CN110724685A - Transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof - Google Patents

Abstract

The invention discloses a flanking sequence of a transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insert and application thereof. The transgenic salt-tolerant herbicide-tolerant corn SR801 is subjected to re-sequencing and specific PCR technology to identify an insertion site, and the insertion site is expressed by SEQ ID NO: 1 is a left flank sequence of an exogenous gene, and the nucleotide sequence shown in SEQ ID NO: 2 is the right flank sequence of the exogenous gene. The invention provides a primer pair for detecting the flanking sequence, and the primer sequences are respectively shown as SEQ ID No: 6-7 and SEQ ID No: 8-9. The identification of the flanking sequence of the exogenous insertion fragment of the salt-tolerant herbicide-tolerant transgenic corn SR801 is suitable for detecting the transgenic corn SR801 including parents, hybrid F1 and descendants, and plants, tissues, seeds and products thereof.

Description

Transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof

Technical Field

The invention belongs to the technical field of biological genes, and particularly relates to a transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence and application thereof.

Background

Soil salinization is a worldwide problem, and nowadays, about 20% of arable land and 40% of irrigated land in the world are affected by salinization to different degrees. The total salinization area of China is 9.91 multiplied by 10⁷Hundred million hm²Although irrigation and drainage works can be carried out to improve saline-alkali soil, the method is difficult to develop for a long time due to high cost and short timeliness. China is a big agricultural country, has been the country with the largest corn planting area all over the world since 2014, and the yield of corn accounts for 90% of the total yield of coarse grains in China. The importance of corn is undoubted, however, many important corn growing areas have soil salinization and secondary salinization problems, which are also common throughout the world. The response of corn to salt stress is a character controlled by multiple genes, and scientists in various countries try to culture salt-tolerant excellent corn varieties through traditional breeding, molecular marker auxiliary technology, transgenic approaches and the like for many years, so that some progress is achieved. However, the identification of key genes related to high-salt stress response in corn and the cultivation work of salt-tolerant corn strains are far behind the researches on drought resistance, low-temperature stress resistance and the like.

NF-Y is a transcription factor widely present in eukaryotes and is capable of specifically binding to CCAAT-box, which is present as a cis-element in the eukaryotic gene promoter of about 1/4. NF-Y is a trimer, which includes NF-YA (CBF-B or HAP 2), NF-YB (CBF-A or HAP 3), NF-YC (CBF-C or HAP 5). In mammals, NF-YB and NF-YC are tightly combined together through a histone folding domain, then are combined with NF-YA in a nucleus to form a final trimeric transcription factor, the NF-YA can slide on chromatin to search a 25bp CCAAT-box element, once the NF-YA is found, the NF-YA can be combined with the NF-YA and inserted into a minor groove of a DNA double helix, so that the DNA double helix is in a relaxed state, RNA polymerase or other transcription factors are more favorably recruited, and further, the downstream target genes are positively or negatively regulated. NF-Y plays an important role as a conserved transcription factor in plant growth and development and in response to adversity stress.

Through the search of the existing patents and other documents, no report about the exogenous insertion vector flanking sequence of the transgenic corn event SR801 with salt tolerance and herbicide tolerance and the establishment of specific qualitative and quantitative PCR detection of the event by using the sequence is found.

Disclosure of Invention

The invention aims to provide a flanking sequence of a transgenic corn SR801 exogenous insert and application thereof.

The invention also aims to provide a PCR detection method and a kit for transgenic corn SR 801.

The method for cultivating the transgenic corn SR801 comprises the following steps: replacing bases between 21908318-21913504 sites of No. 5 chromosome of the target maize genome with exogenous DNA fragments to obtain transgenic maize;

the exogenous DNA fragment contains an expression cassette comprising two genes of ZmNF-YA14 and Bar, about 5186 bp;

the salt stress tolerance of the transgenic corn is higher than that of the target corn, and/or the glufosinate tolerance of the transgenic corn is higher than that of the target corn.

In the method, the corn ZmNF-YA14 gene is shown as SEQ ID NO: 3, the total length of the gene is 906bp, 301 amino acids are coded, the protein molecular weight is about 32.8kDa, and the expression of the ZmNF-YA14 gene can activate the expression of a series of stress-resistant related genes including antioxidant enzyme genes, obviously reduce the content of active oxygen in vivo, and greatly improve the comprehensive tolerance of the transgenic plant to high salt and drought.

The glufosinate-resistant gene Bar is a glufosinate-resistant gene from streptomyces hygroscopicus, and the nucleotide sequence of the glufosinate-resistant gene Bar is shown as SEQ ID NO: 4, the gene has the total length of 552bp, codes 183 amino acids, has the protein molecular weight of about 23kDa, can acetylate the herbicide glufosinate-ammonium, inhibit the activity of the glufosinate-ammonium, and finally achieve the effect of glufosinate-ammonium resistance.

Furthermore, the exogenous DNA fragment sequentially consists of the corn transcription factor ZmNF-YA14 expression cassette and the glufosinate-resistant gene bar expression cassette.

The corn transcription factor ZmNF-YA14 expression cassette consists of a corn ZmNubi promoter, a corn transcription factor ZmNF-YA14 and an NOS terminator in sequence. The corn ZmUbi promoter has the size of 2001bp, is a constitutive promoter and can drive a target gene to be expressed in all tissues of corn. The NOS terminator is 253bp in size and comes from a nopaline synthetase gene terminator in a T-DNA region of an Agrobacterium tumefaciens Ti plasmid to terminate the transcription of the ZmNF-YA14 gene.

The glufosinate-ammonium-resistant gene Bar expression cassette sequentially comprises a CaMV35S promoter, a glufosinate-ammonium-resistant gene Bar and a CaMVpolyA terminator. The size of the CaMV35S promoter is 781bp, is derived from cauliflower mosaic virus CaMV, and is responsible for starting the expression of the plant glufosinate-resistant gene Bar. The CaMV polyA terminator has the size of 185bp and terminates the transcription of the Bar gene.

Furthermore, the nucleotide sequence of the exogenous DNA fragment is specifically shown in SEQ ID NO: 5, respectively. The maize transformation event SR801 obtained by the method is a sequence obtained by converting SEQ ID NO: 5 into 21908318-21913504 of chromosome 5 of the maize genome, and replacing 53bp of the nucleotide sequence between 21908318-21908371 of chromosome 5 to obtain the transgenic maize. And the nucleotide sequence of the upstream flanking fragment upstream from position 21908318 and immediately adjacent to nucleotide 21908318 (left flanking sequence) is as set forth in SEQ ID NO: 1, the nucleotide sequence of the downstream flanking fragment downstream from position 21908371 and immediately downstream from nucleotide 21908371 (right flanking sequence) is as shown in SEQ ID NO: 2, respectively.

The maize transformation event SR801 is characterized in that an agrobacterium-mediated method is utilized, ZmNF-YA14 gene is connected into a modified pCAMbia3301 vector (CAMV35S promoter + GUS is replaced by Ubi promoter), and an expression box of a Bar gene is positioned in the same T-border, maize immature embryos are infected, BASTA is used as selection pressure, and transformed materials are screened and cultured to obtain transgenic seedlings. ZmNF-YA14 is driven by a ubiquitin gene promoter Ubi and terminated by a nopaline synthase gene NOS terminator, can be constitutively and efficiently expressed in corn, and an excellent transgenic strain SR801 is obtained by screening. Through molecular biological analysis, the molecular level and the transcription level of the ZmNF-YA14 gene are identified as positive, a transgenic pure line seed is further obtained through selfing, and the transgenic plant shows stronger salt tolerance under the condition of water culture.

In the above method, the corn of interest can be corn B104.

The method for detecting or assisting in detecting whether the plant sample to be detected is the transgenic corn obtained by the method or the progeny thereof comprises the following steps: detecting whether the genome DNA of the plant sample to be detected contains a DNA fragment A, wherein the DNA fragment A consists of a left flank sequence, the exogenous DNA fragment and a right flank sequence in sequence;

if the genomic DNA of the plant sample to be detected contains the DNA fragment A, the plant sample to be detected is or is selected as the transgenic corn or the descendant thereof;

if the genomic DNA of the plant sample to be detected does not contain the DNA fragment A, the plant sample to be detected is not or is not selected as the transgenic corn or the progeny thereof;

the method for detecting or assisting in detecting whether the plant sample to be detected is the transgenic corn or the descendant thereof obtained by the method is 1) or 2) as follows:

1) direct sequencing;

2) carrying out PCR amplification on the genome DNA of the plant sample to be detected by using a primer pair A and/or a primer pair B, detecting the size of an amplification product, and if the primer pair A is amplified to obtain a band with the size of 899bp and/or the primer pair B is amplified to obtain a band with the size of 1046bp, determining that the plant sample to be detected is or is a candidate of the transgenic corn or the descendant thereof; otherwise, the plant sample to be tested is not or is not a candidate for the transgenic maize or the progeny thereof;

the primer pair A consists of SEQ ID NO: 6 and SEQ ID NO: 7 is shown in the specification;

the primer pair B consists of SEQ ID NO: 8 and SEQ ID NO: 9, and (b) a single-stranded DNA molecule as shown in figure 9.

The kit for detecting or assisting in detecting whether a plant sample to be detected is the transgenic corn or the progeny thereof obtained by the method comprises a primer set consisting of the primer pair A and the primer pair B and/or a probe set consisting of the probe A and the probe B.

Compared with the prior art, the invention has the following excellent effects: the invention provides an excellent transformation event SR801, wherein the transformation event can realize the specific introduction of exogenous genes into a corn strain and endow receptor corn with the capabilities of salt stress resistance and herbicide glufosinate-ammonium resistance; the salt-tolerant stress gene and the glufosinate-tolerant gene can be stably inherited in the receptor corn; the expression of the salt-tolerant stress gene can improve the salt-tolerant capability and has no obvious difference with the agronomic characters of wild corn. According to the invention, flanking sequences at two ends of a transgenic corn event SR801 with salt and herbicide tolerance are obtained by a re-sequencing method, two pairs of specific PCR primers are designed according to sequence information of the two flanking sequences, and a detection method for the transgenic corn SR801 or progeny thereof is established. The invention provides a flanking sequence and a specific primer pair which are suitable for detecting transgenic maize SR801 or descendants thereof.

Drawings

FIG. 1 construction map of vector pCAMbia-Ubi-NFYA 14.

FIG. 2 is a graph showing the identification of salt tolerance of transgenic maize plants pCAMBIA3301-pUbi-NFYA14 under laboratory conditions.

FIG. 3 shows the plant height of transgenic maize SR801 plants of each generation after field planting.

FIG. 4 shows the ear height of transgenic maize SR801 plants of each generation after field planting.

FIG. 5 shows the weight per hundred grains of transgenic maize SR801 plants grown in field.

FIG. 6 shows the pollen scattering time of transgenic maize SR801 plants of each generation under field planting.

FIG. 7 shows the interval period of the loose powder and the silking of each generation of transgenic corn SR801 planted in the field.

FIG. 8T 4-T6 Bar gene promoter of transgenic SR801 and partial Bar gene detection result M: marker; lane 1: wild plantA type strain plant; lane 2: a plasmid; lane 3: transgenic line plants of generation T4; lane 4: transgenic line plants of generation T5; lane 5: transgenic line plants of generation T6; lane 6: sterile ddH₂O; sample loading amount: m: 5uL lanes 1-6: sample 5uL + Loading5 uL.

FIG. 9T 4-T6 Bar gene terminator of transgenic SR801 and partial Bar gene detection result M: marker; lane 1: a wild type strain plant; lane 2: transgenic line plants of generation T4; lane 3: transgenic line plants of generation T5; lane 4: transgenic line plants of generation T6; lane 5: a plasmid; lane 6: sterile ddH₂O; sample loading amount: m: 5 uL; lanes 1-6: sample 5uL + Loading5 uL.

FIG. 10 PCR detection of UBI promoter of transgenic SR 801M: marker; lane 1: a wild type strain plant; lane 2: a plasmid; lane 3: transgenic line plants of generation T4; lane 4: transgenic line plants of generation T5; lane 5: transgenic line plants of generation T6; lane 6: sterile ddH 2O; sample loading amount: m: 5 uL; lanes 1-6: sample 5uL + Loading5 uL.

FIG. 11 PCR detection result M for NOS terminator of transgenic SR 801: marker; lane 1: a wild type strain plant; lane 2: a plasmid; lane 3: transgenic line plants of generation T4; lane 4: transgenic line plants of generation T5; lane 5: transgenic line plants of generation T6; lane 6: sterile ddH 2O; sample loading amount: m: 5 uL; lanes 1-6: sample 5uL + Loading5 uL.

FIG. 12 PCR assay result M specific for transgenic SR 801: marker; 1, 6: positive control (passage T1); 2, 7: SR 801F 1 corn line, SR801 BC1F1 corn line; SR801 BC2F1 corn line; 5, 10: negative control; sample loading amount: m: 5 uL; lanes 1-10: sample 5uL + Loading5 uL.

Detailed Description

The invention is further described with reference to the following figures and specific embodiments.

The experimental methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used, unless otherwise specified, are commercially available; quantitative tests are carried out, three times of repeated experiments are set, and the results are averaged; the pCAMBIA3301-Ubi vector is a vector obtained by modifying on the basis of pCAMBIA3301 plasmid; the pCAMBIA3301-Ubi vector contains a target gene insert (Pubi-polyclonal excision site-Tnos) and a herbicide-tolerant glufosinate-ammonium gene Bar expression cassette (CaMV35S promoter-Bar gene-TCaMV) from streptomyces hygroscopicus; the pCAMBIA3301 plasmid is a product of the Australia CAMBIA (center for the Application of Molecular Biology to International organization culture); the YEP solid culture medium comprises the following components: 10g/L of NaCl, 5g/L of yeast powder and 10g/L of peptone; the formulation of selection medium S1 was as follows: N61L, cef250 mg/L, proline 700mg/L, bialaphos 1.5mg/L, sucrose 30g/L, agar 8 g/L; the formulation of the screening medium S2 is as follows: N61L, cephalosporin 250mg/L, proline 700mg/L, bialaphos 3.0 mg/L, sucrose 30g/L and agar 8 g/L.

Example 1 acquisition, salt tolerance identification and agronomic trait analysis of transgenic pCAMBIA3301-Ubi-NFYA14 maize

First, transfer pCAMBIA3301-Ubi-NFYA14 corn and obtain

1. Obtaining of plasmid vector containing foreign Gene

The construction process is as follows: pCAMBIA3301 was double-cut with EcoRI and PmlI to obtain a linearized vector backbone. Designing a primer with a sequence homologous to a vector framework, carrying out PCR amplification on Pubi by taking corn genomic DNA as a template, and adding a UBI promoter with the homologous sequence through PCR. Then, the Ubi promoter is recombined onto a3301 skeleton by a seamless cloning technology to obtain a3301 vector-3301 Ubi-new vector with the Ubi promoter. PmlI is used for singly cutting the vector to be used as a framework, corn genome cDNA is used as a template, ZmNF-YA14 gene is added with a homologous sequence by PCR and recombined with the vector to obtain the pCAMBIA3301-Ubi-NFYA14 plant expression vector. The map of the pCAMBIA3301-Ubi-NFYA14 vector is shown in FIG. 1.

The names and positions of the specific components of the plasmid vector pCAMBIA3301-Ubi-NFYA14 for corn transformation are shown in Table 1. Wherein the nucleotide sequence of the T-DNA gene is shown as SEQ ID NO: 5, respectively. SEQ ID NO: 5 comprises a complete salt-tolerant stress gene ZmNF-YA14 expression frame and a herbicide-tolerant glufosinate-ammonium gene bar expression frame.

The expression frame of the salt-tolerant stress gene ZmNF-YA14 is composed of the following parts: a corn ZmUbi promoter, a salt-tolerant stress gene ZmNF-YA14 and a nos terminator. Wherein, the ZmUbi promoter has the size of 2001bp, is a constitutive promoter and can drive the target gene to be expressed in all tissues of the corn. The full length of the salt-tolerant stress gene ZmNF-YA14 is 1048bp, and the nucleotide sequence is shown as SEQID NO: 3, respectively. The NOS terminator is 269bp in size, comes from a nopaline synthetase gene terminator in a T-DNA region of an Agrobacterium tumefaciens Ti plasmid, and terminates the transcription of the ZmNF-YA14 gene.

The herbicide-resistant glufosinate-ammonium gene Bar expression frame specifically comprises the following parts: the promoter CaMV35S, the herbicide-resistant glufosinate-ammonium gene Bar and the terminator CaMV polyA. The size of the CaMV35S promoter is 781bp, is derived from cauliflower mosaic virus CaMV, and is responsible for starting the expression of the plant glufosinate-resistant gene Bar. The herbicide-resistant glufosinate-ammonium gene Bar has a full length of 552bp, and the nucleotide sequence is shown as SEQ ID NO: 4, respectively. The CaMV polyA terminator has the size of 1bp and terminates the transcription of the Bar gene.

2. Obtaining of recombinant bacteria

And (2) introducing the recombinant vector pCAMBIA3301-pUbi-NFYA14 obtained in the step (1) into the agrobacterium EHA105 to obtain a recombinant strain.

3. Transfer of pCAMBIA3301-pUbi-NFYA14 maize

Transforming the recombinant bacteria obtained in the step 2 into young ears of corn B104 by adopting an agrobacterium-mediated method to obtain T0 generation transgenic pCAMBIA3301-pUbi-NFYA14 corn, which comprises the following specific steps:

(1) and (3) coating the recombinant bacteria (the agrobacterium EHA105 containing pCAMBIA3301-pUbi-NFYA 14) obtained in the step (2) on a YEP solid culture medium, and performing dark culture at the temperature of 28 ℃ for 1-3 days. Scraping the cultured agrobacterium tumefaciens from the plate, resuspending the agrobacterium tumefaciens, adjusting OD550 to 0.3, and preparing an infection solution for later use;

(2) taking corn B104 young ears 9-12 days after pollination, peeling off bracts, sterilizing with 75% alcohol for 10min, peeling off young embryos, putting the young embryos in a centrifuge tube filled with 2mL of resuspension, and keeping 100 young embryos in each tube for later use;

(3) discarding the resuspension during infection, adding 2mL of the infection solution, gently inverting the centrifuge tube for several times, mixing, and standing at room temperature in the dark for 5 min. After infection, the scutellum of the young embryo is upwards inoculated in a co-culture medium and cultured in dark at 20 ℃ for 3 days. Transferred to a resting medium and cultured in the dark at 28 ℃ for 7 days. Then transferred to a selection medium S1 containing 1.5mg/L bialaphos, and cultured at 28 ℃ for 2 weeks in the dark. If the initial callus has been obtained, it is transferred to selection medium S2 containing 3mg/L bialaphos, after which the medium is changed every two weeks S2;

(4) when the screened resistant callus proliferates to about 2cm in diameter, the callus is transferred to a dark differentiation medium and cultured in the dark at 25 ℃ for 2-3 weeks. The coleoptiles obtained by differentiation were transferred to a light differentiation medium and cultured at 25 ℃ for 2 weeks under light. And after the coleoptile forms complete seedlings and roots, transferring the seedlings into a culture bottle to promote and strengthen the roots. After 10 days, the seedlings were transplanted into a nutrition pot and cultured in an indoor greenhouse. And (3) moving the seedlings into a large flowerpot after 1-2 new leaves grow out, transferring the seedlings to a large greenhouse, and then performing daily management according to a conventional method. After the pollen of the tassel is scattered, selfing and pollination are carried out.

100T 0 generation transfer pCAMBIA3301-pUbi-NFYA14 corn strains are obtained by an agrobacterium-mediated method, positive plants are screened through PCR identification, the T1 generation transfer pCAMBIA3301-pUbi-NFYA14 corn seeds which are positive in PCR identification are harvested, and T2 generation transfer pCAMBIA3301-pUbi-NFYA14 corn strains are obtained after planting and identification in a greenhouse. This was repeated until positive T3, T4, T5, T6 transgenic pCAMBIA3301-pUbi-NFYA14 maize lines were obtained.

The T6 generation pCAMBIA3301-pUbi-NFYA14 maize strain was hybridized with Zheng 58 to obtain F1 generation pCAMBIA3301-pUbi-NFYA14 maize strain. Subsequently, after backcrossing with Zheng 58 for 2 generations, a BC2 backcross population of the pCAMBIA3301-pUbi-NFYA14 corn strain is obtained.

TABLE 1 pCAMBIA3301-Ubi-NFYA14 vector elements information Table

Second, the salt tolerance identification of the transgenic corn pCAMBIA3301-pUbi-NFYA14

The T4, T5 and T6 generation pCAMBIA3301-pUbi-NFYA14 maize strains are treated with 100mmol/L salt solution for 24 days under laboratory conditions, and meanwhile, the salt tolerance condition of the pCAMBIA3301-pUbi-NFYA14 maize strains is observed by taking wild type maize B104 as a control.

The results are shown in FIG. 2. Compared with wild corn B104 plants, the T4, T5 and T6 generation transgenic pCAMBIA3301-pUbi-NFYA14 corn strains have obviously increased salt tolerance.

Thirdly, obtaining of transformation event SR801 of corn transformed with pCAMBIA3301-pUbi-NFYA14 and analyzing agronomic traits

T4, T5 and T6 generation positive transgenic pCAMBIA3301-pUbi-NFYA14 corn strains are cultivated in a laboratory indoor environment, salt treatment is carried out on the corn strains, meanwhile, wild type corn B104 is used as a control, and finally a T6 generation transgenic pCAMBIA3301-pUbi-NFYA14 corn strain with strong salt tolerance is obtained through screening and named as a transformation event SR 801. The change situation of the agronomic traits of the transformation event SR801 and the wild corn B104 is observed through field planting.

The index measurement method specifically comprises the following steps:

1. plant height

When the plant is in the period of taking out the male and flowering, 3 corns with approximately same growth vigor are selected in each cell, and the distance from the ground to the highest point of the plant is measured by a ruler.

The results are shown in FIG. 3. The results show that: from three consecutive generations (T4, T5, T6), the transformation event SR801 was not significantly different from wild-type maize B104 in plant height.

2. High ear position

3 corn plants with approximately the same growth vigor were selected per cell and the height from the ground to the head stalk node of the plant was measured with a ruler.

The results are shown in FIG. 4. The results show that: from three consecutive generations (T4, T5, T6), the transformation event SR801 was not significantly different from wild-type maize B104 in ear height.

3. Weight of hundred grains

Randomly weighing 100 grains at the same position of the corn ear with approximately same growth vigor, repeatedly sampling for 3 times, and taking the average of two similar grains.

The results are shown in FIG. 5. The results show that: from three consecutive generations (T4, T5, T6), the transformation event SR801 was not significantly different from wild-type maize B104 in terms of grain weight.

4. Time of powder scattering

Counting the days for starting the flour scattering of 3 corns with approximately same growth vigor in each cell from the beginning of sowing.

The results are shown in FIG. 6. The results show that: from three consecutive generations (T4, T5, T6), there was no significant difference in the onset of transformation event SR801 versus the comparative break-out time for wild-type maize B104.

5. Interval period of loose powder and spinning

3 corns with approximately same growth vigor are selected in each cell, and the days of the interval period of the loose powder and the silking are observed and counted.

The results are shown in FIG. 7. The results show that: from three consecutive generations (T4, T5, T6), the transformation event SR801 was not significantly different from wild-type maize B104 versus the interval between polled silks.

6. Character identification of target gene Bar

The glufosinate-resistant capability of the transgenic corn SR801 in different generations is evaluated. The specific evaluation method is as follows: and respectively spraying 4 times of glufosinate-ammonium herbicide to the transgenic corn SR801 and the control thereof in the 6-8 leaf period, and counting the mortality rate of the transgenic corn SR801 and the control.

The results are shown in Table 2. The results show that: the glufosinate-ammonium resistance of the transgenic corn SR801 of different generations is obviously higher than that of a control material, and the glufosinate-ammonium resistance is stable, which indicates that Bar gene target characters in the transgenic corn are stable in performance.

TABLE 2 Glufosinate tolerance test for transgenic maize of different generations

Corn material	Generation T4	Generation T5	Generation T6
				SR801	Has no obvious phytotoxicity	Has no obvious phytotoxicity	Has no obvious phytotoxicity
Control	All died	All died	All died

Example 2 genetic stability testing of transformation event SR801

Bar gene genetic stability PCR results and analysis

The Bar gene promoter and a part of the Bar gene, the terminator and a part of the Bar gene of the transgenic line plants of the T4-T6 generation are detected and analyzed.

TABLE 3 primer sequences

Primer name	Upstream primer sequence 5'-3'	Downstream primer sequence 5'-3'	Size of product
				Bar2F/2R	cttcagcaggtgggtgtaga	atttggagaggacacgctga	394bp
Bar1F/1R	ccctaattcccttatctgggaac	accactacatcgagacaagc	562bp

TABLE 4 PCR reaction System

Components	Dosage of
		10×PCR Buffer(with MgCl2)	1ul
dNTP(2 .5mM)	0.2ul
		Left primer(10uM)	0.2ul
Right primer(10uM)	0.2ul
		Taq polymerase(5U/ul)	0.1ul
DNA(50ng/ul)	1ul
		ddH2O	7.3ul
Total	10ul

TABLE 5 PCR reaction conditions

	Number of cycles	Time of day	Temperature of
				Denaturation of the material	1	5min	95°
Denaturation of the material	35	30s	95°
				Annealing	35	40s	56°
Extension of	35	45s	72°
				Extension of	1	10min	72°
Preservation of	-	-	4°

After the PCR reaction, 1% agarose gel was prepared, the PCR products were subjected to spot electrophoresis for 25min, and the results were observed by a gel imaging system and photographed.

This example uses PCR technology to test the genetic stability of transgenic plants. In the aspect of primer design, a traditional method is not adopted to design primers for a promoter, a terminator and a Bar gene, but the promoter and a part of the Bar gene and the terminator and a part of the Bar gene are bundled to design the primers. The PCR results in FIG. 8 and FIG. 9 demonstrate that the promoter, terminator and Bar genes are related to each other, and that the results are bright and correspond to the correct Marker band. This result indicates that the Bar gene is stably integrated in the transgenic line plants of the T4-T6 generation of SR801 and can be stably inherited.

Second, ZmNF-YA14 gene genetic stability PCR result and analysis

PCR detection is carried out on transgenic line plants of T4-T6 generation, PCR detection is carried out on UBI promoters of T4-T6 generation and ZmNF-YA14 generation, a forward primer is set on the UBI promoter, and a reverse primer is set on the ZmNF-YA14 gene. For PCR detection of the NOS terminator of the T4-T6 generation and ZmNF-YA14, the forward primer was set to the ZmNF-YA14 promoter, and the reverse primer was set to the NOS gene.

TABLE 6 primer sequences

Primer name	Upstream primer sequence	Sequence of downstream primer	Size of product
				UBI-F/R	gcggtcgttcatacgttcta	tcctgacaaggaaccatggt	501bp
NOS-F/R	cagcgtgtttccaccataag	atgacaccgcgcgcgataat	368bp

TABLE 7 PCR reaction System

Components	Dosage of
		10×PCR Buffer(with MgCl2)	1ul
dNTP(2 .5mM)	0.2ul
		Left primer(10uM)	0.2ul
Right primer(10uM)	0.2ul
		Taq polymerase(5U/ul)	0.1ul
DNA(50ng/ul)	1ul
		ddH2O	7.3ul
Total	10ul

TABLE 8 PCR reaction conditions

	Number of cycles	Time of day	Temperature of
				Denaturation of the material	1	3min	95°
Denaturation of the material	35	30s	95°
				Annealing	35	40s	56°
Extension of	35	40s	72°
				Extension of	1	10min	72°
Preservation of	-	-	4°

After the PCR reaction, 1% agarose gel was prepared, the PCR products were subjected to spot electrophoresis for 25min, and the results were observed by a gel imaging system and photographed. The results are shown in FIGS. 10 and 11.

As shown in FIG. 10, the PCR amplification product size of the positive plasmid control is 501bp, the negative control has a darker band, the amplification size of the target fragment is consistent with that of the PCR of the positive plasmid control, and the result is expected, which indicates that the UBI promoter driving the ZmNF-YA14 gene is stably integrated into the maize genome.

As shown in FIG. 11, the result shows that the PCR amplification product size of the positive plasmid control is 368bp, the negative control has no band, the amplification size of the target fragment is consistent with the PCR size of the positive plasmid control, and the result is expected to indicate that the NOS terminator is stably integrated into the maize genome.

The PCR detection of transgenic line plants of T4-T6 generation determines that the main elements of the transgenic line SR801 are stably integrated in different generations and can be inherited for multiple generations continuously.

Example 3 cultivation of salt-tolerant glufosinate-tolerant maize varieties

1. Taking a T6 generation inbred line of a transformation event SR801 as a donor parent, taking a maize inbred line Zheng 58 as a receptor parent to perform primary hybridization to obtain hybrid progeny, backcrossing the hybrid progeny and Zheng 58, using glufosinate to eliminate a segregating line which does not contain an SR801 transgenic composite structure in each generation in the backcrossing process, and continuously backcrossing for 6 times to obtain a BC6 generation line.

2. DNA was extracted from the leaf tissue of the BC6 generation strain, PCR-amplified using the primers PR1 and PR2 identified by the specific PCR for the maize transformation event SR801 in example 2, and the exogenous insert gene and its flanking DNA fragments were amplified and verified by sequencing. Sequencing analysis proves that the sequence is consistent with the transgenic structure sequence of the donor parent, which indicates that the SR801 transformation event is stably transferred into new acceptor materials.

3. The strain of BC6 generation is used as female parent, and Chang 7-2 is used as male parent to make hybridization to obtain hybrid, and the primers PR1 and PR2 identified by the specific PCR of the maize transformation event SR801 in example 2 are used to make analysis and sequencing of the exogenous insertion gene and its flanking DNA sequence. The results show that: this hybrid contains the transformation event SR 801.

4. And (4) carrying out a field resistance test on the hybrid obtained in the step (3). And (3) spraying glufosinate-ammonium with the concentration of 0.18% in the seedling stage, counting the number of dead plants and survival indexes, and calculating the death rate of the hybrid seeds so as to reflect the herbicide glufosinate-ammonium tolerance capability of the hybrid seeds. And (3) carrying out a laboratory resistance test on the hybrid obtained in the step (3). And (3) carrying out 175mmol/L salt solution treatment in the seedling stage, observing the growth condition of the plants, counting the number of dead plants and survival indexes, and calculating the death rate of the hybrid seeds so as to reflect the salt stress resistance of the hybrid seeds. The result shows that the hybrid has good capability of salt tolerant herbicide glufosinate.

Example 4 flanking sequence analysis and specific PCR detection of transformation event SR801

In the experimental research, the integration of the exogenous target gene in the corn genome is detected by using a re-sequencing method and a PCR (polymerase chain reaction) technology, and the integration of the insertion sequence on the corn chromosome is found. The gene of interest was detected in all 3 generations (T4, T5, and T6), indicating that the insert was present in integrated form. The insertion of the exogenous gene of SR801 into the corn genome Chr5: 21,908,318-21,913,504 is preliminarily confirmed by a whole genome re-sequencing method.

The integration position of the target gene in the genome is determined by a high-throughput re-sequencing method and a PCR combined sequencing method in an intermediate test stage, the flanking sequence of the SR801 event is sequenced by PCR, and the maize ZmNF-YA14 gene is shown as SEQ ID NO: 3, the left flanking sequence is shown as SEQ ID NO: 1, and the right flank sequence is shown as SEQ ID NO: 2, the primer pair A detected by the specific PCR consists of SEQ ID NO: 6 and the single-stranded DNA molecule shown in SEQ ID NO: 7, and the primer pair B for specific PCR detection consists of SEQ ID NO: 8 and a single-stranded DNA molecule as set forth in SEQ ID NO: 9, and (b) a single-stranded DNA molecule as shown in figure 9.

TABLE 9 primer sequences

Primer name	Upstream primer sequence	Sequence of downstream primer	Size of product
				Primer pair A	gacgtccacatccacttcac	gtttcgctcatgtgttgagc	899bp
Primer pair B	aggtgaccagctcgaatttc	ccctctcact gtataagacg	1046bp

TABLE 10 PCR reaction System

Components	Dosage of
		10×PCR Buffer(with MgCl2)	1ul
dNTP(2 .5mM)	0.2ul
		Left primer(10uM)	0.2ul
Right primer(10uM)	0.2ul
		Taq polymerase(5U/ul)	0.1ul
DNA(50ng/ul)	1ul
		ddH2O	7.3ul
Total	10ul

TABLE 11 PCR reaction conditions

	Number of cycles	Time of day	Temperature of
				Denaturation of the material	1	3min	94°
Denaturation of the material	35	30s	94°
				Annealing	35	40s	58°
Extension of	35	40s	72°
				Extension of	1	10min	72°
Preservation of	-	-	4°

After the PCR reaction, 1% agarose gel was prepared, the PCR products were subjected to spot electrophoresis for 25min, and the results were observed by a gel imaging system and photographed. The results are shown in FIG. 12.

The designed specific PCR detection primer is used, the transgenic corn SR801, the positive control and the negative control are used as templates, one-time amplification is carried out, the results of 3-time repeated PCR are consistent, and the result shows that the primer can specifically detect the transgenic corn SR801 and the progeny thereof.

Sequence listing

<110> institute of biotechnology of Chinese academy of agricultural sciences

<120> transgenic salt-tolerant herbicide-resistant corn SR801 exogenous insertion flanking sequence and application thereof

<160>9

<170>SIPOSequenceListing 1.0

<210>1

<211>1029

<212>DNA

<213> corn (Zea mays)

<400>1

ctgctgtacg gcgctcccgg cacgggcaag tccacgttcg ccgccgcgat ggcgaggttc 60

ctggggtacg acgtctacga cgtggacctg tcccgcggcg gctgcgacga cctccgcgcc 120

ctgctcctgg acaccgcccc gcggtcgctc atcctcgtgg aggacctcga ccgctacctg 180

cgcggcgggg acggcgagac ggcggcggcg aggaccgcgc gcgtgctcgg cttcatggac 240

gggctctcct cgtcatgcgg cgaggagcgc gtgatggtgt tcaccatgag cgggggcaag 300

gacggcgtgg acccggccgt gctgcggccc ggccggctcg acgtccacat ccacttcacr 360

catgtgcgac ttcgagggat tcaaggctcr tggcgagcaa ctacctgggg ctcaaggacc 420

acaagctgta cccgcaggtg gaggaggggt tccacgccgg cgcccgcctc agccccgccg 480

agctcggcga gatcatgctc gccaaccgcg ggtccgcgag ccgcgcgctc cgcaccgtca 540

tcagcgcgct gcagcacgtg gccccgtcac cgcctccgca gcggaccgtc accgcggcgc 600

ggccgccgag gctgacatcg agatggtccg ggcacctcgacgaggccagc gtcgcgaccg 660

cgacgtccga ggccagcgcg gcggggcagt cgccgcgggg cgggggaggt ttcgccaagg 720

acgcgccgat cagggagatc aagaagctct acggtctgat caagtacagg agccgcaagg 780

acgccggcgt cgtgccggtg gatgacagcg cggcatcgcc ggacgggcgg gacagcgacg 840

ttagccccga gaaggaccgg tgattagtta tctgtgtttt cttttttttt ttcgttttca 900

cttttgataa tgggttctaa agtagtagta caaattactg tttattcgaa acgtgggtgg 960

atgtacattc tgcactgtaa atctttgtag cactagaggc tttctcatta ctcgagaaaa 1020

aaacgtgtt 1029

<210>2

<211>900

<212>DNA

<213> corn (Zea mays)

<400>2

tggtaaccgc ttcttcgcag tttggcacgc aaaatcgcgg tcaatgagcc caattgacat 60

tctggtgaca ccttatgcga aatactcagg tgcaatagaa tagcaaattc tcaacaacga 120

ctaacaacca ggactctgta tgtttgttag tttgaagttg aagtagtcaa agatcttatt 180

cttgtttgcc aaaagaacag aaatctgaca ttagtttcca aacaccgtga tttgcgcgct 240

ttgtaccaat ctctgtcacc gagctagcac tgccactaat cctgtcctgg accaccgtcg 300

ctggtccgtc ctagtcccct cgcgggagcc ggcggcttgg ggacaatcgt cgccgattcc 360

tttgcccacc atactgcgat ttgatgaagc gccgggctgg ctgcggttgc cacatcgcca 420

taacaccgct ttcaggtgtt agctcgcgtc tgtttcggct ctgccttgcg cttaactgtc 480

ttttcgtttg gttcctatag tatttttgtc cttataaatt acagctgcagcaatcaaaca 540

gcccacttta attcgaaaca aacaaccgac ttttaaatag tattgtacaa tatatacttc 600

atctgtccta taatataatg tataaccatt tttatttttg tcctataata taagacatgt 660

tatctttaaa cacacgtaca tcgatgcaat agcatagata aaattaaata tatttattgg 720

cttttgaact agagtagagt tagttacgtc ttatacagtg agagggagta atatatactg 780

tatagtacat atactgtaca gtagcaaagg acacgcgtgg ttacgaggtg ctagacaatg 840

agatgaagca aagacgccca ttattattgc acttagaggc tggcgatgat gattaggggc 900

<210>3

<211>1048

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

atgtgccttt tacgggaaat ggaggatcat tatgtccatc ccaagtctaa gtctaaccat 60

ggctccttgt caggaaatgg ttatgagatg aaaaatccag gccatgaagt ttgtgatagg 120

gattcatcat cagagtctga tcgatctcac ccagaagcat cagcagtgag tgaaagcagt 180

ctagatgaac acacatcaac tcaatcagac aatgatgaag atcatgggaa ggataatcag 240

gacacattga agccagtatt gtccttgggg aaggaagggt ctgccttttt ggccccaaaa 300

atagattaca acccatcttt tgcttatatt ccttatactg ctgatgctta ctatggtggc 360

gttggggtct tgacaggata tgctccacat accattgtcc atccccagca aaatgataca 420

acaaatagtc cggttatgtt gcctgcggaa cctgcagaag aagaaccaat atatgtcaat 480

gcaaaacaat accatgcaat ccttaggagg aggcagacac gtgctaaact ggaggcgcag 540

aacaagatgg tgaaaggccg gaagccatac cttcatgagt ctcgacaccg tcatgccatg 600

aagcgggccc gtggctcagg agggcggttc ctcaacacaa agcagcagcc ccaggagcag 660

aaccagcagt accaggcgtc gagtggttca atgtgctcaa agaccattgg caacagcgta 720

atctcccaaa gtggccccat ttgcacgccc tcttctgacg ctgcaggtgc ttcagcagcc 780

agccaggacc gcggctgctt gccctcggtg ggcttccgcc ccacagccaa cttcagtgag 840

caaggtggag gcggctcgaa gctggtcgtg aacggcatgc agcagcgtgt ttccaccata 900

aggtgaagag aagtgggcac gacaccattc ccaggcgcgc actgcctgtg gcaactcatc 960

cttggctttt gaaactatgg atatgcaatg gacatgtagc ttcgagttcc tcagaataac 1020

caaacgtgaa gaatatgcaa agtccttt 1048

<210>4

<211>552

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

atgagcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcg 60

gtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg 120

caggaaccgc aggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc 180

gtcgccgagg tggacggcga ggtcgccggc atcgcctacg cgggcccctg gaaggcacgc 240

aacgcctacg actggacggc cgagtcaacc gtgtacgtct ccccccgcca ccagcggacg 300

ggactgggct ccacgctcta cacccacctg ctgaagtccc tggaggcaca gggcttcaag 360

agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgca cgaggcgctc 420

ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgac 480

gtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc 540

accgagatgt ga 552

<210>5

<211>11417

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

aattcaagct tgcagtgcag cgtgacccgg tcgtgcccct ctctagagat aatgagcatt 60

gcatgtctaa gttataaaaa attaccacat attttttttg tcacacttgt ttgaagtgca 120

gtttatctat ctttatacat atatttaaac tttactctac gaataatata atctatagta 180

ctacaataat atcagtgttt tagagaatca tataaatgaa cagttagaca tggtctaaag 240

gacaattgag tattttgaca acaggactct acagttttat ctttttagtg tgcatgtgtt 300

ctcctttttt tttgcaaata gcttcaccta tataatactt catccatttt attagtacat 360

ccatttaggg tttagggtta atggttttta tagactaatt tttttagtac atctatttta 420

ttctatttta gcctctaaat taagaaaact aaaactctat tttagttttt ttatttaata 480

atttagatat aaaatagaat aaaataaagt gactaaaaat taaacaaata ccctttaaga 540

aattaaaaaa actaaggaaa catttttctt gtttcgagta gataatgcca gcctgttaaa 600

cgccgtcgac gagtctaacg gacaccaacc agcgagccag cagcgtcgcg tcgggccaag 660

cgaagcagac ggcacggcat ctctgtcgct gcctctggac ccctctcgag agttccgctc 720

caccgttgga cttgctccgc tgtcggcatc cagaaattgc gtggcggagc ggcagacgtg 780

agccggcacg gcaggcggcc tcctcctcct ctcacggcac cggcagctac gggggattcc 840

tttcccaccg ctccttcgct ttcccttcct cgcccgccgt aataaataga caccccctcc 900

acaccctctt tccccaacct cgtgttgttc ggagcgcaca cacacacaac cagatctccc 960

ccaaatccac ccgtcggcac ctccgcttca aggtacgccg ctcgtcctcc cccccccccc 1020

ctctctacct tctctagatc ggcgttccgg tccatggtta gggcccggta gttctacttc 1080

tgttcatgtt tgtgttagat ccgtgtttgt gttagatccg tgctgctagc gttcgtacac 1140

ggatgcgacc tgtacgtcag acacgttctg attgctaact tgccagtgtt tctctttggg 1200

gaatcctggg atggctctag ccgttccgca gacgggatcg atttcatgat tttttttgtt 1260

tcgttgcata gggtttggtt tgcccttttc ctttatttca atatatgccg tgcacttgtt 1320

tgtcgggtca tcttttcatg cttttttttg tcttggttgt gatgatgtgg tctggttggg 1380

cggtcgttct agatcggagt agaattaatt ctgtttcaaa ctacctggtg gatttattaa 1440

ttttggatct gtatgtgtgt gccatacata ttcatagtta cgaattgaag atgatggatg 1500

gaaatatcga tctaggatag gtatacatgt tgatgcgggt tttactgatg catatacaga 1560

gatgcttttt gttcgcttgg ttgtgatgat gtggtgtggt tgggcggtcg ttcatacgtt 1620

ctagatcgga gtagaatact gtttcaaact acctggtgta tttattaatt ttggaactgt 1680

atgtgtgtgt catacatctt catagttacg agtttaagat ggatggaaat atcgatctag 1740

gataggtata catgttgatg tgggttttac tgatgcatat acatgatggc atatgcagca 1800

tctattcata tgctctaacc ttgagtacct atctattata ataaacaagt atgttttata 1860

attattttga tcttgatata cttggatgat ggcatatgca gcagctatat gtggattttt 1920

ttagccctgc cttcatacgc tatttatttg cttggtactg tttcttttgt cgatactcac 1980

cctgttgttt ggtgttactt ctgcagtaga cgcgtggatc cgagctcaca tgtgcctttt 2040

acgggaaatg gaggatcatt ctgtccatcc aaagtctaag tctaaccatg gttccttgtc 2100

aggaaatggt tatgagatga aaaatccagg ccatgaagtt tgtgataggg attcatcatc 2160

agagtctgat cgatctcacc cagaagcatc agcagtgagt gaaagcagtc tagatgaaca 2220

cacatcaact caatcagaca atgatgaaga tcatgggaag gataatcagg acacattgaa 2280

gccagtattg tccttgggga aggaagggtc tgcctttttg gccccaaaaa tagattacaa 2340

cccgtctttt ccttatattc cttatactgc tgacgcttac tatggtggcg ttggggtctt 2400

gacaggatat gctccgcatg ccattgtcca tccccagcaa aatgatacaa caaatagtcc 2460

ggttatgttg cctgcggaac ctgcagaaga agaaccaata tatgtcaatg caaaacaata 2520

ccatgcgatc cttaggagga ggcagacacg tgctaaactg gaggcgcaga acaagatggt 2580

gaaaggtcgg aagccatacc ttcatgagtc tcgacaccgt catgccatga agcgggcccg 2640

tggctcagga gggcggttcc tcaacacaaa gcagcagctc caggagcaga accagcagta 2700

ccaggcgtcg agtggttcaa tgtgctcaaa gaccattggc gacagcgtaa tctcccaaag 2760

tggccccatt tgcacgccct cttctgacgc tgcaggtgct tcagcagcca gccaggaccg 2820

cggctgcttg ccctcggttg gcttccgccc cacagccaac ttcagtgagc aaggtggagg 2880

cggctcgaag ctggtcgtga acggcatgca gcagcgtgtt tccaccataa gggtgtgaat 2940

tacaggtgac cagctcgaat ttccccgatc gttcaaacat ttggcaataa agtttcttaa 3000

gattgaatcc tgttgccggt cttgcgatga ttatcatata atttctgttg aattacgtta 3060

agcatgtaat aattaacatg taatgcatga cgttatttat gagatgggtt tttatgatta 3120

gagtcccgca attatacatt taatacgcga tagaaaacaa aatatagcgc gcaaactagg 3180

ataaattatc gcgcgcggtg tcatctatgt tactagatcg ggaattaaac tatcagtgtt 3240

tgacaggata tattggcggg taaacctaag agaaaagagc gtttattaga ataacggata 3300

tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg tatgtgcatg ccaaccacag 3360

ggttcccctc gggatcaaag tactttgatc caacccctcc gctgctatag tgcagtcggc 3420

ttctgacgtt cagtgcagcc gtcttctgaa aacgacatgt cgcacaagtc ctaagttacg 3480

cgacaggctg ccgccctgcc cttttcctgg cgttttcttg tcgcgtgttt tagtcgcata 3540

aagtagaata cttgcgacta gaaccggaga cattacgcca tgaacaagag cgccgccgct 3600

ggcctgctgg gctatgcccg cgtcagcacc gacgaccagg acttgaccaa ccaacgggcc 3660

gaactgcacg cggccggctg caccaagctg ttttccgaga agatcaccgg caccaggcgc 3720

gaccgcccgg agctggccag gatgcttgac cacctacgcc ctggcgacgt tgtgacagtg 3780

accaggctag accgcctggc ccgcagcacc cgcgacctac tggacattgc cgagcgcatc 3840

caggaggccg gcgcgggcct gcgtagcctg gcagagccgt gggccgacac caccacgccg 3900

gccggccgca tggtgttgac cgtgttcgcc ggcattgccg agttcgagcg ttccctaatc 3960

atcgaccgca cccggagcgg gcgcgaggcc gccaaggccc gaggcgtgaa gtttggcccc 4020

cgccctaccc tcaccccggc acagatcgcg cacgcccgcg agctgatcga ccaggaaggc 4080

cgcaccgtga aagaggcggc tgcactgctt ggcgtgcatc gctcgaccct gtaccgcgca 4140

cttgagcgca gcgaggaagt gacgcccacc gaggccaggc ggcgcggtgc cttccgtgag 4200

gacgcattga ccgaggccga cgccctggcg gccgccgaga atgaacgcca agaggaacaa 4260

gcatgaaacc gcaccaggac ggccaggacg aaccgttttt cattaccgaa gagatcgagg 4320

cggagatgat cgcggccggg tacgtgttcg agccgcccgc gcacgtctca accgtgcggc 4380

tgcatgaaat cctggccggt ttgtctgatg ccaagctggc ggcctggccg gccagcttgg 4440

ccgctgaaga aaccgagcgc cgccgtctaa aaaggtgatg tgtatttgag taaaacagct 4500

tgcgtcatgc ggtcgctgcg tatatgatgc gatgagtaaa taaacaaata cgcaagggga 4560

acgcatgaag gttatcgctg tacttaacca gaaaggcggg tcaggcaaga cgaccatcgc 4620

aacccatcta gcccgcgccc tgcaactcgc cggggccgat gttctgttag tcgattccga 4680

tccccagggc agtgcccgcg attgggcggc cgtgcgggaa gatcaaccgc taaccgttgt 4740

cggcatcgac cgcccgacga ttgaccgcga cgtgaaggcc atcggccggc gcgacttcgt 4800

agtgatcgac ggagcgcccc aggcggcgga cttggctgtg tccgcgatca aggcagccga 4860

cttcgtgctg attccggtgc agccaagccc ttacgacata tgggccaccg ccgacctggt 4920

ggagctggtt aagcagcgca ttgaggtcac ggatggaagg ctacaagcgg cctttgtcgt 4980

gtcgcgggcg atcaaaggca cgcgcatcgg cggtgaggtt gccgaggcgc tggccgggta 5040

cgagctgccc attcttgagt cccgtatcac gcagcgcgtg agctacccag gcactgccgc 5100

cgccggcaca accgttcttg aatcagaacc cgagggcgac gctgcccgcg aggtccaggc 5160

gctggccgct gaaattaaat caaaactcat ttgagttaat gaggtaaaga gaaaatgagc 5220

aaaagcacaa acacgctaag tgccggccgt ccgagcgcac gcagcagcaa ggctgcaacg 5280

ttggccagcc tggcagacac gccagccatg aagcgggtca actttcagtt gccggcggag 5340

gatcacacca agctgaagat gtacgcggta cgccaaggca agaccattac cgagctgcta 5400

tctgaataca tcgcgcagct accagagtaa atgagcaaat gaataaatga gtagatgaat 5460

tttagcggct aaaggaggcg gcatggaaaa tcaagaacaa ccaggcaccg acgccgtgga 5520

atgccccatg tgtggaggaa cgggcggttg gccaggcgta agcggctggg ttgtctgccg 5580

gccctgcaat ggcactggaa cccccaagcc cgaggaatcg gcgtgacggt cgcaaaccat 5640

ccggcccggt acaaatcggc gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg 5700

cgcaggccgc ccagcggcaa cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag 5760

cggccgctga tcgaatccgc aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga 5820

ttaggaagcc gcccaagggc gacgagcaac cagatttttt cgttccgatg ctctatgacg 5880

tgggcacccg cgatagtcgc agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg 5940

accgacgagc tggcgaggtg atccgctacg agcttccaga cgggcacgta gaggtttccg 6000

cagggccggc cggcatggcc agtgtgtggg attacgacct ggtactgatg gcggtttccc 6060

atctaaccga atccatgaac cgataccggg aagggaaggg agacaagccc ggccgcgtgt 6120

tccgtccaca cgttgcggac gtactcaagt tctgccggcg agccgatggc ggaaagcaga 6180

aagacgacct ggtagaaacc tgcattcggt taaacaccac gcacgttgcc atgcagcgta 6240

cgaagaaggc caagaacggc cgcctggtga cggtatccga gggtgaagcc ttgattagcc 6300

gctacaagat cgtaaagagc gaaaccgggc ggccggagta catcgagatc gagctagctg 6360

attggatgta ccgcgagatc acagaaggca agaacccgga cgtgctgacg gttcaccccg 6420

attacttttt gatcgatccc ggcatcggcc gttttctcta ccgcctggca cgccgcgccg 6480

caggcaaggc agaagccaga tggttgttca agacgatcta cgaacgcagt ggcagcgccg 6540

gagagttcaa gaagttctgt ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg 6600

agtacgattt gaaggaggag gcggggcagg ctggcccgat cctagtcatg cgctaccgca 6660

acctgatcga gggcgaagca tccgccggtt cctaatgtac ggagcagatg ctagggcaaa 6720

ttgccctagc aggggaaaaa ggtcgaaaag gtctctttcc tgtggatagc acgtacattg 6780

ggaacccaaa gccgtacatt gggaaccgga acccgtacat tgggaaccca aagccgtaca 6840

ttgggaaccg gtcacacatg taagtgactg atataaaaga gaaaaaaggc gatttttccg 6900

cctaaaactc tttaaaactt attaaaactc ttaaaacccg cctggcctgt gcataactgt 6960

ctggccagcg cacagccgaa gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc 7020

tacgccccgc cgcttcgcgt cggcctatcg cggccgctgg ccgctcaaaa atggctggcc 7080

tacggccagg caatctacca gggcgcggac aagccgcgcc gtcgccactc gaccgccggc 7140

gcccacatca aggcaccctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac 7200

atgcagctcc cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc 7260

cgtcagggcg cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt 7320

agcgatagcg gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag 7380

tgcaccatat gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc 7440

gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg 7500

tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa 7560

agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg 7620

cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga 7680

ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg 7740

tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg 7800

gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc 7860

gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg 7920

gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca 7980

ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt 8040

ggcctaacta cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag 8100

ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg 8160

gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc 8220

ctttgatctt ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt 8280

tggtcatgca ttctaggtac taaaacaatt catccagtaa aatataatat tttattttct 8340

cccaatcagg cttgatcccc agtaagtcaa aaaatagctc gacatactgt tcttccccga 8400

tatcctccct gatcgaccgg acgcagaagg caatgtcata ccacttgtcc gccctgccgc 8460

ttctcccaag atcaataaag ccacttactt tgccatcttt cacaaagatg ttgctgtctc 8520

ccaggtcgcc gtgggaaaag acaagttcct cttcgggctt ttccgtcttt aaaaaatcat 8580

acagctcgcg cggatcttta aatggagtgt cttcttccca gttttcgcaa tccacatcgg 8640

ccagatcgtt attcagtaag taatccaatt cggctaagcg gctgtctaag ctattcgtat 8700

agggacaatc cgatatgtcg atggagtgaa agagcctgat gcactccgca tacagctcga 8760

taatcttttc agggctttgt tcatcttcat actcttccga gcaaaggacg ccatcggcct 8820

cactcatgag cagattgctc cagccatcat gccgttcaaa gtgcaggacc tttggaacag 8880

gcagctttcc ttccagccat agcatcatgt ccttttcccg ttccacatca taggtggtcc 8940

ctttataccg gctgtccgtc atttttaaat ataggttttc attttctccc accagcttat 9000

ataccttagc aggagacatt ccttccgtat cttttacgca gcggtatttt tcgatcagtt 9060

ttttcaattc cggtgatatt ctcattttag ccatttatta tttccttcct cttttctaca 9120

gtatttaaag ataccccaag aagctaatta taacaagacg aactccaatt cactgttcct 9180

tgcattctaa aaccttaaat accagaaaac agctttttca aagttgtttt caaagttggc 9240

gtataacata gtatcgacgg agccgatttt gaaaccgcgg tgatcacagg cagcaacgct 9300

ctgtcatcgt tacaatcaac atgctaccct ccgcgagatc atccgtgttt caaacccggc 9360

agcttagttg ccgttcttcc gaatagcatc ggtaacatga gcaaagtctg ccgccttaca 9420

acggctctcc cgctgacgcc gtcccggact gatgggctgc ctgtatcgag tggtgatttt 9480

gtgccgagct gccggtcggg gagctgttgg ctggctggtg gcaggatata ttgtggtgta 9540

aacaaattga cgcttagaca acttaataac acattgcgga cgtttttaat gtactgaatt 9600

aacgccgaat taattcgggg gatctggatt ttagtactgg attttggttt taggaattag 9660

aaattttatt gatagaagta ttttacaaat acaaatacat actaagggtt tcttatatgc 9720

tcaacacatg agcgaaaccc tataggaacc ctaattccct tatctgggaa ctactcacac 9780

attattatgg agaaactcga gcttgtcgat cgacagatcc ggtcggcatc tacttcacat 9840

ctcggtgacg ggcaggaccg gacggggcgg taccggcagg ctgaagtcca gctgccagaa 9900

acccacgtca tgccagttcc cgtgcttgaa gccggccgcc cgcagcatgc cgcggggggc 9960

atatccgagc gcctcgtgca tgcgcacgct cgggtcgttg ggcagcccga tgacagcgac 10020

cacgctcttg aagccctgtg cctccaggga cttcagcagg tgggtgtaga gcgtggagcc 10080

cagtcccgtc cgctggtggc ggggggagac gtacacggtt gactcggccg tccagtcgta 10140

ggcgttgcgt gccttccagg ggcccgcgta ggcgatgccg gcgacctcgc cgtccacctc 10200

ggcgacgagc cagggatagc gctcccgcag acggacgagg tcgtccgtcc actcctgcgg 10260

ttcctgcggc tcggtacgga agttgaccgt gcttgtctcg atgtagtggt tgacgatggt 10320

gcagaccgcc ggcatgtccg cctcggtggc acggcggatg tcggccgggc gtcgttctgg 10380

gctcatctcg agagagatag atttgtagag agagactggt gatttcagcg tgtcctctcc 10440

aaatgaaatg aacttcctta tatagaggaa ggtcttgcga aggatagtgg gattgtgcgt 10500

catcccttac gtcagtggag atatcacatc aatccacttg ctttgaagac gtggttggaa 10560

cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc atctttggga ccactgtcgg 10620

cagaggcatc ttgaacgata gcctttcctt tatcgcaatg atggcatttg taggtgccac 10680

cttccttttc tactgtcctt ttgatgaagt gacagatagc tgggcaatgg aatccgagga 10740

ggtttcccga tattaccctt tgttgaaaag tctcaatagc cctttggtct tctgagactg 10800

tatctttgat attcttggag tagacgagag tgtcgtgctc caccatgtta tcacatcaat 10860

ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgctc ctcgtgggtg 10920

ggggtccatc tttgggacca ctgtcggcag aggcatcttg aacgatagcc tttcctttat 10980

cgcaatgatg gcatttgtag gtgccacctt ccttttctac tgtccttttg atgaagtgac 11040

agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 11100

caatagccct ttggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 11160

cgtgctccac catgttggca agctgctcta gccaatacgc aaaccgcctc tccccgcgcg 11220

ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga 11280

gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt tacactttat 11340

gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag 11400

ctatgaccat gattacg 11417

<210>6

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gacgtccaca tccacttcac 20

<210>7

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

gtttcgctca tgtgttgagc 20

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

aggtgaccag ctcgaatttc 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

ccctctcact gtataagacg 20

Claims (7)

1. A transgenic salt-tolerant herbicide-tolerant corn SR801 exogenous insertion flanking sequence is characterized in that nucleotide sequences of two flanking sequences of the flanking sequence are respectively shown as a sequence table SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

2. The exogenous insertion flanking sequence of the DNA transgenic salt-tolerant herbicide-tolerant corn SR801 according to claim 1, wherein the exogenous insertion fragment comprises a corn ZmNF-YA14 gene and a glufosinate-tolerant Bar gene, and the nucleotide sequence of the corn ZmNF-YA14 gene is shown as SEQ ID NO: 3, the nucleotide sequence of the glufosinate-ammonium-resistant Bar gene is shown as SEQ ID NO: 4, respectively.

3. The use of the exogenous insertion flanking sequence of the transgenic salt-tolerant herbicide-tolerant maize SR801 as claimed in any one of claims 1-2 for detecting the transgenic maize SR 801.

4. The specific primer pair for detecting the salt-tolerant herbicide-tolerant transgenic corn SR801 has a nucleotide sequence shown in a sequence table SEQ ID NO: 6-7 or SEQ ID NO: 8-9.

5. A kit for detecting transgenic maize SR801, comprising the specific primer pair of claim 4.

6. Use of the specific primer pair of claim 4 for detecting transgenic maize SR801 parent, progeny, hybrid F1, and plants, tissues, seeds, or products thereof.

7. A method for detecting transgenic corn SR801 with salt and herbicide tolerance is characterized in that total DNA of a sample is taken as a template, a PCR reaction is carried out by utilizing the specific primer pair of claim 4, and the result is judged according to the electrophoresis fragment of the PCR product;

when the nucleotide sequence shown as SEQ ID NO: 6-7, if the size of an amplification product band is 899bp when the sample DNA is subjected to PCR amplification by the specific primer pair shown in 6-7, the sample to be detected contains the SR 801-derived component;

if the nucleotide sequence is as shown in SEQ ID NO: 8-9, if the size of the amplified product band is 1046bp, the sample to be detected contains the SR801 derived component.

Images