat tttctatttc actgccatgt tcctatatat ttcactggct 1380

gtccgggtca atcttttcag aggattcaaa ttctcacttt catggtgggc ctacactttt 1440

ccaatgactg ctgcagcaat tgctaccata acctatacaa atcaagtcac aaatgtacta 1500

actcaagctt tgagtgtaat attgagtctc attgctacat tcacagtaac agcagtgctt 1560

gtctcgacta tagtgcatgc ctttgtccta cgagacctct ttcccaatga ccttgccatt 1620

gccacaagtg agagaaagca aaaaccacgc aggaaatggc tcccatttaa gacttgggag 1680

ccatga 1686

<210>2

<211>561

<212>PRT

<213>Artificial sequence

<220>

<223>

<400>2

Met Glu Asn Asn Leu Asn Arg Glu Thr Glu Gly His Gly Leu Pro Lys

1 5 10 15

Ile Pro Ser Leu Val Gln His Ile Ser Ser Asn Asp Glu Gly Asn Phe

20 25 30

Asp Asn Gly Asp Leu Lys Asn Leu Ser Ser Ser Phe Lys Glu Asn Glu

35 40 45

Thr Ile Leu Ala Gly Ser Gln Gly Asp Glu His Ala Ala Ile Asn His

50 55 60

Arg Asn Lys His Ser Val Ser Ile Asn Ile Pro Phe Ser Cys Glu Glu

65 70 75 80

Val Gln Leu His Asn Thr Val Arg Val Leu Tyr Ser Gly Glu Asn Asp

85 90 95

Phe Ser Ser Gln Ser Thr Thr Thr Asp Ser Lys Pro Pro Leu Pro Ser

100 105 110

Gln Ser Met Pro Asn Gly Ser Leu His Ser Glu Pro Ala Ser Gly Val

115 120 125

Asn Phe Asn Asn Gln Glu Ser Val Ile Ser Leu Asn Asn Lys Arg Ile

130 135 140

Asp Phe Phe Lys Thr Trp Ser Ser Lys Leu Gly Gly His Ile Ser Val

145 150 155 160

Met Ser Gly Lys Val His Thr Glu Ser Ala Glu Asp Asp Asn Ser Leu

165 170 175

Cys Asn Thr Asn Lys Pro Leu Pro Val Asp Leu Phe Phe Lys Thr Leu

180 185 190

Glu Gly Pro Gln Leu Gln Thr Pro Lys Lys Ser Ser Glu Glu Met Val

195 200 205

Leu Pro Gln Asp Lys Gln Trp Pro Phe Leu Leu Arg Phe Pro Val Ser

210 215 220

Ser Phe Gly Ile Cys Leu Gly Val Ser Ser Gln Ala Ile Leu Trp Lys

225 230 235 240

Ala Leu Ala Thr Ser Pro Ser Thr Ala Phe Leu His Ile Thr Pro Lys

245 250 255

Ile Asn Phe Ile Leu Trp Phe Ile Ser Ile Gly Ile Val Ala Thr Ile

260 265 270

Phe Thr Thr Tyr Leu Phe Lys Ile Ile Leu His Phe Glu Ala Val Arg

275 280 285

Arg Glu Tyr Gln His Pro Val Arg Val Asn Phe Phe Phe Ala Pro Trp

290 295 300

Ile Ala Leu Leu Phe Leu Ala Leu Gly Val Pro Pro Ser Val Thr Lys

305 310 315 320

Asp Leu His Gln Ala Val Trp Tyr Ile Leu Met Ile Pro Leu Phe Cys

325 330 335

Leu Lys Leu Lys Ile Tyr Gly Gln Trp Met Phe Gly Gly Lys Arg Met

340 345 350

Leu Ser Lys Val Ala Asn Pro Thr Asn Leu Leu Ala Ile Val Gly Asn

355 360 365

Phe Val Gly Ala Leu Leu Gly Ala Ser Met Gly Leu Lys Glu Gly Pro

370 375 380

Leu Phe Phe Phe Ala Leu Gly Leu Ala His Tyr Met Val Leu Phe Val

385 390 395 400

Thr Leu Ser Gln Met Leu Pro Thr Asn Lys Thr Ile Pro Lys Asp Leu

405 410 415

His Pro Val Phe Phe Leu Phe Val Ala Pro Pro Ser Val Ala Ala Met

420 425 430

Ala Trp Ala Lys Ile Gln Gly Ser Phe His Tyr Glu Ser Arg Ile Phe

435 440 445

Tyr Phe Thr Ala Met Phe Leu Tyr Ile Ser Leu Ala Val Arg Val Asn

450 455 460

Leu Phe Arg Gly Phe Lys Phe Ser Leu Ser Trp Trp Ala Tyr Thr Phe

465 470 475 480

Pro Met Thr Ala Ala Ala Ile Ala Thr Ile Thr Tyr Thr Asn Gln Val

485 490 495

Thr Asn Val Leu Thr Gln Ala Leu Ser Val Ile Leu Ser Leu Ile Ala

500 505 510

Thr Phe Thr Val Thr Ala Val Leu Val Ser Thr Ile Val His Ala Phe

515 520 525

Val Leu Arg Asp Leu Phe Pro Asn Asp Leu Ala Ile Ala Thr Ser Glu

530 535 540

Arg Lys Gln Lys Pro Arg Arg Lys Trp Leu Pro Phe Lys Thr Trp Glu

545 550 555 560

Pro

Claims

1. protein, it is following protein a) or b) or c) or d)：

A) amino acid sequence is the protein shown in sequence 2；

C) amino acid sequence shown in sequence 2 is passed through to the substitution and/or missing and/or addition of one or several amino acid residues The obtained protein with identical function；

D) with sequence 2 shown in homology of the amino acid sequence with 75% or more than 75% and the albumen with identical function Matter.

Any of 2. the biomaterial with the albumen qualitative correlation described in claim 1, is following A 1) to A12)：

A1 the nucleic acid molecules of the protein described in claim 1) are encoded；

A2 A1) is contained) expression cassettes of the nucleic acid molecules；

A3 A1) is contained) recombinant vectors of the nucleic acid molecules；

A4 A2) is contained) recombinant vector of the expression cassette；

A6 A2) is contained) recombinant microorganism of the expression cassette；

A7 A3) is contained) recombinant microorganism of the recombinant vector；

A8 A4) is contained) recombinant microorganism of the recombinant vector；

3. relevant biological material according to claim 2, it is characterised in that：A1) nucleic acid molecules for it is following 1) or 2) Or 3) shown in gene：

2) nucleotide sequence with 1) limiting has 75% or more than 75% homogeneity, and encodes the albumen described in claim 1 The cDNA molecules or genomic DNA molecule of matter；

1) or 2) 3) and the protein described in claim 1 is encoded with the nucleotide sequence hybridization limited under strict conditions CDNA molecules or genomic DNA molecule.

4. the relevant biological material described in protein or Claims 2 or 3 described in claim 1 is in plant stress tolerance is regulated and controled Application；

Or, the protein described in claim 1 or the relevant biological material described in Claims 2 or 3 are cultivating resistance of reverse raising Genetically modified plants in application；

Or, the protein described in claim 1 or the relevant biological material described in Claims 2 or 3 answering in plant breeding With.

5. application according to claim 4, it is characterised in that：

The resistance of reverse is alkali resistance；

Or, the alkali resistance is the salt stress of resistance to carbonic acid.

6. a kind of method for cultivating the genetically modified plants that resistance of reverse improves, including improve in recipient plant described in claim 1 Protein expression amount and/or activity, the step of obtaining genetically modified plants；The resistance of reverse of the genetically modified plants higher than it is described by Body plant.

7. according to the method for claim 6, it is characterised in that：

The resistance of reverse is alkali resistance；

Or, the alkali resistance is the salt stress of resistance to carbonic acid.

8. the method according to claim 6 or 7, it is characterised in that：The resistance of reverse of the genetically modified plants higher than it is described by Body plant is embodied in any in following (1)-(5)：

(1) seed germination rate of genetically modified plants is higher than recipient plant；

(2) root long of genetically modified plants is longer than recipient plant；

(3) Aboveground Biomass of Young of genetically modified plants is higher than recipient plant；

(4) chlorophyll content of genetically modified plants is higher than recipient plant；

(5) Electrolyte Leakage Rate of genetically modified plants is less than recipient plant.

9. according to any described method in claim 6-8, it is characterised in that：

The method of protein expression amount and/or activity in the raising recipient plant described in claim 1 is to be planted in acceptor The protein described in claim 1 is overexpressed in thing；

Or, the method for the overexpression is that the encoding gene of the protein described in claim 1 is imported into recipient plant；

Or, the nucleotide sequence of the encoding gene of the protein is the DNA molecular shown in sequence 1.

10. according to any described method in claim 6-9, it is characterised in that：The recipient plant be monocotyledon or Dicotyledon.