CN104402981A - Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1 - Google Patents

Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1 Download PDF

Info

Publication number
CN104402981A
CN104402981A CN201410691772.4A CN201410691772A CN104402981A CN 104402981 A CN104402981 A CN 104402981A CN 201410691772 A CN201410691772 A CN 201410691772A CN 104402981 A CN104402981 A CN 104402981A
Authority
CN
China
Prior art keywords
ser
leu
lys
glu
rice
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410691772.4A
Other languages
Chinese (zh)
Inventor
马小定
韩龙植
马建
曹桂兰
雷财林
张欣
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Original Assignee
Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Crop Sciences of Chinese Academy of Agricultural Sciences filed Critical Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority to CN201410691772.4A priority Critical patent/CN104402981A/en
Publication of CN104402981A publication Critical patent/CN104402981A/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses a protein PALS1 related to the plant height, the tiller number and the leaf shape of rice and an encoding gene and application of protein PALS1. The invention provides a protein which consists of amino acid sequences as shown in SEQIDNO:3, or a protein which consists of amino acid sequences which are substituted, deleted and/or inserted by one or more amino acid residues, as shown in SEQIDNO:3, and is related to the plant type and the leaf shape of rice and derived from SEQIDNO:3. The experiment shows that a PALS1 gene is separated and cloned from nipponbare, and the gene belongs to the CHR4/MI-2-LIKE gene family. A transgenetic seedling obtained when rice is transformed by using an interference gene expressed carrier shows that the plant height, the tiller number, the leaf width and the leaf length of rice can be remarkably affected by the expression amount of PALS1, and the gene has certain application potential in plant type and leaf shape molecular breeding of rice.

Description

A kind of albumen PALS1 relevant with leaf proterties to plant type of rice and encoding gene thereof and application
Technical field
The invention belongs to plant genetic engineering and biological technical field, be specifically related to one and be positioned on paddy rice the 7th chromosome long arm and control plant type of rice and leaf pleiotropic gene pALS1( plant Architecture and Leaf Shape 1) clone and application.
Background technology
Paddy rice is one of most important food crop in the world, and solution universe food safety plays irreplaceable effect.In the past in six more than ten years, due to the Green Revolution and heterotic utilization, rice yield achieves twice quantum leap.But due to continuing to increase of world population, grain security is the cardinal task that countries in the world government is concerned about all the time.So, cultivate fine seed strains, continue to improve per unit area yield and just seem particularly urgent, and Ideotype Breeding is considered to the Critical policies facilitating rice yield third time leap.Ideotype is the organic assembling of the proterties such as plant height, tiller number, grain number per spike, impels paddy rice to obtain maximum biological yield and economic yield.The research institutions such as International Rice Research Institute think Ideal Rice Plant Type have plant height moderate, tiller less, the feature such as grain number per spike is many, stem stalk is sturdy.
Plant height is important economical character, is also one of important factor affecting plant type of rice.The dwarfted varieties that the sixties in last century extensively promotes significantly improves output, " the first time Green Revolution " of paddy rice of being known as.Along with rice green revolution gene sD1be cloned, the discovered in recent years regulatory gene of a large amount of participation plant height, relate to Plant hormones regulators,gibberellins, brassinolide, phytokinin, the synthesis of growth hormone and degradation pathway (Sasaki et al., 2002; Zhou et al., 2013).Individual plant tiller number is also one of important factor that rice yield is formed, spike number number depend on to a great extent tiller number number.In the clone controlling rice tillering gene, had been found that a large amount of quantitative trait locus so far, major part is Primary Location, only has small part to be cloned. mOC1the clone of gene is one of the most important progress that obtains of rice tillering study mechanism field (Li et al., 2003).Blade, as photosynthetic major organs, plays key effect in rice yield is formed.Suitable leaf area can form good photosynthetic colony, provides energy for realizing rice high yield.Therefore, the leaf improvement of paddy rice is also the important goal of plant type improvement.
Existing progress finds, Plant Height of Rice and tiller number exist certain dependency, and a lot of genes regulating and controlling these two proterties are present on identical signal path, and have not been reported about the research of plant height, tiller number and leaf three's mutual relationship.Therefore, this area is necessary to find the gene simultaneously controlling these three kinds of proterties, seeks mutual regulatory mechanism, thus is Breeding Rice for Ideotype excavation genetic resources.
Leading reference:
Sasaki A, Ashikari M, Ueguchi-Tanaka M, Itoh H, et al. Green revolution: a mutant gibberellins-synthesis gene in rice. Nature 2002, 416:701-702.
Zhou F, Lin Q, Zhu L, Ren Y, et al. D14-SCFD3-dependent degradation of D53 regulates strigolactone signaling. Nature 2013, 504:406-410.
Li X, Li J, et al. Control of tillering in rice. Nature 2003, 422:618-621.
Ma X, Cheng Z, Wu F, Jin M et al. BEAK LIKE SPIKELET1is required for lateral development of lemma and palea in rice, Plant Mol Biol Rep 2013, 31:98–108.
Wu Z, Zhang X, He B, et al. A chlorophyll-deficient rice mutant with impaired chlorophyllide esterification in chlorophyll biosynthesis. Plant Physiol 2007, 145:29-40。
Summary of the invention
For above-mentioned research background, the object of the invention be separating clone simultaneously adjusting and controlling rice plant height, tiller and leaf genes involved pALS1(Italic capitals represents, lower with), the expression amount of this gene can remarkably influenced Plant Height of Rice, tiller number, leaf is wide and leaf is long, shows that this gene can be applicable in plant type of rice and leaf molecular breeding.
Technical scheme provided by the invention is: the protein of a kind of adjusting and controlling rice plant height, tiller number and leaf genes involved PALS1 coding, its aminoacid sequence is as shown in SEQ ID NO:3.
Separating clone of the present invention derives from the aminoacid sequence of the fine PALS1 albumen of Japan (capitalization roman represents, lower same).The present invention also comprises the aminoacid sequence with the amino acid sequence shown in SEQ ID NO:3 with more than 80% homology, and because inserting, replacing or lack one or more amino acid and the derivative that produces.
The present invention also provides the encoding gene of described protein pALS1, its nucleotide sequence such as SEQ ID NO:1(separating clone of the present invention derives from rice varieties " Japan is fine " pALS1the nucleotide sequence of gene, sequence 13848 bp) or SEQ ID NO:2(separating clone of the present invention to derive from Japan fine pALS1the protein encoding polynucleotide sequence of gene, sequence 6780 bp) shown in.The present invention also comprises the gene order showing more than 80% homology with the nucleotides sequence shown in SEQ ID NO:1 or SEQ ID NO:2, also comprises because inserting, replacing or lack one or more base and the mutant allele that produces or derivative.
The present invention also provides a kind of interference carrier, and it is chosen described in claim 2 pALS1the conserved sequence of gene is as special interference region.
Described interference carrier, it utilizes pLHRNAi interference carrier to obtain as framework construction.
Described interference carrier, further, described in it is chosen pALS1the conserved sequence of 346 bp in gene C DS 1040-1385 interval is as special interference region.
The present invention also provides a kind of plasmid of described gene and the plant expression vector of gene.
A kind of host cell, it contains described gene.
Described host cell, it is Bacillus coli cells, agrobatcerium cell or vegetable cell.
The present invention also provides a kind of method of cultivating transgenic plant: comprise the gene transformation rice cell using SEQ ID NO:1 or the nucleotide sequence shown in SEQ ID NO:2, and rice plant obtained thus.
The present invention also provides described pALS1the purposes of gene or described interference carrier, it is for building transgenic paddy rice, is changed plant type and leaf transgenic paddy rice, and described transgenic paddy rice at least has following a kind of feature:
1) plant height of described transgenic paddy rice is less than described rice transformation kind;
2) tiller number of described transgenic paddy rice is less than described rice transformation kind;
3) leaf of described transgenic paddy rice is wide is less than described rice transformation kind with leaf is long;
Described paddy rice is specially japonica rice.
The paddy rice of the present invention clone pALS1the mutant of the genetic code premature termination of gene pals1(small letter italic represents, lower with) morphologically shows that plant height becomes short, tiller number reduces and blade area reduces (see embodiment 1, Fig. 1).Normal function pALS1disturbed rear plant shows as gene pals1mutation type surface (see embodiment 3, Fig. 4).
Realize concrete technological step of the present invention as follows:
1. paddy rice of the present invention pals1mutant from the fine T-DNA insertional mutagenesis library of Japan, but mutation type surface be not divided into T-DNA insertion point from. pals1by hybridization fine with Japan, prove that this mutant character is by stealthy Dominant gene.
2. utilize map-based cloning and function complementation experiment, successful clone plant type genes involved pALS1.
Detailed technological invention details is listed in " embodiment ".
Advantage of the present invention is:
The present invention has cloned one and has controlled Plant Height of Rice simultaneously, tillers and leaf plant type genes involved pALS1, this gene belongs to CHR4/MI-2-LIKE gene family, and by the vector paddy rice of interference genetic expression, the transfer-gen plant of acquisition finds, pALS1the expression amount of gene can remarkably influenced Plant Height of Rice, tiller number, leaf is wide and leaf is long, shows that this gene has certain application potential in plant type of rice and leaf molecular breeding.
Accompanying drawing explanation
Fig. 1: wild-type and mutant pals1phenotype compare, wherein, A: wild-type and mutant phenotype in seedling stage, a left side is wild-type, and the right side is mutant pals1; B: wild-type and mutant phenotype in tillering phase, a left side is wild-type, and the right side is mutant pals1; C: wild-type and mutant leaf morphology in tillering phase, a left side is wild-type, and the right side is mutant pals1.
Fig. 2: pALS1genetic mapping, wherein, A: pALS1gene Fine Mapping figure; B: pALS1gene structure figure and pals1mutant gene mutational site.
Fig. 3: build the carrier pLHRNAi structural representation that pLHRNAi-PALS1 interference carrier is used.
Fig. 4: interference pALS1gene transgenic plant detects, wherein, and A a: left side is the empty interference carrier pLHRNAiT of Japanese fine conversion 0transfer-gen plant, phenotype and common Japan fine without considerable change; The right side is Japanese fine conversion interference carrier pLHRNAi-PALS1 T 0transfer-gen plant, shows pals1mutation type surface, plant height reduces, and tiller number reduces, and leaf is wide and leaf is long all diminishes; B: detect positive pLHRNAi-PALS1 transfer-gen plant by Real-time PCR method pALS1the expression amount of gene.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method, and material used, reagent etc., if no special instructions, all can obtain from commercial channels.
embodiment 1: the phenotype analytical of wild-type and mutant
Measure plant height in the ripening stage, method saves ruler amount from tassel top to the most beneath one; Tiller number is ripening stage effective tillering number; Sword-like leave length is that the main fringe sword-like leave choosing plant is measured, and sword-like leave width is the numerical value measured at the widest part of main fringe sword-like leave.Each economical character measures 25 individual plants.According to the numerical evaluation mean value measured, do t test and calculate P value, the results are shown in Table 1.
Result shows: compared with wild-type, mutant plant height significantly reduces, and tiller number significantly reduces, and sword-like leave length and width significantly diminish.
Table 1. wild-type and mutant economical character compare (2014, Beijing)
embodiment: 2: pALS1the separating clone of gene
1. pals1mutant is originated:
Paddy rice ( oryza sativa L.) mutant pals1screen from the fine T-DNA insertional mutagenesis library of Japan, but the proterties of mutant does not cause gene inactivation to cause by T-DNA insertion.This mutant obtains in Institute of Crop Science, Chinese Academy of Agricultural Science.
pals1mutant, by hybridizing with rice variety 9311, builds F 2segregating population, carries out genetic analysis.Analytical results is: F 1notable difference is not had, at F for plant phenotype and wild-type 2for 135 individual plants of Stochastic choice in colony, the individual plant number of wild-type and mutation type surface is 100 and 35 respectively, different sexes (χ 2 1:3=0.022, P>0.80) meet the segregation ratio of 3:1, illustrate that mutant character controls by single recessive nuclear gene.
2. assignment of genes gene mapping informative population:
pals1mutant and rice variety 9311 are hybridized, F 1selfing obtains F 2colony.From F 21350 strains are selected in colony pals1mutation type surface plant is as assignment of genes gene mapping colony.Heading stage, each individual plant got young leaflet tablet, for extracting genomic dna.
3. pALS1the assignment of genes gene mapping:
CTAB method (Ma et al., 2013) is adopted to extract plant leaf total genomic dna.Choose and be uniformly distributed in 582 pairs of SSR marker on paddy rice 12 karyomit(e)s and Indel mark, carry out polymorphism analysis to mutant and wild-type, screening has the primer of polymorphism.Pcr amplification reaction system 20 μ l, comprises 2 μ l DNA(20 ng/ μ l) template, 2 μ l(2 pmol, F+R) primer, 2 μ l 10 × Buffer(Mg 2+free), 1.2 μ l MgCl 2(25 mM), 0.1 μ l dNTP(2.5 mM), 0.2 μ l rTaq(5 U/ μ l, TaKaRa) and 12.5 μ l ddH 2o; Amplified reaction is at Professional Thermocycler(Biometra Inc.) amplification instrument carries out, response procedures is: 94 DEG C of 4 min; 94 DEG C of 30 sec, 55 DEG C of 30 sec, 72 DEG C of 30 sec, 34 circulations; 72 DEG C extend 5 min.PCR primer 8% polyacrylamide gel electrophoresis detects (200V constant voltage, 1.5 hours).At F 2choose 12 mutation type surface individual plants in colony, the DNA constructed dna extracting 12 individual plants mixes pond, utilizes the mark between two parents with polymorphism, analyzes the genotype in mixed pond, screening with pals1the mark that mutational site is chain.Result screens IN7 and IN5 two Indel linked markers (Fig. 3) on the 7th chromosome long arm.
Choose 1350 F 2recessive individual plant in colony, extracts DNA, exchanges individual plant with IN7 and IN5 two label screenings.According to http://www.gramene.org/ website SSR marker collection of illustrative plates, the Indel mark choosing SSR marker between IN7 and IN5 and exploitation carries out polymorphism analysis to parent.To the primer of polymorphism be had to identify the exchange individual plant screened above, the most at last pALS1gene Fine Mapping is between mark IN27 and IN35 within the scope of 27 kb (Fig. 3).
Table 2. pALS1assignment of genes gene mapping labeled primer sequence
Primer Front primer sequence (5'-3 ') Rear primer sequence (5'-3')
IN7 ATCGGTGCCGCTCCTAGAT CACTCCACAGACATGCAATTT
IN5 GCGGTACTGGTGGAGACGAA CGTGTGCATCTCGACCAGTAAT
RM445 GCCTTGTCCCTAGCTAATCATTTCC GGCTCGAATCTACGAACAACAGC
IN8 TCGCAAAGAAAACTGGACTCC GGGCACTGCATTGTTCACG
IN13 ATCCGAAAATTTGGACGGC TTCAGGGGGATTTTGGGTG
IN15 GCACTATCACAGGGCAAAATT CCTTGGTACTATGGTTAGTATGCAC
IN16 TTCAACGTATGTGACGCCCTT AAGGTTCGCCCTAACTGAAATG
IN20 CAAACTGCACTTCCCCTCAAA CGATTTTGCCAGTTTGCGA
IN27 GTGCTACTGCACATGACACATCC CCGGCATTTGATTGTACTAACAA
IN35 AGAAGGTTCGCGACTGACTGA AGATGGCCTCCAGGTCGGT
Remarks: RM primer belongs to the paddy rice SSR primer published, and all can find in common data base; IN primer is the InDel mark of patent inventor's designed, designed.
4. candidate gene prediction and sequencing analysis
According to website prediction (http://orygenesdb.cirad.fr/), mark in limit section at IN27 and IN35, comprise 3 candidate genes.According to predicting the outcome, we devise the sequencing primer of each gene, and the candidate gene that increases from wild-type and mutant respectively carries out sequencing analysis.Find that the replacement of 1 base occurs at LOC_Os07g31450 gene the 6th exon place, sport T by A, form a terminator codon, cause premature termination.According to website annotation (http://rice.plantbiology.msu.edu), this gene belongs to CHR4/MI-2-LIKE gene family, total length 13848 bp(SEQ ID NO:1), comprise 11 exons and 10 introns.Gene coded sequence 6780 bp(SEQ ID NO:2), 2259 amino acid (SEQ ID NO:3) of encoding.
Table 3. pALS1gene sequencing primer sequence
Primer Primer sequence (5'-3 ') Primer Primer sequence (5'-3')
seq1 CATTTGAATGATGTTAGGGTTGG seq13 TGTTGAACTGGGTTGATTGCC
seq2 AATGCTCATCTGTGATCATCTCG seq14 ACTGCTGTGTCTGTTTATGGGC
seq3 GTGTGCCCTTCCATATGACGA seq15 AGCAGCGACAGAAGCAGGTT
seq4 TTTTGCTGACTGGAACTCCGTTA seq16 GCTCCGCTCCTTCATCATTAGA
seq5 TTTAGTTTACAGGCTTGTCGTGC seq17 TGCCTATTTTCCGATTTTGAACTA
seq6 TCAGCGCCATGTGATTAAGAA seq18 TAGGCATGCATCTTGAATGCA
seq7 GGCAGATATTGCTGGAACTTCA seq19 GGATCAATCCACTACCTTTGGC
seq8 TGATCCCACCATTTATGCCG seq20 CTACGCGAGCGTGTGCTTAG
seq9 TGTCTGAAGTCGACAGCCTAGG seq21 TTCGCTGTGCTCAAGAGAAGTAG
seq10 TTCGAAGCATATGTGGAGCTACA seq22 TATTCCATGAGATGCAACGGC
seq11 TTCCACTTCCTTCTGTGATTCTGA seq23 CACACTGGAAACCATTGGGAA
seq12 TGCACAGGATTGGGATCTTCTAC    
embodiment 3:PALS1 transgenosis is verified
1. the structure of interference carrier
Due to pALS1full-length genome has 13848 bp, and building complementing vector has certain difficulty.Therefore, the present inventor utilizes pLHRNAi interference carrier (Authorization Notice No.: CN102191262B; Application number: 201110055864.X; Denomination of invention: a kind of rna interference vector and application thereof) disturb as framework construction pALS1the binary expression vector of gene carries out transgenosis checking.The conserved sequence choosing the interval 346 bp genes of PALS1 gene C DS 1040-1385 as special interference region, with cDNA as template amplification.Being connected into left side multiple clone site fragment amplification primer is: 5'TTCTGCACTAGGTACCAGGCCTGTTGATCGCATCCTAGGCTGTC 3'(1-23 is carrier sequence, 24-44 is gene order) and 5'CTGACGTAGGGGCGATAGAGCTCGTGACGATTTGATCAGCGGAA 3'(1-23 be carrier sequence, 24-44 is gene order).Being connected into right side multiple clone site fragment amplification primer 5'CGGGGATCCGTCGACTACTTGATCGCATCCTAGGCTGTC 3'(1-18 is carrier sequence, 19-39 is gene order) and 5'AGGTGGAAGACGCGTTACGTGACGATTTGATCAGCGGAA 3'(1-18 be carrier sequence, 19-39 is gene order).The concrete construction process of pLHRNAi-PALS1 interference carrier refers to described in above-mentioned patent.
2. the genetic transformation of pLHRNAi-PALS1 interference carrier
PLHRNAi-PALS1 carrier is proceeded to EHA105 Agrobacterium (Agrobacterium tumefaciens, Wu et al., 2007; The public can obtain from Institute of Crop Science, Chinese Academy of Agricultural Science), obtain transformant.Transformant is extracted plasmid and checks order, confirmation plasmid is pLHRNAi-PALS1, thus obtains agrobacterium strains EHA105-pLHRNAi-PALS1.Agrobcterium-mediated transformation is adopted bacterial strain EHA105-pLHRNAi-PALS1 to be imported the callus of the fine embryo of wild-type Japan, through preculture, infect, Dual culture, the step such as screening, (agrobcterium-mediated transformation and step refer to patent: a kind of rna interference vector and application thereof to obtain transfer-gen plant; Authorization Notice No.: CN102191262B; Application number: 201110055864.X).Empty carrier pLHRNAi is imported the fine callus of Japan by the method introduced according to aforementioned patent, and the transfer-gen plant obtained is negative control.
Result display of the present invention, imports the fine callus of Japan by interference carrier pLHRNAi-PALS1 by agriculture bacillus mediated method, and obtain the strain of independent transformation seedling 36 altogether, wherein 28 strain positive plants show as pals1mutation type surface.Empty carrier transformation seedlings 10 strain obtained, all act normally (Fig. 4).We choose 2,10,17 3 relatively more outstanding familys of interference phenotype and negative control, with Real-time experimental analysis pALS1the expression (Fig. 4) of gene, three family genetic expressions are all obviously lowered.Real-time PCR primer sequence is: 5'GCTGTCCACGAACATACCACTT 3' and 5'TGGGCTATCTGATGTGGTGCT 3'.Above result shows pals1the phenotype of mutant be due to pALS1transgenation causes.
<110> Institute of Crop Science, Chinese Academy of Agricultural Science
The albumen PALS1 that <120> mono-kind is relevant with leaf proterties to plant type of rice and encoding gene thereof and application
<160> 3
<210> 1
<211> 13848
<212> gDNA
<213> paddy rice (Oryza sativa)
<400> 1
gcggattcgc ctcctccccc cctccccccc cccccccgca tctcctcccc cccacgccgc 60
cgccgccgcc gccgcttcgg ctccagctct ccgccccgtc cggtacccgc cgaggaggag 120
ggtggggggt ttgctccgcg cctcgcgcgc gatccgcggc ggaagtcccg gcgatccggc 180
actgatttcg gggtgccgcc gcggcgacct ggggaggtga gccgcgattc ggggcctgct 240
ggggcgggtt tgcgggggtt ttggtaggaa tttggccggg ggtggagtgg ggtggggtgg 300
gctacgcgag cgtgtgctta gggcggagat tcggatttcg ggggaggtgg ctgcggctgt 360
ttggagcgga ggggtttaat agctacaggt gagcttgtgc gagagaaacg gatggttgtg 420
tctacgtgat ccgacgacga gctaggtata gcttgtctgt atgcatgctg tagttcaaga 480
tgattagcta ggttaaatac agtggtttga tatagagagt aaaccgagaa gaaatttcag 540
agacccgccg cggcaatagg tgtacgagct gaagcttggg gggtgtttgg actaacagca 600
gcatgtcata gtggaatcat gtgcgcggtg tgctagtttt tggactttga agcaatgaaa 660
catttgaatg atgttagggt tggaagtaaa gtagcaagga tgtatctagt gcaggctaat 720
tgtgttggtg gttacaaagg gagggtttgt tttacttttc ataatgtggt tgggttgtcc 780
atttgcatgc ttccttcata tgacaaagtt taatttgagt atgagtgaca aaatgacaac 840
aggatattgt ctgttatgtt ctgtttaccc cagttttttg ttgtttagct tgtttactgg 900
ggtttcatga taatagaaat gcttttctgt ttgttttgta ccgctctctg aatttcggcc 960
tgtaaagttg tatgcgtgca tgttctgttc tatgatatat ggtgcaaggg agtattaaat 1020
gcaacattga aacgggtagc agtcaataat cgaagtgtaa cgtgttgcac cacgcatgtc 1080
tgttttatct gttagagagt gcttatcacc agattgtatg ctcatggaaa cagatggtaa 1140
ccttcagtta aagtagaact gttcatcaac taatgcatca ttttggtgta agtacataat 1200
acgaataatt ccgagtatat tcatatacct gaagtgctta attttattga cacatatcac 1260
agtacaatct aatccttgat tgaactctgt ctgatttctt gttagaaact tagaatcgaa 1320
ctctgtatca tatgactata atgatatgaa gattaatcta ttcaattaag ggttgcctat 1380
tttccgattt tgaactacca actaaggaaa ttctcttctg ttgctagcag catgtgacgt 1440
tgatactcta atgatgaagg agcggagctc tttatgtgaa agtgcggcag atggaagttg 1500
ggttttgaaa tacaaaagga aacggagcaa gctaacagtt agtccatcaa gtgagcatga 1560
tgcttcctca ccaatactgg attctcaaat gaacaatggc tccatcaaaa agaagatcaa 1620
acatgacact aacatttctc catcaaccaa gaagataaga ggacatgacg gggtggatat 1680
ctgctctgat actttccatt tgtagtttag ctgtatatct catctaataa tctccatatc 1740
tggctttgct gttaatctgt cttgtggata ttgtttgtga tttactcctt gtggtcatga 1800
gaacaggtca tttgatacat taaaacagtt tcaaatacaa ttttgaccat aattgtaaaa 1860
catctgtaga acctaataaa actatcatat cacaaaagtt cttgctgagg caaatctaca 1920
catatgattt tcatgtattt aatttaactg tttaaagaca tcttggtact caagttttga 1980
aagtttgact ggagaagcat ttcttatggc actcatgtaa aatccctcat atctacaaca 2040
atggatcaat ccactacctt tggcaatttg acacatgatg gggatgtgac caaactcttg 2100
cagtgtttct gcattcaaga tgcatgccta caacaaatat tggagtccca tgtagttatc 2160
atacatttgt gtgcgaataa ttataggaaa ttgcaaaagc aggttttgga aaaaaatgaa 2220
ttgaatttga gctgaacagt gatacatgta gtcataattc ttacaagttt aaggcctgat 2280
acattattat ttgttttctt tgcattatgc ggtctaaata tttttacata tacatttctt 2340
gtctttcttc agtacttcta cgagtgtgta gaatgtgatc tcggtggcaa tttgctgtgc 2400
tgtgatagct gtccacgaac ataccacttg gaatgtctta atcctcctct caaggtttga 2460
atcttatccg ttgtttcttg ttttctttga ctgttttttt tggggattgt actgattgct 2520
tcttatctct ttgcatgctt ccatctacaa tgtagcgtgc accacctgga aattggcaat 2580
gcccaagatg tcgtacaaaa aaagttagct tgaagctctt agacaatgct gatgctgaca 2640
cctctaaacg tgaaagaaca aggagaatgc gcacaagcac cacatcagat agcccatccc 2700
catctccaca aaacaaagcc tcttttaaca catcacgtgg tgctgcattt agggatgatg 2760
aaccaggtgc aaaagacaat gaagttgaga aaaggaaacc attgatatta catttgaaga 2820
agcgttcaac caaggaacta tctacagata ccacatcatc aaagtcaggg ttacttggaa 2880
agtcttcaga agagaaacag gagaaacacg gaagtgcttt gaaagtgaag aaacatctgc 2940
atcccatgga attatctcca aagaaatata agaacaagaa gcaacacaat cacagagaca 3000
gtaagagatc cgaagcaaaa aaggtccaat atttggcatc agatgtggac agtgattctt 3060
caatggaacc atctacttct cttgagcaca gcgaatcgcc gcccccaaaa agaaaatcgt 3120
tggatggaag aacacctgca tcaagtacca agaaaggaaa aaagaaagtg aaatttgttg 3180
ataaaaagca ccctgaggta ttcaaacaaa actttgttat gctaaaatag cattggctga 3240
gctgaatttg ttttctttat tttttttcac tttttcagaa atgctactta gtgattttgc 3300
cattgttata cattggtgaa cacgttatta tgttacttgt gaactcaaga agtatgcact 3360
atgttttttc ttcctgatcc tatcaccatt tactagatct acactttact acatttgcca 3420
ccttctatat tttcttttta accttgttgt atcttgcgtg tcatagttta gcaattctac 3480
cataagttta ttacctatat tttaggaata atagcatgca accatcattt ctttttgcaa 3540
agttctaata ctaatatttt tttatagctt attctatact gctttctcat attacacaat 3600
atgtaattga tggcctttga attggactac cttttatggt tgtttttctg tcttcaagtt 3660
ttactctggt gctgttgtat gctgtggagg gaaaatatat ctttcgacat acaatcaatc 3720
tacatatccc ataaatgagt tagactatcc ttttttatca ccatttatct tcacattaca 3780
ggcttactgt atgggtatta tggtagtggt gcaacctttt tctgtcttgg tgtgtctgac 3840
ctatcaccac tgccatgaat tgctttttaa tacttttatt ttacaaagat aaacttactt 3900
gatcattttt ttgtttcatc atctggtata aagatttttc catgtcagct tcttctgatc 3960
acttctcttt ggttgctacg acaatcagcc ttcaccactt ttttatgtgc atagtgtctt 4020
acctccttca attcctattg catgatgaac accttattgg tattcacagc taccaaatgt 4080
cctaattctc ttaaaagaaa aatgccctaa ttctctgaca tacttgtgtt cagaatgctg 4140
ttcatataac tgaaaaggag catggtggtg caggagacaa aataacaact cagggggatc 4200
tgcaggtttg ctctaacaac taatctgcta gtgtttattg tagatggtgg tctgtggagt 4260
actgtagttg catcaagcca ctagcttatc tatataaatt gctttttcat cccattaatt 4320
tgcctttgtt ctgtctcatt tctgagttat ctgactattg caaaacattg ttctttgctt 4380
aggttgatcg catcctaggc tgtcgacttc agacaagcca aatcatttca cctgcccatg 4440
cttcatcaga gcagattgat atggcccctc ctagtgcatc cggtgcacca gaacctagtc 4500
aagccctttt aaaaggactt catgaagaaa ttcagtcttc taatagtgat actaatgtga 4560
cagaggatgc atgtgctgat gaattagcaa acgatggtgg ggaaaataat ttggattgtt 4620
ctgatgctca aaaggagagt aatgttagat cccatggaca caaggaatca cttaacgcaa 4680
aagaaatcat gaatacagca tcagcatgtt ccgctgatca aatcgtcact gttaaggatg 4740
ctggagcagt acagacatat gtaacagctt cagtaaatgg tgaatatgag acagtaactg 4800
atattccaga agaaaagaat gacaccaaac atccagtttc caaagctgac acagaagtcc 4860
acactaaaca agaacataca cctgatagta aattgcatgg gaaaatacaa gaaactgaat 4920
tgaaggagca cgacggaact acttatgagt ttttagttaa atgggttggc aaatcgaata 4980
tccataacag ctggatttct gaatctgagc tgaaagcatt agcaaaaagg aaactagaaa 5040
actacaaagc aaagtacgga acaggtttga taaacatctg caaagaacaa tggtgccaac 5100
cgcaacgagt tattgctctg cgcacttctt tagatgaaat agaagaggct ttgatcaaat 5160
ggtgtgccct tccatatgac gaatgcacgt gggaaagatt agatgaacct acaatggtga 5220
agtatgcaca tttggtcact cagttcaaaa aatttgaatc ccaggctttg gataaggata 5280
agggaggtag ccatgcaaag ccaagggaac accaagagtt taatatgctg gttgagcagc 5340
caaaagaact ccagggaggc atgctcttcc ctcatcaact ggaagcattg aactggctac 5400
gcaaatgctg gtacaagtca aaaaatgtta tccttgctga tgagatgggt cttggaaaga 5460
ctgtgtctgc ctgtgctttt ctatcatccc tatgttgtga atataagatt aacttgccat 5520
gtcttgtctt ggttcctctt tctactatgc ccaactggat ggctgaattt gcatcatggg 5580
cacctcattt aaatgttgtg gagtatcatg gttctgcacg ggcaagatct attattcgtc 5640
aatatgagtg gcatgagggt gatgcaagcc agatgggtaa aatcaagaaa tctcataagt 5700
tcaatgtatt gctcactact tatgaaatgg tgcttgttga tgctgcatat cttcggtctg 5760
tgtcatggga ggttcttata gtcgatgagg gtcatcgtct gaagaattct agcagcaaac 5820
ttttcagttt actcaataca ttatcatttc agcatagagt tttgctgact ggaactccgt 5880
tacagaataa cattggtgaa atgtataact tattgaactt cttacaacct gcttctttcc 5940
cttctctagc ttcatttgag gagaaattca atgaccttac aacaacagag aaagtggagg 6000
agctgaagaa ccttgtagct ccacatatgc ttcgaagact gaaaaaggat gcaatgcaaa 6060
atatccctcc aaagactgaa cgaatggtgc ctgttgaatt gacatcaatc caggctgaat 6120
actaccgtgc tatgcttaca aagaactacc aagtattgcg caatattggg aaaggtggtg 6180
ctcaccagtc attgttgaac atagtaatgc aacttcggaa agtctgcaat catccgtatc 6240
ttattcctgg aactgaacct gaatcaggat caccagagtt cttgcatgaa atgcgaataa 6300
aggcctcagc aaagttaact ttgttgcact ctatgcttaa aatcctacac aaggatggtc 6360
atcgagttct tattttttct cagatgacaa agcttcttga catccttgaa gattacctga 6420
cttgggagtt tggtccgaaa acatttgaaa gagtggatgg ttcagtatct gtggcagaac 6480
gccaggcagc aattgctcgt tttaatcagg acaagagtcg ttttgtattc ctgctatcta 6540
cgcggtcatg tgggcttgga attaatttgg caactgcaga tactgttatc atatatgatt 6600
ctgatttcaa tccacatgct gatatacagg caatgaacag agcacacaga attggacagt 6660
caaacagact tttagtttac aggcttgtcg tgcgtgctag tgttgaggag cgtatcttgc 6720
accttgcgaa gaaaaaattg atgcttgatc aactttttgt taacaaatca gaatcacaga 6780
aggaagtgga agatatcatt cgctggggaa cagaggaact cttcaggaat agcgatgttg 6840
cagttaaaga taataatgaa gcttctggtg ctaaaaatga tgtagcagag gttgagttta 6900
agcataaaag aaaaactggt ggactaggcg atgtttatga agacagatgt gctgatggtt 6960
ctgctaaatt tatttgggat gaaaatgcta tcacaaagct tcttgacaga tccaacgttc 7020
catcaacagt agctgaaagc actgatgggg acttggacaa tgatatgctt ggcactgtaa 7080
aggtaattta atttgtgtac cttcttttta aataattgac tactcatgca atgaattgtg 7140
atatctagaa tgccatcttg tctgtgtgtc accaaaaaat agtgttttac ttaaaggaag 7200
tttctaatca ttttttctca attaaacttt ttttgtttat gtccagttac agacaaattt 7260
ctacactaat ttagatcttt aatttcttag accactttta accattgcat tttttttctg 7320
tatggtactg tccatcatat tctgatgtat gttatacttt gtgcaatcaa taacttctct 7380
gtgtggttct taattaattc tcttttaaac ccatttatca gtcaatagat tggaacgatg 7440
agctgaatga tgaccctggt gccaccgagg acatcccaaa tattgataat gatggttgcg 7500
agcaggcatc tgaagcaaag caggatgcag ctaatcgtgt tgaagaaaat gaatgggata 7560
aactcttacg tgtcaggtgc tgcactatac catgtacttg ttcttcctct tggcttatga 7620
tggtcttaat ttataatttt tttcttgttt acttcgtaac tttacatgcc agaaaataaa 7680
catgatggac gaataaatac tccaagccta gaatttaaga aactgaataa gttaagacac 7740
gccacatctc agcttatgaa atttcatttc tcttagtctt ttccagtgga ttcaaatttg 7800
tggtagcaca aatccctact tttgggaggc gcatgatgca ctacttagag tcatgcgaaa 7860
caaatgtgga caagtgcctt ctgttcacca aaacctcatc tgacctttca aaaatttcca 7920
cagccaccat ttcttgtttc tacttaaaca ctaccatcat tctttttctg atgtttaggt 7980
ctttaggaca tcgatccggc tccaacacaa atgtttgatc attgtctttt ttaatcatat 8040
attcataaaa gatattgaaa atataaccac atgaaattat tttcatgaaa aatctactca 8100
tatgagtcac atatcaaatc ttaatatttt tggatttatt agcgagttaa gatttcaagg 8160
tttgactgca gcacgccttc taaaacatca tctaatttag aacagatgga gtagaaggtg 8220
aggccacgaa atgcaatcat agtagcttta ctggttgcag ctaactctct ctctctctct 8280
ctctctctca tctcagatgg gagcagtatc aaactgagga ggaagcatct cttggtcgag 8340
gtaagcgttt aaggaaggct gtttcttaca gggaaacatt tgcaaccatt cctaatgaag 8400
ctttaagcga ggtaattctg cattttgacc ttgttctgca tttattttct gttgatcagt 8460
tagcaatgct ggttcataag ttaatttact gtgttactac cttctgcata aaaaaatatg 8520
cttgcctaaa tatcctgtaa gggatctgtt ctcctagcta acgagcataa atttatcttt 8580
gcatttttgt ccaccgtggt ccacttattg tggcatataa ttgctgcaac cctatgaaca 8640
ttgagctttg caacttttgc tttctctata agtgcataaa ctattcaaag tatgccttat 8700
gaggctctct gaatatatat atatatatat atatatatat atatatatat atatattgca 8760
acattttgaa tctgtaagtc aaaaattgta ccacaatccc cacataactg aatttttcat 8820
gcgccatttt gattttcttg atttgttcct ctctgctatt cactcatgcc tattgaatac 8880
tttccgtcca ccacacagat ggaaatctga ggtggcactt aacggatgcc acaatagact 8940
attaataatt gccaaatgac ctactgttct ctttacttgg agtcatgatg agataatcac 9000
aattactcag cgataagccg cctccttgtg ggcataacca gaggagaggg ggagaggagg 9060
gggataagtt cgccctggaa acctaggtgg cggcacttcc atcctaccac ggatctgcgc 9120
ttccctcctc ccctttgcgg caccaccgca tcctcttcct tgtccttcat caccttctcc 9180
acctcgtccc tgtttcccag caaagtactc ttctactccc atctttcctc tgctttatgc 9240
tgatttgttc ttctccctcc atgcttcctt cctatcttct ttctggtgtg ctgccgagcc 9300
gccaccttca ctactttagg cggcggcggc agctcgcttc ctgctagtgc acctgcatta 9360
gggtgagagg gagagggtgc tttaaatggg ctattgtgct ggggtttact gcgcaatact 9420
atagtgtgct gtgagtggct taatgtaatt taggcccata tcttctctct ctctctctct 9480
ctcaaaattg tgtaatctgt acatctgatc acttaggctg aattgctgaa aggcaggggt 9540
gggtgctttg cattgccacc gtaacaacga tgagaatgct ttcctaagtc ctcataccct 9600
caccccttta cattttcata cacaggacac caaaccctta acaacagaca caattcaaat 9660
gatttatggg agctctttgt agttttagtt tgtgttaaca tagttcaaaa aataattttg 9720
caataaatta ctctttatta tgggctcttt gatgaattac tactaaataa tttcattttg 9780
tgggatttat cctatgtaat tctacagaca catgataaca tgtgaattcc tgtgaccctg 9840
caggactcac ttttcttatt tatgtacgat tttggaaaat cggctagtta gggctattca 9900
agggggatat gattttggta gtgttgttct ttagagcttg acaaagcatg ttaatagctg 9960
taatgttgaa ttgttatggc aaatgggaac gacagtctga gctgtgggca tcatatagct 10020
ttaaaatcga gatagtgtgt gtgttcagtc taccactcat gttcacgttc tcaaaatcag 10080
gctttccgtt gaaaaaagta aaaccaatgc ctactttagt gtcttggaga atcaaatgaa 10140
cagttgaaac ttgcttatat ttgaaagctt atgtgttccc tgataattca gatatatacc 10200
agagttccct gaatagttta atctcccatg agtaatattg cgtgcattca atataaatgt 10260
aatattcaga gacttccgca gatatgttac tgcagtgcag tttttaattt gctatttgcc 10320
ttgcactctt atattcacaa tagttttgag tcatggtttc atgatttgct ggcattggta 10380
taggactctg atgaggagga tgaaccaaag cgagaataca ctgcagctgg actggctttg 10440
aaggaaaaat agtatgctat ctatcccttt atctccctcc ctctccctca tgctaaggct 10500
ggggattcct atacttactt tcgcatgtgc ccttatcatc aggcattgat ttacttctga 10560
ttgtaacagt gaaaaactcc gagctagaca aaaggaaagg attgctcagc gccatgtgat 10620
taagaattat gctgatgaca gacttgaaga attcatgaaa ctatatgatt ccagtgcaaa 10680
tcccttgaga attgtagaag atcccaatcc tgtgcagcca tctggggcta aacgtctcgg 10740
tgaatcaact gcagaaatga agcaatcctc gaagaaaacc aagagatatc ctgaaattcc 10800
tcaagagctt tatgccaagc ttactggcaa tgctgcttca tcaaaacatc acccaaaggc 10860
agcagatatc tccaattcag gaactccaca tcacctttta cctgttcttg gcctttgtgc 10920
tccaaatgct gatcagatga actcatataa agggtcagtt tgtgggccaa gcacaaagga 10980
gcaaaaaaga gctagtggtg aactagccaa caaaccgctg ttgactcctg ctgttgatca 11040
ttctagcgaa caaaaacatg atggccaacc aactccttgt aagcctatgt ttcctggttc 11100
ctccgaggag actttgcgaa ggctgaataa tatcattcca gacagttact tccccttcca 11160
acctgtatgt cctcttcttt ctttggtagc atattatttc atctagttgc tttatcgttg 11220
ttcatgcttt ttcttcaaaa gtgaaaaata taagatagtt gtccacttta tacttattag 11280
gaggaaatgg tgcaacctac cctgatatta gtttttaaaa tattttttat ggatgcaaaa 11340
ttgggaaaaa aagaatccat tcttgagtac agcatatatg atgttttatc tagttaagag 11400
catcattaaa gaaaaagaat gacaaggttt ttgtgtgcag attcctccta tatccgggaa 11460
ggggattggt gatcatgtag aaaatcctgt atcgtccatt ccttcatttc aagggaaact 11520
gggtcttcct aattttagtc tggaagacag tattccactt aagcatttga agtcagtacc 11580
ggatctattt cccaacttgt ctttgggcac tagcaatgaa tatcttcgta attgtgtccc 11640
agaattgcca aatagttcat ttctaccaag ctttatggca gatattgctg gaacttcaaa 11700
gcagaagaac aagttcatgg cagatatgtc tggccttctt ccaggtttgg caatcaaccc 11760
agttcaacaa atccattcgt ccatgcctga aaatcataag aaggtcttgg acaaattaat 11820
gatgcgtgct cagtactcct caagcaagtt cttgaagaat gcctcaaata aattcctgaa 11880
gaagagttta aaaccagact attggtcaga agatgaactc gatgctttgt ggattggggt 11940
tcgcaggcat ggaagaggaa attgggaggc catgcttaga gatccaaagc tgaagttttt 12000
gagccaccga tctcatgaag agctggcctc aagatggatt ttggaggagc agaaaattat 12060
agaggaacca atgcctacag ccaccagaag ctccaactct acatcatttc ctggcatatc 12120
ggatgcaatg atgtctcggg cacttaatgg aagtagcttt tccaaactga ggatggagcc 12180
gccaaagttg cagtcccacc taactgacat tcagttaggt tgcaatgata taccaaccag 12240
attttctcat gttgagccca ctaattacat gaatttaagt gagggtggtc catcactgac 12300
accgtggcag gatttcaaaa atagatcagg acacagtgga gattttcctg gcccacttga 12360
caagtgggag aaacctgata tggggttgat cccaccattt atgccgaatc cttttatgaa 12420
ggaaagcatt gggtcactgc ccataaacag acacagcagt aattccattc agcagaatga 12480
agttggatca agttctcatg agagcatact tcatggtttt tcggacggac aggccaaatt 12540
attccatgag atgcaacggc gtgtgaagtt agggaaatta cccattgaga tgaatctgaa 12600
tcacacaaag ctgtcagatc ctctagctga gaactctggt gattttgaaa gttcaaaacc 12660
gaacaagcta ccgcactggc ttcaggaggc tgtgcgtgca cctccatcca agccacctga 12720
atgtgagcta ccagcaactg tttcagctat tgctcagtct gtgtgcctac tacttggaga 12780
gcaaaaacca gcaatacctc cattcccgat tccaggacct cgtctctctc tccccaagga 12840
cccaaggagt gctccaaaga agaggagagt tcacaaagtt cagcaagctt cctccctggt 12900
agatcattcc aaaactacag ttgggcaagg tgaccacaac tctactccgt cagcaccact 12960
atccatggaa gccgcacctg cctctcctgc agttattaaa agcagtgata ccccctcgct 13020
caacttgaac tcaccatctt catcatcagc tggcagtcgg gggcaggatg cgtcaacccc 13080
ttccactttt gaagaaccag aaagaaccat ggaagtttca gaacctgctt ctgtcgctgc 13140
tgccacttgc ccgtccaggc cagagcctcc tgagactggt actcacagaa tcgagttctc 13200
cgcggtagat gacatggata ctggatcttg tagatcacct gtgagggata ctcctgaccc 13260
tgacaatcag aagagcgaat tgtctggatc aggtaataca cctactgaac tttctgtatt 13320
accgttggtt gatgcacctg ggacgagcag cgaacctgct gtagtgcccg tatccagcga 13380
cgaggagtca acccaagagg gtgtaccagg caaagccgta agcaccggcg accaggagaa 13440
acggacgccc cctgatgaga gcgaaaattc aggtgcggca aatccagttt cggcagctca 13500
gacagctgac gaagataagg tggacgagat gatcacagat gagcattaga acttttgagc 13560
aatgagctca aatgcttatt tttcttccat ttagcgctgg gattttccct ttcccaatgg 13620
tttccagtgt gtggaggtat caggtacctg ccttttgtgt ttgtatgctt agcccagaat 13680
ccagatagag taaaaatcca gggactagta gtttagccct ctagtccagc gggagcaaac 13740
tctcgaaagc ctctatatac atgaagtgta tattttcaga catggtacct tggacatgga 13800
caagtattca tttatttatg cgtgtatgat ttagatagtc cgtttacc 13848
 
<210> 2
<211> 6780
<212> CDS
<213> paddy rice (Oryza sativa)
<400> 2
atgatgaagg agcggagctc tttatgtgaa agtgcggcag atggaagttg ggttttgaaa 60
tacaaaagga aacggagcaa gctaacagtt agtccatcaa gtgagcatga tgcttcctca 120
ccaatactgg attctcaaat gaacaatggc tccatcaaaa agaagatcaa acatgacact 180
aacatttctc catcaaccaa gaagataaga ggacatgacg ggtacttcta cgagtgtgta 240
gaatgtgatc tcggtggcaa tttgctgtgc tgtgatagct gtccacgaac ataccacttg 300
gaatgtctta atcctcctct caagcgtgca ccacctggaa attggcaatg cccaagatgt 360
cgtacaaaaa aagttagctt gaagctctta gacaatgctg atgctgacac ctctaaacgt 420
gaaagaacaa ggagaatgcg cacaagcacc acatcagata gcccatcccc atctccacaa 480
aacaaagcct cttttaacac atcacgtggt gctgcattta gggatgatga accaggtgca 540
aaagacaatg aagttgagaa aaggaaacca ttgatattac atttgaagaa gcgttcaacc 600
aaggaactat ctacagatac cacatcatca aagtcagggt tacttggaaa gtcttcagaa 660
gagaaacagg agaaacacgg aagtgctttg aaagtgaaga aacatctgca tcccatggaa 720
ttatctccaa agaaatataa gaacaagaag caacacaatc acagagacag taagagatcc 780
gaagcaaaaa aggtccaata tttggcatca gatgtggaca gtgattcttc aatggaacca 840
tctacttctc ttgagcacag cgaatcgccg cccccaaaaa gaaaatcgtt ggatggaaga 900
acacctgcat caagtaccaa gaaaggaaaa aagaaagtga aatttgttga taaaaagcac 960
cctgagaatg ctgttcatat aactgaaaag gagcatggtg gtgcaggaga caaaataaca 1020
actcaggggg atctgcaggt tgatcgcatc ctaggctgtc gacttcagac aagccaaatc 1080
atttcacctg cccatgcttc atcagagcag attgatatgg cccctcctag tgcatccggt 1140
gcaccagaac ctagtcaagc ccttttaaaa ggacttcatg aagaaattca gtcttctaat 1200
agtgatacta atgtgacaga ggatgcatgt gctgatgaat tagcaaacga tggtggggaa 1260
aataatttgg attgttctga tgctcaaaag gagagtaatg ttagatccca tggacacaag 1320
gaatcactta acgcaaaaga aatcatgaat acagcatcag catgttccgc tgatcaaatc 1380
gtcactgtta aggatgctgg agcagtacag acatatgtaa cagcttcagt aaatggtgaa 1440
tatgagacag taactgatat tccagaagaa aagaatgaca ccaaacatcc agtttccaaa 1500
gctgacacag aagtccacac taaacaagaa catacacctg atagtaaatt gcatgggaaa 1560
atacaagaaa ctgaattgaa ggagcacgac ggaactactt atgagttttt agttaaatgg 1620
gttggcaaat cgaatatcca taacagctgg atttctgaat ctgagctgaa agcattagca 1680
aaaaggaaac tagaaaacta caaagcaaag tacggaacag gtttgataaa catctgcaaa 1740
gaacaatggt gccaaccgca acgagttatt gctctgcgca cttctttaga tgaaatagaa 1800
gaggctttga tcaaatggtg tgcccttcca tatgacgaat gcacgtggga aagattagat 1860
gaacctacaa tggtgaagta tgcacatttg gtcactcagt tcaaaaaatt tgaatcccag 1920
gctttggata aggataaggg aggtagccat gcaaagccaa gggaacacca agagtttaat 1980
atgctggttg agcagccaaa agaactccag ggaggcatgc tcttccctca tcaactggaa 2040
gcattgaact ggctacgcaa atgctggtac aagtcaaaaa atgttatcct tgctgatgag 2100
atgggtcttg gaaagactgt gtctgcctgt gcttttctat catccctatg ttgtgaatat 2160
aagattaact tgccatgtct tgtcttggtt cctctttcta ctatgcccaa ctggatggct 2220
gaatttgcat catgggcacc tcatttaaat gttgtggagt atcatggttc tgcacgggca 2280
agatctatta ttcgtcaata tgagtggcat gagggtgatg caagccagat gggtaaaatc 2340
aagaaatctc ataagttcaa tgtattgctc actacttatg aaatggtgct tgttgatgct 2400
gcatatcttc ggtctgtgtc atgggaggtt cttatagtcg atgagggtca tcgtctgaag 2460
aattctagca gcaaactttt cagtttactc aatacattat catttcagca tagagttttg 2520
ctgactggaa ctccgttaca gaataacatt ggtgaaatgt ataacttatt gaacttctta 2580
caacctgctt ctttcccttc tctagcttca tttgaggaga aattcaatga ccttacaaca 2640
acagagaaag tggaggagct gaagaacctt gtagctccac atatgcttcg aagactgaaa 2700
aaggatgcaa tgcaaaatat ccctccaaag actgaacgaa tggtgcctgt tgaattgaca 2760
tcaatccagg ctgaatacta ccgtgctatg cttacaaaga actaccaagt attgcgcaat 2820
attgggaaag gtggtgctca ccagtcattg ttgaacatag taatgcaact tcggaaagtc 2880
tgcaatcatc cgtatcttat tcctggaact gaacctgaat caggatcacc agagttcttg 2940
catgaaatgc gaataaaggc ctcagcaaag ttaactttgt tgcactctat gcttaaaatc 3000
ctacacaagg atggtcatcg agttcttatt ttttctcaga tgacaaagct tcttgacatc 3060
cttgaagatt acctgacttg ggagtttggt ccgaaaacat ttgaaagagt ggatggttca 3120
gtatctgtgg cagaacgcca ggcagcaatt gctcgtttta atcaggacaa gagtcgtttt 3180
gtattcctgc tatctacgcg gtcatgtggg cttggaatta atttggcaac tgcagatact 3240
gttatcatat atgattctga tttcaatcca catgctgata tacaggcaat gaacagagca 3300
cacagaattg gacagtcaaa cagactttta gtttacaggc ttgtcgtgcg tgctagtgtt 3360
gaggagcgta tcttgcacct tgcgaagaaa aaattgatgc ttgatcaact ttttgttaac 3420
aaatcagaat cacagaagga agtggaagat atcattcgct ggggaacaga ggaactcttc 3480
aggaatagcg atgttgcagt taaagataat aatgaagctt ctggtgctaa aaatgatgta 3540
gcagaggttg agtttaagca taaaagaaaa actggtggac taggcgatgt ttatgaagac 3600
agatgtgctg atggttctgc taaatttatt tgggatgaaa atgctatcac aaagcttctt 3660
gacagatcca acgttccatc aacagtagct gaaagcactg atggggactt ggacaatgat 3720
atgcttggca ctgtaaagtc aatagattgg aacgatgagc tgaatgatga ccctggtgcc 3780
accgaggaca tcccaaatat tgataatgat ggttgcgagc aggcatctga agcaaagcag 3840
gatgcagcta atcgtgttga agaaaatgaa tgggataaac tcttacgtgt cagatgggag 3900
cagtatcaaa ctgaggagga agcatctctt ggtcgaggta agcgtttaag gaaggctgtt 3960
tcttacaggg aaacatttgc aaccattcct aatgaagctt taagcgagga ctctgatgag 4020
gaggatgaac caaagcgaga atacactgca gctggactgg ctttgaagga aaaatatgaa 4080
aaactccgag ctagacaaaa ggaaaggatt gctcagcgcc atgtgattaa gaattatgct 4140
gatgacagac ttgaagaatt catgaaacta tatgattcca gtgcaaatcc cttgagaatt 4200
gtagaagatc ccaatcctgt gcagccatct ggggctaaac gtctcggtga atcaactgca 4260
gaaatgaagc aatcctcgaa gaaaaccaag agatatcctg aaattcctca agagctttat 4320
gccaagctta ctggcaatgc tgcttcatca aaacatcacc caaaggcagc agatatctcc 4380
aattcaggaa ctccacatca ccttttacct gttcttggcc tttgtgctcc aaatgctgat 4440
cagatgaact catataaagg gtcagtttgt gggccaagca caaaggagca aaaaagagct 4500
agtggtgaac tagccaacaa accgctgttg actcctgctg ttgatcattc tagcgaacaa 4560
aaacatgatg gccaaccaac tccttgtaag cctatgtttc ctggttcctc cgaggagact 4620
ttgcgaaggc tgaataatat cattccagac agttacttcc ccttccaacc tattcctcct 4680
atatccggga aggggattgg tgatcatgta gaaaatcctg tatcgtccat tccttcattt 4740
caagggaaac tgggtcttcc taattttagt ctggaagaca gtattccact taagcatttg 4800
aagtcagtac cggatctatt tcccaacttg tctttgggca ctagcaatga atatcttcgt 4860
aattgtgtcc cagaattgcc aaatagttca tttctaccaa gctttatggc agatattgct 4920
ggaacttcaa agcagaagaa caagttcatg gcagatatgt ctggccttct tccaggtttg 4980
gcaatcaacc cagttcaaca aatccattcg tccatgcctg aaaatcataa gaaggtcttg 5040
gacaaattaa tgatgcgtgc tcagtactcc tcaagcaagt tcttgaagaa tgcctcaaat 5100
aaattcctga agaagagttt aaaaccagac tattggtcag aagatgaact cgatgctttg 5160
tggattgggg ttcgcaggca tggaagagga aattgggagg ccatgcttag agatccaaag 5220
ctgaagtttt tgagccaccg atctcatgaa gagctggcct caagatggat tttggaggag 5280
cagaaaatta tagaggaacc aatgcctaca gccaccagaa gctccaactc tacatcattt 5340
cctggcatat cggatgcaat gatgtctcgg gcacttaatg gaagtagctt ttccaaactg 5400
aggatggagc cgccaaagtt gcagtcccac ctaactgaca ttcagttagg ttgcaatgat 5460
ataccaacca gattttctca tgttgagccc actaattaca tgaatttaag tgagggtggt 5520
ccatcactga caccgtggca ggatttcaaa aatagatcag gacacagtgg agattttcct 5580
ggcccacttg acaagtggga gaaacctgat atggggttga tcccaccatt tatgccgaat 5640
ccttttatga aggaaagcat tgggtcactg cccataaaca gacacagcag taattccatt 5700
cagcagaatg aagttggatc aagttctcat gagagcatac ttcatggttt ttcggacgga 5760
caggccaaat tattccatga gatgcaacgg cgtgtgaagt tagggaaatt acccattgag 5820
atgaatctga atcacacaaa gctgtcagat cctctagctg agaactctgg tgattttgaa 5880
agttcaaaac cgaacaagct accgcactgg cttcaggagg ctgtgcgtgc acctccatcc 5940
aagccacctg aatgtgagct accagcaact gtttcagcta ttgctcagtc tgtgtgccta 6000
ctacttggag agcaaaaacc agcaatacct ccattcccga ttccaggacc tcgtctctct 6060
ctccccaagg acccaaggag tgctccaaag aagaggagag ttcacaaagt tcagcaagct 6120
tcctccctgg tagatcattc caaaactaca gttgggcaag gtgaccacaa ctctactccg 6180
tcagcaccac tatccatgga agccgcacct gcctctcctg cagttattaa aagcagtgat 6240
accccctcgc tcaacttgaa ctcaccatct tcatcatcag ctggcagtcg ggggcaggat 6300
gcgtcaaccc cttccacttt tgaagaacca gaaagaacca tggaagtttc agaacctgct 6360
tctgtcgctg ctgccacttg cccgtccagg ccagagcctc ctgagactgg tactcacaga 6420
atcgagttct ccgcggtaga tgacatggat actggatctt gtagatcacc tgtgagggat 6480
actcctgacc ctgacaatca gaagagcgaa ttgtctggat caggtaatac acctactgaa 6540
ctttctgtat taccgttggt tgatgcacct gggacgagca gcgaacctgc tgtagtgccc 6600
gtatccagcg acgaggagtc aacccaagag ggtgtaccag gcaaagccgt aagcaccggc 6660
gaccaggaga aacggacgcc ccctgatgag agcgaaaatt caggtgcggc aaatccagtt 6720
tcggcagctc agacagctga cgaagataag gtggacgaga tgatcacaga tgagcattag 6780
 
<210> 3
<211> 2259
<212> PRT
<213> paddy rice (Oryza sativa)
<400> 3
Met Met Lys Glu Arg Ser Ser Leu Cys Glu Ser Ala Ala Asp Gly Ser Trp Val Leu Lys Tyr Lys Arg Lys Arg Ser Lys Leu Thr Val Ser Pro Ser Ser Glu His Asp Ala Ser Ser Pro Ile Leu Asp Ser Gln Met Asn Asn Gly Ser Ile Lys Lys Lys Ile Lys His Asp Thr Asn Ile Ser Pro Ser Thr Lys Lys Ile Arg Gly His Asp Gly Tyr Phe Tyr Glu Cys Val Glu Cys Asp Leu Gly Gly Asn Leu Leu Cys Cys Asp Ser Cys Pro Arg Thr Tyr His Leu Glu Cys Leu Asn Pro Pro Leu Lys Arg Ala Pro Pro Gly Asn Trp Gln Cys Pro Arg Cys Arg Thr Lys Lys Val Ser Leu Lys Leu Leu Asp Asn Ala Asp Ala Asp Thr Ser Lys Arg Glu Arg Thr Arg Arg Met Arg Thr Ser Thr Thr Ser Asp Ser Pro Ser Pro Ser Pro Gln Asn Lys Ala Ser Phe Asn Thr Ser Arg Gly Ala Ala Phe Arg Asp Asp Glu Pro Gly Ala Lys Asp Asn Glu Val Glu Lys Arg Lys Pro Leu Ile Leu His Leu Lys Lys Arg Ser Thr Lys Glu Leu Ser Thr Asp Thr Thr Ser Ser Lys Ser Gly Leu Leu Gly Lys Ser Ser Glu Glu Lys Gln Glu Lys His Gly Ser Ala Leu Lys Val Lys Lys His Leu His Pro Met Glu Leu Ser Pro Lys Lys Tyr Lys Asn Lys Lys Gln His Asn His Arg Asp Ser Lys Arg Ser Glu Ala Lys Lys Val Gln Tyr Leu Ala Ser Asp Val Asp Ser Asp Ser Ser Met Glu Pro Ser Thr Ser Leu Glu His Ser Glu Ser Pro Pro Pro Lys Arg Lys Ser Leu Asp Gly Arg Thr Pro Ala Ser Ser Thr Lys Lys Gly Lys Lys Lys Val Lys Phe Val Asp Lys Lys His Pro Glu Asn Ala Val His Ile Thr Glu Lys Glu His Gly Gly Ala Gly Asp Lys Ile Thr Thr Gln Gly Asp Leu Gln Val Asp Arg Ile Leu Gly Cys Arg Leu Gln Thr Ser Gln Ile Ile Ser Pro Ala His Ala Ser Ser Glu Gln Ile Asp Met Ala Pro Pro Ser Ala Ser Gly Ala Pro Glu Pro Ser Gln Ala Leu Leu Lys Gly Leu His Glu Glu Ile Gln Ser Ser Asn Ser Asp Thr Asn Val Thr Glu Asp Ala Cys Ala Asp Glu Leu Ala Asn Asp Gly Gly Glu Asn Asn Leu Asp Cys Ser Asp Ala Gln Lys Glu Ser Asn Val Arg Ser His Gly His Lys Glu Ser Leu Asn Ala Lys Glu Ile Met Asn Thr Ala Ser Ala Cys Ser Ala Asp Gln Ile Val Thr Val Lys Asp Ala Gly Ala Val Gln Thr Tyr Val Thr Ala Ser Val Asn Gly Glu Tyr Glu Thr Val Thr Asp Ile Pro Glu Glu Lys Asn Asp Thr Lys His Pro Val Ser Lys Ala Asp Thr Glu Val His Thr Lys Gln Glu His Thr Pro Asp Ser Lys Leu His Gly Lys Ile Gln Glu Thr Glu Leu Lys Glu His Asp Gly Thr Thr Tyr Glu Phe Leu Val Lys Trp Val Gly Lys Ser Asn Ile His Asn Ser Trp Ile Ser Glu Ser Glu Leu Lys Ala Leu Ala Lys Arg Lys Leu Glu Asn Tyr Lys Ala Lys Tyr Gly Thr Gly Leu Ile Asn Ile Cys Lys Glu Gln Trp Cys Gln Pro Gln Arg Val Ile Ala Leu Arg Thr Ser Leu Asp Glu Ile Glu Glu Ala Leu Ile Lys Trp Cys Ala Leu Pro Tyr Asp Glu Cys Thr Trp Glu Arg Leu Asp Glu Pro Thr Met Val Lys Tyr Ala His Leu Val Thr Gln Phe Lys Lys Phe Glu Ser Gln Ala Leu Asp Lys Asp Lys Gly Gly Ser His Ala Lys Pro Arg Glu His Gln Glu Phe Asn Met Leu Val Glu Gln Pro Lys Glu Leu Gln Gly Gly Met Leu Phe Pro His Gln Leu Glu Ala Leu Asn Trp Leu Arg Lys Cys Trp Tyr Lys Ser Lys Asn Val Ile Leu Ala Asp Glu Met Gly Leu Gly Lys Thr Val Ser Ala Cys Ala Phe Leu Ser Ser Leu Cys Cys Glu Tyr Lys Ile Asn Leu Pro Cys Leu Val Leu Val Pro Leu Ser Thr Met Pro Asn Trp Met Ala Glu Phe Ala Ser Trp Ala Pro His Leu Asn Val Val Glu Tyr His Gly Ser Ala Arg Ala Arg Ser Ile Ile Arg Gln Tyr Glu Trp His Glu Gly Asp Ala Ser Gln Met Gly Lys Ile Lys Lys Ser His Lys Phe Asn Val Leu Leu Thr Thr Tyr Glu Met Val Leu Val Asp Ala Ala Tyr Leu Arg Ser Val Ser Trp Glu Val Leu Ile Val Asp Glu Gly His Arg Leu Lys Asn Ser Ser Ser Lys Leu Phe Ser Leu Leu Asn Thr Leu Ser Phe Gln His Arg Val Leu Leu Thr Gly Thr Pro Leu Gln Asn Asn Ile Gly Glu Met Tyr Asn Leu Leu Asn Phe Leu Gln Pro Ala Ser Phe Pro Ser Leu Ala Ser Phe Glu Glu Lys Phe Asn Asp Leu Thr Thr Thr Glu Lys Val Glu Glu Leu Lys Asn Leu Val Ala Pro His Met Leu Arg Arg Leu Lys Lys Asp Ala Met Gln Asn Ile Pro Pro Lys Thr Glu Arg Met Val Pro Val Glu Leu Thr Ser Ile Gln Ala Glu Tyr Tyr Arg Ala Met Leu Thr Lys Asn Tyr Gln Val Leu Arg Asn Ile Gly Lys Gly Gly Ala His Gln Ser Leu Leu Asn Ile Val Met Gln Leu Arg Lys Val Cys Asn His Pro Tyr Leu Ile Pro Gly Thr Glu Pro Glu Ser Gly Ser Pro Glu Phe Leu His Glu Met Arg Ile Lys Ala Ser Ala Lys Leu Thr Leu Leu His Ser Met Leu Lys Ile Leu His Lys Asp Gly His Arg Val Leu Ile Phe Ser Gln Met Thr Lys Leu Leu Asp Ile Leu Glu Asp Tyr Leu Thr Trp Glu Phe Gly Pro Lys Thr Phe Glu Arg Val Asp Gly Ser Val Ser Val Ala Glu Arg Gln Ala Ala Ile Ala Arg Phe Asn Gln Asp Lys Ser Arg Phe Val Phe Leu Leu Ser Thr Arg Ser Cys Gly Leu Gly Ile Asn Leu Ala Thr Ala Asp Thr Val Ile Ile Tyr Asp Ser Asp Phe Asn Pro His Ala Asp Ile Gln Ala Met Asn Arg Ala His Arg Ile Gly Gln Ser Asn Arg Leu Leu Val Tyr Arg Leu Val Val Arg Ala Ser Val Glu Glu Arg Ile Leu His Leu Ala Lys Lys Lys Leu Met Leu Asp Gln Leu Phe Val Asn Lys Ser Glu Ser Gln Lys Glu Val Glu Asp Ile Ile Arg Trp Gly Thr Glu Glu Leu Phe Arg Asn Ser Asp Val Ala Val Lys Asp Asn Asn Glu Ala Ser Gly Ala Lys Asn Asp Val Ala Glu Val Glu Phe Lys His Lys Arg Lys Thr Gly Gly Leu Gly Asp Val Tyr Glu Asp Arg Cys Ala Asp Gly Ser Ala Lys Phe Ile Trp Asp Glu Asn Ala Ile Thr Lys Leu Leu Asp Arg Ser Asn Val Pro Ser Thr Val Ala Glu Ser Thr Asp Gly Asp Leu Asp Asn Asp Met Leu Gly Thr Val Lys Ser Ile Asp Trp Asn Asp Glu Leu Asn Asp Asp Pro Gly Ala Thr Glu Asp Ile Pro Asn Ile Asp Asn Asp Gly Cys Glu Gln Ala Ser Glu Ala Lys Gln Asp Ala Ala Asn Arg Val Glu Glu Asn Glu Trp Asp Lys Leu Leu Arg Val Arg Trp Glu Gln Tyr Gln Thr Glu Glu Glu Ala Ser Leu Gly Arg Gly Lys Arg Leu Arg Lys Ala Val Ser Tyr Arg Glu Thr Phe Ala Thr Ile Pro Asn Glu Ala Leu Ser Glu Asp Ser Asp Glu Glu Asp Glu Pro Lys Arg Glu Tyr Thr Ala Ala Gly Leu Ala Leu Lys Glu Lys Tyr Glu Lys Leu Arg Ala Arg Gln Lys Glu Arg Ile Ala Gln Arg His Val Ile Lys Asn Tyr Ala Asp Asp Arg Leu Glu Glu Phe Met Lys Leu Tyr Asp Ser Ser Ala Asn Pro Leu Arg Ile Val Glu Asp Pro Asn Pro Val Gln Pro Ser Gly Ala Lys Arg Leu Gly Glu Ser Thr Ala Glu Met Lys Gln Ser Ser Lys Lys Thr Lys Arg Tyr Pro Glu Ile Pro Gln Glu Leu Tyr Ala Lys Leu Thr Gly Asn Ala Ala Ser Ser Lys His His Pro Lys Ala Ala Asp Ile Ser Asn Ser Gly Thr Pro His His Leu Leu Pro Val Leu Gly Leu Cys Ala Pro Asn Ala Asp Gln Met Asn Ser Tyr Lys Gly Ser Val Cys Gly Pro Ser Thr Lys Glu Gln Lys Arg Ala Ser Gly Glu Leu Ala Asn Lys Pro Leu Leu Thr Pro Ala Val Asp His Ser Ser Glu Gln Lys His Asp Gly Gln Pro Thr Pro Cys Lys Pro Met Phe Pro Gly Ser Ser Glu Glu Thr Leu Arg Arg Leu Asn Asn Ile Ile Pro Asp Ser Tyr Phe Pro Phe Gln Pro Ile Pro Pro Ile Ser Gly Lys Gly Ile Gly Asp His Val Glu Asn Pro Val Ser Ser Ile Pro Ser Phe Gln Gly Lys Leu Gly Leu Pro Asn Phe Ser Leu Glu Asp Ser Ile Pro Leu Lys His Leu Lys Ser Val Pro Asp Leu Phe Pro Asn Leu Ser Leu Gly Thr Ser Asn Glu Tyr Leu Arg Asn Cys Val Pro Glu Leu Pro Asn Ser Ser Phe Leu Pro Ser Phe Met Ala Asp Ile Ala Gly Thr Ser Lys Gln Lys Asn Lys Phe Met Ala Asp Met Ser Gly Leu Leu Pro Gly Leu Ala Ile Asn Pro Val Gln Gln Ile His Ser Ser Met Pro Glu Asn His Lys Lys Val Leu Asp Lys Leu Met Met Arg Ala Gln Tyr Ser Ser Ser Lys Phe Leu Lys Asn Ala Ser Asn Lys Phe Leu Lys Lys Ser Leu Lys Pro Asp Tyr Trp Ser Glu Asp Glu Leu Asp Ala Leu Trp Ile Gly Val Arg Arg His Gly Arg Gly Asn Trp Glu Ala Met Leu Arg Asp Pro Lys Leu Lys Phe Leu Ser His Arg Ser His Glu Glu Leu Ala Ser Arg Trp Ile Leu Glu Glu Gln Lys Ile Ile Glu Glu Pro Met Pro Thr Ala Thr Arg Ser Ser Asn Ser Thr Ser Phe Pro Gly Ile Ser Asp Ala Met Met Ser Arg Ala Leu Asn Gly Ser Ser Phe Ser Lys Leu Arg Met Glu Pro Pro Lys Leu Gln Ser His Leu Thr Asp Ile Gln Leu Gly Cys Asn Asp Ile Pro Thr Arg Phe Ser His Val Glu Pro Thr Asn Tyr Met Asn Leu Ser Glu Gly Gly Pro Ser Leu Thr Pro Trp Gln Asp Phe Lys Asn Arg Ser Gly His Ser Gly Asp Phe Pro Gly Pro Leu Asp Lys Trp Glu Lys Pro Asp Met Gly Leu Ile Pro Pro Phe Met Pro Asn Pro Phe Met Lys Glu Ser Ile Gly Ser Leu Pro Ile Asn Arg His Ser Ser Asn Ser Ile Gln Gln Asn Glu Val Gly Ser Ser Ser His Glu Ser Ile Leu His Gly Phe Ser Asp Gly Gln Ala Lys Leu Phe His Glu Met Gln Arg Arg Val Lys Leu Gly Lys Leu Pro Ile Glu Met Asn Leu Asn His Thr Lys Leu Ser Asp Pro Leu Ala Glu Asn Ser Gly Asp Phe Glu Ser Ser Lys Pro Asn Lys Leu Pro His Trp Leu Gln Glu Ala Val Arg Ala Pro Pro Ser Lys Pro Pro Glu Cys Glu Leu Pro Ala Thr Val Ser Ala Ile Ala Gln Ser Val Cys Leu Leu Leu Gly Glu Gln Lys Pro Ala Ile Pro Pro Phe Pro Ile Pro Gly Pro Arg Leu Ser Leu Pro Lys Asp Pro Arg Ser Ala Pro Lys Lys Arg Arg Val His Lys Val Gln Gln Ala Ser Ser Leu Val Asp His Ser Lys Thr Thr Val Gly Gln Gly Asp His Asn Ser Thr Pro Ser Ala Pro Leu Ser Met Glu Ala Ala Pro Ala Ser Pro Ala Val Ile Lys Ser Ser Asp Thr Pro Ser Leu Asn Leu Asn Ser Pro Ser Ser Ser Ser Ala Gly Ser Arg Gly Gln Asp Ala Ser Thr Pro Ser Thr Phe Glu Glu Pro Glu Arg Thr Met Glu Val Ser Glu Pro Ala Ser Val Ala Ala Ala Thr Cys Pro Ser Arg Pro Glu Pro Pro Glu Thr Gly Thr His Arg Ile Glu Phe Ser Ala Val Asp Asp Met Asp Thr Gly Ser Cys Arg Ser Pro Val Arg Asp Thr Pro Asp Pro Asp Asn Gln Lys Ser Glu Leu Ser Gly Ser Gly Asn Thr Pro Thr Glu Leu Ser Val Leu Pro Leu Val Asp Ala Pro Gly Thr Ser Ser Glu Pro Ala Val Val Pro Val Ser Ser Asp Glu Glu Ser Thr Gln Glu Gly Val Pro Gly Lys Ala Val Ser Thr Gly Asp Gln Glu Lys Arg Thr Pro Pro Asp Glu Ser Glu Asn Ser Gly Ala Ala Asn Pro Val Ser Ala Ala Gln Thr Ala Asp Glu Asp Lys Val Asp Glu Met Ile Thr Asp Glu His
 
 

Claims (10)

1., to Plant Height of Rice, tiller number and a leaf relevant protein PALS1, its aminoacid sequence is as shown in SEQ ID NO:3.
2. the encoding gene of protein as claimed in claim 1 pALS1, its nucleotide sequence is as shown in SEQ ID NO:1 or SEQ ID NO:2.
3. an interference carrier, is characterized in that: choose described in claim 2 pALS1the conserved sequence of gene is as special interference region.
4. interference carrier as claimed in claim 3, is characterized in that: it utilizes pLHRNAi interference carrier to obtain as framework construction.
5. the interference carrier as described in claim 3 or 4, is characterized in that: it is chosen described in claim 2 pALS1the conserved sequence of 346 bp in gene C DS 1040-1385 interval is as special interference region.
6. comprise the plasmid of gene described in claim 2 and the plant expression vector of gene.
7. host cell, is characterized in that: this host cell contains a part for gene according to claim 2 or gene.
8. host cell as claimed in claim 7, is characterized in that: this cell is Bacillus coli cells, agrobatcerium cell or vegetable cell.
9. cultivate the method for transgenic plant: it is characterized in that comprising the gene transformation rice cell using SEQ ID NO:1 or the nucleotide sequence shown in SEQ ID NO:2, and rice plant obtained thus.
10. as claimed in claim 2 pALS1the purposes of interference carrier described in gene or any one of claim 3-5, it is characterized in that: for building the transgene carrier of rice transformation, be changed plant type and leaf transgenic paddy rice, described transgenic paddy rice at least has following a kind of feature:
1) plant height of described transgenic paddy rice is less than described rice transformation kind;
2) tiller number of described transgenic paddy rice is less than described rice transformation kind;
3) leaf of described transgenic paddy rice is wide is less than described rice transformation kind with leaf is long;
Described paddy rice is specially japonica rice.
CN201410691772.4A 2014-11-27 2014-11-27 Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1 Pending CN104402981A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410691772.4A CN104402981A (en) 2014-11-27 2014-11-27 Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410691772.4A CN104402981A (en) 2014-11-27 2014-11-27 Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1

Publications (1)

Publication Number Publication Date
CN104402981A true CN104402981A (en) 2015-03-11

Family

ID=52640659

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410691772.4A Pending CN104402981A (en) 2014-11-27 2014-11-27 Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1

Country Status (1)

Country Link
CN (1) CN104402981A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107353331A (en) * 2016-05-10 2017-11-17 中国农业科学院作物科学研究所 Application of the oil body GAP-associated protein GAP in plant wax content is regulated and controled
CN109721649A (en) * 2019-03-14 2019-05-07 中国水稻研究所 A kind of plant type of rice regulation related gene, protein and application
CN113151336A (en) * 2021-04-02 2021-07-23 山东银河生物科技有限公司 Method for constructing hyaluronic acid engineering strain by recombinant expression plasmid and application

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102153638A (en) * 2011-03-24 2011-08-17 浙江大学 Gene OsCHR4 for controlling adventitious root elongation and leaf color of rice and application
CN102787122A (en) * 2012-06-21 2012-11-21 南京农业大学 Gene OsEHD4 for controlling paddy rice heading stage and mutant and application thereof
CN103045613A (en) * 2012-12-28 2013-04-17 中国农业科学院作物科学研究所 Rice NWL1 gene, as well as encoding protein and application thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102153638A (en) * 2011-03-24 2011-08-17 浙江大学 Gene OsCHR4 for controlling adventitious root elongation and leaf color of rice and application
CN102787122A (en) * 2012-06-21 2012-11-21 南京农业大学 Gene OsEHD4 for controlling paddy rice heading stage and mutant and application thereof
CN103045613A (en) * 2012-12-28 2013-04-17 中国农业科学院作物科学研究所 Rice NWL1 gene, as well as encoding protein and application thereof

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107353331A (en) * 2016-05-10 2017-11-17 中国农业科学院作物科学研究所 Application of the oil body GAP-associated protein GAP in plant wax content is regulated and controled
CN107353331B (en) * 2016-05-10 2020-12-04 中国农业科学院作物科学研究所 Application of oil body related protein in regulation and control of plant wax content
CN109721649A (en) * 2019-03-14 2019-05-07 中国水稻研究所 A kind of plant type of rice regulation related gene, protein and application
CN113151336A (en) * 2021-04-02 2021-07-23 山东银河生物科技有限公司 Method for constructing hyaluronic acid engineering strain by recombinant expression plasmid and application
CN113151336B (en) * 2021-04-02 2022-09-06 山东银河生物科技有限公司 Method for constructing hyaluronic acid engineering strain by recombinant expression plasmid and application

Similar Documents

Publication Publication Date Title
AU2016216734B2 (en) Maize cytoplasmic male sterility (CMS) C-type restorer RF4 gene, molecular markers and their use
CN100554423C (en) A kind of rice grain grain length and heavy major gene GS3 of grain of controlling
CN107164401A (en) A kind of method and application that rice Os PIL15 mutant is prepared based on CRISPR/Cas9 technologies
CN101704881B (en) Plant male fertility-associated protein, coding gene and application thereof
US20220396805A1 (en) Dna sequence for regulating maize leaf angle, and mutant, molecular markers, detection primers, and use thereof
CN111996209B (en) Parthenogenesis haploid inducing gene DMP and application thereof
AU2020235775B2 (en) Rice bacterial blight resistance protein, coding gene thereof and use therefor
CN108291234A (en) Multiple sporinite forms gene
EP3932939A1 (en) Zmwak-rlk protein related to gray leaf spot resistance, and encoding gene and application thereof
CN112375130A (en) Corn ear length gene and molecular marker and application thereof
CN108864266B (en) Protein SSH1 related to rice graininess and grain type as well as encoding gene and application thereof
CN108218968B (en) A kind of plant seed character-related protein and its encoding gene and application
CN109134633B (en) Rice blast resistant protein and gene, isolated nucleic acid and application thereof
CN107603963A (en) A kind of rice honeysuckle small ear gene DF1 and its coding protein and application
CN104402981A (en) Protein PALS1 related to plant type and leaf shape character of rice and encoding gene and application of protein PALS1
CN111304219B (en) GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length
CN111826391B (en) Application of NHX2-GCD1 double gene or protein thereof
CN108623667B (en) Rice white spot leaf control gene WLML1, protein coded by same and application thereof
CN106589085A (en) Protein OsFLO8 related to plant starch synthesis and coding gene and application thereof
CN103524608B (en) Rice spike neck node regulation gene SUI1 (shorted uppermost Internode 1) and application thereof
CN109912706B (en) Gene, protein and molecular marker related to rice weakness and premature senility and application
CN107446031A (en) A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application
CN111763249B (en) Plant powdery mildew resistance related protein Pm5e, and coding gene and application thereof
CN114752601A (en) Gene for regulating and controlling rice stigma exsertion and application thereof
KR102539626B1 (en) Use of protein nog1 in controlling plant yield and number of grains per ear

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20150311

RJ01 Rejection of invention patent application after publication